Маска для лица цинковая: BingoSpa — Цинковая маска для лица

Содержание

Следоцид Маска цинковая д/лица 10г

Видное, Строительная ул, д. 3, пом. 19-25
пн-вс 8:00-20:00
8 (495) 419-24-84

Голиково, Усковский пр-д, 2
пн-вс 9:00-22:00
+7 495 419-15-65

Домодедово, аэропорт, 1 этаж
пн-вс круглосуточно
8(495)419-12-83

Домодедово, аэропорт, 2 этаж

пн-вс круглосуточно
8-495-419-12-81

Жуковский, Клубная ул, 4/8
пн-вс 9:00-21:00
+7 495 221-53-88

Москва, Бутырская ул, 6
пн-вс 09:00-21:00
+7 (495) 419-30-81

Москва, Живописная ул, 12
пн-пт 8:00-22:00, сб 8:00-21:00, вс 9:00-21:00
+7 495 419-06-22

Москва, Н. Красносельская ул, 35 с 49
пн-пт 9:00-22:00, сб-вс 10:00-22:00
+7 495 419 13 48

Москва, Самора Машела ул, 2А
пн-пт 9:00-22:00, сб-вс 9:00-21:00
+7 495 419-12-51

Москва, ул. Большая Тульская, д.11
пн-пт 08:00-21:00, сб-вс 09:00-20:00
8(495) 419 30 12

Москва, ул. Сущевский вал, д.5, с.5.
пн-пт 08:00-21:00, сб-вс 09:00-20:00
8(495) 419 30 12

Ногинск, 1-ая Ильича ул, стр 6/29
пн-вс 9:00-22:00
+7 495 221-53-85

Ногинск, Дмитрия Михайлова ул, 1
пн-вс 9:00-22:00
+7 495 419-06-21

Химки, Ленинский пр, 1к1
пн-вс 8:00-21:00

+7 495 419 12 97

Южнобутовская ул. , 29к3
пн-вс 9:00-21:00
8(495)419-30-83

Маски для лица на основе биоцинка

Цинковая мазь используется человечеством уже свыше 5000 лет.
Содержат цинк: кожа, волосы, кости, ногти (когда на ногтях появляются белые пятна – это один из признаков нехватки цинка).
К источнику цинка относят: грибы, семена подсолнечника и тыквы,  мясо, печень, сельдь, креветки, устрицы.

Бад Тяньши биоцинк показана:
— когда есть  любые кожные проявления, включая те, что имеют аллергическую природу,
— чтобы устранить угревую сыпь,
— когда снижается эластичность коллагена кожи,

— для профилактики старения кожи.

Употребляем биоцинк между трапезами — до трапезы за 30 минут или спустя 1 час после трапезы, запиваем теплой водой (1 стаканом до 50°С) чтобы он лучше усваивался.

Маски для лица 

Читайте в рубрике материалы, посвящённые маскам для лица на основе Биоцинка:

Маска для лица на растворе календулы с биоцинком

Маска от прыщей на основе биоцинка

Отбеливающая маска на основе биоцинка

Питательная маска на основе биоцинка

Сухая маска на основе биоцинка

Цинковая мазь

Цинковая маска

Маска для лица на растворе календулы с биоцинком

Раздел: Маски для лица на основе биоцинка

Маска для лица на растворе календулы рекомендуется для жирной пористой кожи, она содержит биоцинк.

Дата: Вторник, 28 Декабря 2010

Маска от прыщей на основе биоцинка

Раздел: Маски для лица на основе биоцинка

Маска от прыщей на основе биоцинка регулярно используется при лечении угревой сыпи. Наносится на кожу лица косметической кисточкой

Дата: Вторник, 28 Декабря 2010

Отбеливающая маска на основе биоцинка

Раздел: Маски для лица на основе биоцинка

Каков состав отбеливающей маски на основе биоцинка и способ приготовления? Читайте в статье

Дата: Вторник, 05 Февраля 2013

Питательная маска на основе биоцинка

Раздел: Маски для лица на основе биоцинка

Кому рекомендована питательная маска на основе биоцинка? Что входит в её состав? Каков способ приготовления маски? Ответы вы найдёте в статье

Дата: Среда, 06 Февраля 2013

Сухая маска на основе биоцинка

Раздел: Маски для лица на основе биоцинка

Что входит в состав сухой маски на основе биоцинка и каков способ её приготовления? Читайте в статье

Дата: Вторник, 05 Февраля 2013

Цинковая мазь

Раздел: Маски для лица на основе биоцинка

В каких целях используется цинковая мазь? Каков её состав, как её готовить? Читайте в статье

Дата: Среда, 06 Февраля 2013

Цинковая маска

Раздел: Маски для лица на основе биоцинка

Кому рекомендована цинковая маска? Каков её состав и способ приготовления? Ответы читайте в статье

Дата: Среда, 06 Февраля 2013

Страницы:  1 Показано 17 (всего 7 статей)

Маска для лица Витэкс 45+Ночная волшебная несмываемая 100 мл

Ультраконцентрированная гиалуроновая кислота Peptide-комплекс Стволовые клетки • возвращают межклеточный объем кожи • подтягивают и укрепляют кожу лица и шеи • возвращают четкость контурам • разглаживают морщины Формула ночной крем-маски обеспечивает волшебное преображение Вашей кожи, дарит ей свежий и отдохнувший вид и молодость. Ночная маска совершает свое волшебство, пока Вы спите: восстанавливает межклеточный объем, моделирует овал лица, разглаживает морщины, обеспечивая коже длительное увлажнение. Активные компоненты: ультраконцентрированная гиалуроновая кислота, peptide-комплекс Renaissance®, стволовые клетки. Применение: нанесите крем-маску за 30-40 минут до сна тонким слоем на щеки, лоб и подбородок. Избегайте попадания в глаза. Не смывайте! Состав: вода, циклопентасилоксан, циклогексасилоксан, кроссполимер диметикона, сорбитанстеарат, сорбитиллаурат, гиалуронат натрия, сквалан, масло Butyrospermum parkii (ши), ксантановая камедь, гидролизованный белок пшеницы, пальмитоилдекапептид-21, цинковая соль пальмитоилдекапептида-14, декапептид-22, олигопептид-78, карбомер, полисорбат-20, пальмитоилолигопептид, пальмитоилтетрапептид-7, экстракт Echinacea purpurea (эхинацеи), экстракт корня Panax Ginseng (женьшеня), кроссполимер диметикона и винилдиметикона, диоксид кремния, масло семян Simmondsia chinensis (жожоба), сополимер акрилоилдиметилтаурата аммония и винилпирролидона, феноксиэтанол, метилпарабен, этилпарабен, пропилпарабен, экстракт Euphrasia Officinalis (очанки), экстракт листьев Melissa Officinalis (мелиссы), экстракт бутонов/цветов Magnolia Biondii (магнолии), лецитин, изопропилмиристат, масло зародышей Triticum vulgare (пшеницы), токоферилацетат, БГТ, парфюмерная композиция, аллантоин, эктракт культуры недифференцированных клеток Leontopodium Alpinum (эдельвейса), 2-бром-2-нитропропан-1,3-диол, гидроксид натрия, CI 16255, альфа-изометилионон, бензилсалицилат, бутилфенилметилпропиональ, цитронеллол, гексилциннамаль, лимонен, линалол Применение: нанесите крем-маску за 30-40 минут до сна тонким слоем на щеки, лоб и подбородок. Избегайте попадания в глаза. Не смывайте!

Прочные нанокомпозитные лицевые маски с высокой степенью фильтрации частиц и быстрой инактивацией коронавирусов

Изготовление нанокомпозитов

Нанокомпозиты были созданы путем погружения имеющейся в продаже ткани лицевой маски в 0,5 М раствор прекурсора соли цинка в деионизированной воде. Испытанные материалы для лицевых масок представляли собой полипропилен, выдутый из расплава (Vanalay LLC), и смесь нейлона и хлопка Cordura ® 50/50 (Rockywoods Fabrics LLC). Гидрофобность полипропиленовой маски требует приложения давления для обеспечения полного смачивания материала.Затем маску, все еще погруженную в раствор, помещали в промышленную конвекционную печь (модель FDL 115, BINDER GmbH, Туттлинген, Германия) при 100 °C на 4 часа. После синтеза лицевые маски были подвергнуты одному циклу стирки/сушки в соответствии с Американской ассоциацией текстильных химиков и колористов (AATCC) LP1: Домашняя стирка в воде с температурой 20 °C в стиральной машине (Vortex M6, SDL Atlas) с последующей сушкой. при высокой температуре в сушильной машине (Vortex M6D, SDL Atlas). Для всех циклов стирки использовалось высокоэффективное жидкое стандартное моющее средство AATCC.

Цинковая колориметрия

Небольшие образцы нанокомпозитных тканей весом от 0,2 до 0,5 г вываривали в кислотной смеси 20 мл азотной кислоты, 10 мл 35%-ной соляной кислоты и 10 мл деионизированной воды. Вываривание проводят путем погружения ткани в ванну с кислотой и нагревания в печи при 95 °C в течение 2 часов. Затем проводят анализ переваренного образца в соответствии с методом USEPA Zincon 8009 с помощью карманного колориметра Hach DR300 44,45 .

Тестирование HRIPT

Экзаменационный тест повторного раздражения человека (HRIPT) был проведен компанией Evalulabs LLC на людях для определения раздражения кожи обработанной тканью.Этот протокол тестирования был выполнен в соответствии с соответствующими рекомендациями и правилами и проводился под руководством лицензированного дерматолога. Все экспериментальные протоколы были одобрены Комитетом по этике, Независимым комитетом по этике Evalulab LLC (IEC), для обеспечения защиты прав, безопасности и благополучия субъектов, участвующих в исследовании. Информированное согласие было получено от всех 50 человек и/или их законных опекунов. Для получения более подробной информации см. полный отчет в дополнительной информации.

Тестирование на вирулицидность

В соответствии с рекомендациями ASTM по выбору суррогатного вируса SARS-CoV-2, мы использовали TGEV в этом тесте, следуя методу ISO 18184 с модификациями 31,46 . Аликвоты (75 мкл) суспензии TGEV (с начальным титром = ⁓ 6,5 Log TCID 50 /мл) помещали в центр 2 × 2 см 2 стерильных квадратов парафильма, которые были вырезаны ранее и помещены в чашки Петри. Девять квадратов (2 × 2 см 2 ) из необработанного (контрольного) и 9 нанокомпозитных материалов (маска для лица и нейлон/хлопок) были помещены отдельно на поверхность каждого квадрата парафильма, где капли вируса были зажаты между тестируемой тканью и парафильм квадратный. Капли вируса немедленно поглощались образцами из нейлона/хлопка, поскольку они гидрофильны, в то время как к полипропиленовым образцам прикладывалось небольшое давление наконечником пипетки для поглощения образца. После 10 мин, 30 мин и 60 мин контакта из контрольных образцов, а также из образцов нанокомпозита извлекали тройные наборы образцов (испытуемый образец с абсорбированным вирусом и парапленочный квадрат). Затем каждый набор образцов переносили в пластиковые центрифужные пробирки объемом 13 мл с круглым дном (Falcon), содержащие 1 мл среды для выделения вируса (Eagle’s MEM с 4% FBS и стандартными антибиотиками).Затем все пробирки встряхивали в течение 2 мин сразу после переноса, чтобы выделить вирусные частицы из тестируемых образцов. В параллельном эксперименте (выщелоченный контроль NP) образцы нанокомпозита (не содержащие вирус) сначала переносили в пробирки для выделения вируса и встряхивали в течение 2 минут с последующим добавлением аликвоты 75 мкл вируса в каждую пробирку (без прямого контакта с ткань). Это было сделано, чтобы узнать, была ли часть вирусных частиц инактивирована при контакте с наночастицами, которые могли попасть в раствор для восстановления вируса после извлечения вируса из ткани.

Титр выжившего вируса, выделенного в восстановительной среде, определяли методом 50% инфицирующей дозы тканевой культуры (TCID 50 ). Из восстановительной среды каждого образца готовили серийные десятикратные разведения. Эти разведения инокулировали в 80% конфлюэнтных монослоях клеток яичек свиней (ST), предварительно приготовленных в 96-луночных титрационных микропланшетах, используя 3 лунки на разведение (100 мкл каждого разведения образца на лунку). Зараженные клетки инкубировали при 37°C в инкубаторе с 5% CO 2 до пяти дней и ежедневно исследовали под инвертированным микроскопом на появление цитопатических эффектов (ЦПЭ).За конечную точку принимали максимальное разведение вируса, при котором ЦПЭ продуцировалось в 50% инфицированных клеток. Титр выжившего вируса в каждом образце затем рассчитывали по методу Карбера и выражали как log 10 TCID 50 /образец 47 .

RT-qPCR в реальном времени

Чтобы получить некоторое представление о способе действия инактивации вируса нанокомпозитами, мы количественно определили количество копий вирусного генома в растворе для восстановления после извлечения вируса из контрольных и нанокомпозитных образцов.Вирусную РНК экстрагировали из 140 мкл каждого образца с использованием мини-набора QIAamp DSP Viral RNA (Qiagen, Германия) в соответствии с инструкциями производителя. РНК элюировали в 100 мкл элюирующего буфера и хранили при температуре - 80 °C до использования для количественного определения вирусного генома. Для ОТ-кПЦР мы использовали набор праймеров для ПЦР и зонд, показанные в таблице 2. Праймеры для ОТ-кПЦР были разработаны для нацеливания на консервативную область размером 146 п.н. (соответствует области между нуклеотидами 370 и 515 гена TGEV S со ссылкой на последовательность TGEV-GenBank № доступа: KX

0.1). Праймеры и зонд были изготовлены компанией Integrated DNA Technologies (IDT, Coralville, IA). Реакции RT-qPCR проводили с использованием набора AgPath-ID One-Step RT-PCR (Applied Biosystems by Thermo Fisher Scientific, Waltham, MA). Реакционная смесь (25 мкл) состояла из 5 мкл матричной РНК, 12,5 мкл 2 × RT-PCR буфера, 1 мкл 25× RT-PCR Enzyme Mix, 0,50 мкл 10 мкМ прямого праймера (конечная концентрация 200 нМ), 0,50 мкл 10 мкМ раствора обратного праймера (конечная концентрация 200 нМ), 0.30 мкл 10 мкМ зонда (конечная концентрация 120 нМ) и 5,20 мкл воды без нуклеазы. RT-qPCR проводили в системе термоциклера QuantStudio™ 5 PCR (Thermo Fisher Scientific, Applied Biosystems™). Обратную транскрипцию проводили при 45°C в течение 10 мин. Активацию полимеразы Taq проводили при 95 °C в течение 15 минут с последующими 45 циклами амплификации с использованием стадии денатурации 95 °C/15 с и стадии отжига/удлинения при 58 °C в течение 45 с. Флуоресценцию измеряли в конце стадии отжига в каждом цикле.В каждом цикле RT-qPCR в качестве положительного и отрицательного контроля использовали образцы со стандартной кривой и контроль без матрицы соответственно. Стандартная/калибровочная кривая TGEV была построена для абсолютного количественного определения количества копий вирусного генома, в котором мы использовали серийные десятикратные разведения очищенного обычного RT-PCR ампликона гена S TGEV размером 557 п.н. -qPCR прайм/набор зондов). Фрагмент гена TGEV S длиной 557 п.н. был получен с помощью обычной реакции ОТ-ПЦР с использованием набора праймеров собственной разработки, показанного в Таблице 2.Результаты выражали в виде значений порога цикла (Ct). Значения Ct и стандартную кривую использовали для расчета абсолютного числа копий генома TGEV, выраженного в виде копий генома/образец.

Таблица 2. Олигонуклеотиды для TGEV RT-qPCR на основе TaqMan, использованные в этом исследовании.

Статистический анализ

Эксперимент по тестированию вирулицидности проводился дважды. В каждом из них тестировали по три образца в каждый момент времени контакта. Следовательно, результаты, представленные здесь, представляют собой среднее геометрическое 6 повторов   ±   одного гемометрического стандартного деления. Представленные результаты ОТ-ПЦР в реальном времени представляют собой среднее геометрическое двойных образцов   ±   одно гемометрическое стандартное деление. Дисперсионный анализ был выполнен с помощью однофакторного дисперсионного анализа, а значимость различий между средними значениями была выполнена путем парных сравнений с использованием критерия Тьюки при значимости  = 0,05.

Бактерицидные испытания

Бактерицидная эффективность может быть определена с помощью стандартных методов Американской ассоциации текстильных колористов и химиков (AATCC), которые оценивают антибактериальные эффекты и определяют минимальные ингибирующие концентрации (МИК) и минимальные бактерицидные концентрации (МБК) различных металлов. наночастиц на выбранных микроорганизмах.Были использованы количественные и качественные тесты, основанные на стандартизированных протоколах AATCC TM100-2004 и AATCC TM147-2004, соответственно 48 . Согласно этим методам, Staphylococcus aureus subsp . aureus (АТСС 6538) выращивали в трипсиново-соевом бульоне (ТСБ) с получением 10 8 клеток. За этим последовало серийное разведение с использованием TSB для получения конечной концентрации 10 5 для целей инокуляции. Каждый из двух наборов образцов необработанной ткани и один набор образцов обработанной ткани помещали в чашку Петри размером 60 мм ×   15 мм.Образцы были отдельно инокулированы 1 мл бактериального штамма в бульоне, приготовленном, как описано выше. Растворы бульона полностью впитывались в каждую ткань. Контрольный образец инокулировали 1 мл стерильного TSB в качестве меры загрязнения. Эти чашки Петри запечатывали парафиновой пластиковой пленкой и инкубировали в течение 24 часов при 37 °C. Для тестов с немедленным элюированием инокулированные образцы образцов готовили, как описано выше, и каждый переносили в пробирки, содержащие 50 мл 0.15 М раствор NaCl. Образцы прижимали к стенкам пробирки и встряхивали для обеспечения полного элюирования инокулята. После тщательного элюирования образцы удаляли из раствора NaCl. В отдельную пробирку, содержащую 50 мл раствора NaCl, непосредственно инокулировали бактериальную культуру, которая служила контролем. Эти этапы элюции повторяли для 24-часовых инкубированных образцов образцов. Элюат для каждого образца последовательно разбавляли один раз с использованием TSB для образцов с немедленной элюцией и пять раз для образцов образцов, инкубированных в течение 24 часов, перед посевом на триптико-соевый агар (TSA) и инкубированием в течение 24 часов при 37 °C.После инкубации подсчитывали бактериальные колонии и рассчитывали процент снижения, как описано в следующем разделе.

Антимикробная активность нанокомпозитных тканей была протестирована против Staphylococcus aureus (грамположительные бактерии) в соответствии с методами AATCC. Микроорганизм Staphylococcus aureus является патогенной бактерией, с которой манипулировали в Лаборатории биобезопасности уровня 2 (BSL2) Ветеринарной диагностической лаборатории Миннесотского университета. Количественные методы основаны на расчете процента уменьшения количества бактерий от 0 до 24 часов времени контакта как в образце инокулированной ткани, так и в контрольном образце (без антибактериального агента). Процентное уменьшение определяется следующим образом:

$$ R\;(\% ) = \frac{A — B}{A} $$

где, R — сокращение колониеобразующих единиц (КОЕ), A — количество колоний бактерий на контрольном текстиле, а В — количество колоний бактерий на обработанном текстиле. Качественную оценку антибактериальной активности проводили методом параллельных полос (ААТСС 147-2004), а количественный тест — методом ААТСС 100-2004.

Проверка эффективности фильтрации

Экспериментальная установка показана на рис. 5. Тестовые аэрозоли были приготовлены из водного раствора NaCl с массовой концентрацией 0,1% с использованием распылителя с постоянной производительностью (модель 3076, TSI Inc., Шорвью). , МН). Аэрозоли разбавляли, сушили и затем гомогенизировали в смесительной камере. Материал LOG3Mask был нарезан на диск диаметром 37 мм и плотно прижат к сетчатой ​​опоре фильтрующей кассеты (Air Sampling Cassette, Zefon International Inc., Окала, Флорида) и запечатаны по краю. Распределение размеров аэрозолей в диапазоне 30–600 нм до и после держателя фильтра, а также концентрацию частиц, классифицированных по подвижности, определяли с помощью сканирующего измерителя подвижности частиц (SMPS, модель 3936, TSI Inc., Шорвью, Миннесота). . Портативный аэрозольный спектрометр (GRIMM Model 11-D, Durag Inc., Mendota Heights, MN) измеряет распределение аэрозолей по размерам в диапазоне 500–5000 нм. Двухразрядный манометр (RISEPRO, 365BG947677, диапазон измерения  ± 13.79 кПа, разрешение 0,001 кПа) использовали для отслеживания сопротивления материалов потоку, поскольку сопротивление потоку через фильтрующий материал является важным компонентом для определения воздухопроницаемости материала. Эффективность фильтрации, полученная из распределений по размерам, измеренных SMPS и GRIMM, и зависящая от размера эффективность фильтрации (\(\eta (D_{p} )\)) была рассчитана по формуле:

$$ \eta (D_{p } ) = 1 — \frac{{n_{o} (D_{p} )}}{{n_{i} (D_{p} )}} $$

, где \(n_{o} (D_{p } )\) и \(n_{i} (D_{p} )\) — числовые концентрации частиц для каждого размера частиц, измеренные на выходе (ниже по потоку) и на входе (вверх по потоку) фильтрующей кассеты. Стандартное отклонение рассчитывали на основе метода распространения ошибки, описанного в Hao et al. 49,50 .

Пропитанные цинком ткани инактивируют вирусы SARS-CoV-2 и гриппа А

Версия 3. bioRxiv. Препринт. NaN NaN [пересмотрено 6 января 2021 г.].

Эта статья является препринтом.

Препринты не рецензировались.
Чтобы узнать больше о препринтах в PMC, см.: Пилотный выпуск препринтов NIH.

Викрам Гопал

1 Ascend Performance Materials, 1010 Travis Street, Suite 900, Хьюстон, Техас 77002, США

Бенджамин Э.Nilsson-Payant

2 Кафедра микробиологии, Медицинская школа Икана на горе Синай, Нью-Йорк, штат Нью-Йорк 10029, США

Hollie French

3 Отделение вирусологии, кафедра патологии, больница Адденбрук, Кембриджский университет , Hills Road, CB2 2QQ, United Kingdom

Jurre Y. Siegers

4 Отделение Viroscience, Медицинский центр Университета Эразмус, Роттердам, Нидерланды

Wai-shing Yung

Материалы Ascend 10006, Travisd 1

1 Street, Suite 900, Houston, TX 77002, USA

Matthew Hardwick

5 ResInnova Laboratories, 8807 Colesville Rd, 3-й этаж, Silver Spring, MD 20910, USA

Aartjan J.

W. te Velthuis

3 Отделение вирусологии, отделение патологии, больница Адденбрука, Кембриджский университет, Hills Road, CB2 2QQ, United Kingdom

1 Ascend Performance Materials, 1010 Travis Street, Suite 900, Houston, TX 77002, США

2 Отделение микробиологии, Медицинская школа Икана на горе Синай, Нью-Йорк, штат Нью-Йорк 10029, США

3 Отделение вирусологии, отделение патологии, больница Адденбрука, Кембриджский университет, Hills Road , CB2 2QQ, Великобритания

4 Отделение вирусологии, Медицинский центр Университета Эразма, Роттердам, Нидерланды

5 ResInnova Laboratories, 8807 Colesville Rd, 3rd Floor, Silver Spring, MD 20910, США

под лицензией Creative Commons Attribution 4.0 International License, которая позволяет повторным пользователям распространять, ремикшировать, адаптировать и использовать материал на любом носителе или в любом формате при условии указания авторства. Лицензия разрешает коммерческое использование. Полная история версий этого препринта доступна на сайте bioRxiv.

Abstract

Инфекции, вызванные респираторными вирусами, могут распространяться воздушно-капельным и аэрозольным путем и вызывать такие заболевания, как грипп и COVID-19. Маски для лица и другие средства индивидуальной защиты (СИЗ) могут действовать как барьеры, препятствующие распространению респираторных капель, содержащих эти вирусы.Однако вирусы гриппа А и коронавирусы стабильны в течение нескольких часов на различных материалах, что делает важной частую и правильную утилизацию этих СИЗ. Ионы металлов, внедренные в СИЗ, могут инактивировать респираторные вирусы, но смешанные факторы, такие как поглощение вирусов, затрудняют измерение и оптимизацию характеристик инактивации. Здесь мы использовали волокна из полиамида 6.6 (PA66), в которые были внедрены ионы цинка в процессе полимеризации, и систематически исследовали, могут ли эти волокна поглощать и инактивировать пандемический SARS-CoV-2 и вирус гриппа A h2N1. Мы обнаружили, что эти вирусы легко поглощаются тканями PA66 и инактивируются ионами цинка, внедренными в эту ткань. Скорость инактивации (pfu·gram −1 ·min −1 ) превышает количество активных вирусных частиц, выделяемых при кашле, и поддерживает широкий диапазон вирусных нагрузок. Более того, мы обнаружили, что содержание цинка и способность ткани инактивировать вирусы остаются стабильными в течение 50 стандартных стирок. В целом, эти результаты дают новое представление о разработке «свободных от патогенов» средств индивидуальной защиты и лучшей защите от распространения РНК-вируса.

Ключевые слова: грипп, коронавирус, абсорбция, цинк, лицевая маска . Эти респираторные РНК-вирусы передаются через аэрозоли, капли жидкости и фомиты, а сезонные штаммы обычно вызывают легкое заболевание с такими симптомами, как назофарингит, лихорадка, кашель и головная боль. Тем не менее, сезонные IAV и IBV ежегодно приводят к 290 000–645 000 смертей и убыткам в миллиарды долларов, отчасти из-за увеличения числа госпитализаций и снижения эффективности работы.

Воздействие высокопатогенных и пандемических штаммов ВГА и КоВ еще более серьезное. За последнее столетие несколько штаммов пандемического вируса гриппа А (IAV) и коронавирусов тяжелого острого респираторного синдрома (SARS-CoV) заразили и убили миллионы людей. Особое значение имели пандемические штаммы IAV h2N1 1918 г., h3N2 1957 г. и h4N2 1968 г., а также пандемический штамм SARS-CoV-2, возбудитель COVID-19. Эти вирусы могут вызывать вирусную пневмонию и способствовать развитию вторичных бактериальных инфекций, увеличивая заболеваемость и смертность пациентов ( 1 ).Понимание того, как мы можем эффективно предотвратить распространение этих вирусов, будет важно для текущих и будущих вспышек РНК-вируса.

IAV является частью Orthomyxoviridae , семейства РНК-вирусов с отрицательным смыслом, которые известны своими сегментированными РНК-геномами. Вирусная частица окружена двухслойной мембраной и содержит несколько копий белков вирусного гемагглютинина (HA), матрикса 2 (M2) и нейраминидазы (NA), встроенных в мембрану ( 2 ). Белок HA связывается с рецепторами сиаловой кислоты снаружи клеток-хозяев и сливает вирусную мембрану с клеточной плазматической мембраной, в то время как белок M2 действует как протонный канал, который играет роль в активации HA и высвобождении генома вирусной РНК в клетки. клетка-хозяин. Геном вирусной РНК состоит из восьми сегментов, инкапсулированных вирусным нуклеопротеином (NP) и РНК-полимеразой в виде комплексов рибонуклеопротеина (RNP) внутри вирусных частиц ( 3 ). После вирусной транскрипции, синтеза белка, репликации и образования вириона белок NA необходим для высвобождения вирусных частиц из клетки-хозяина.

SARS-CoV-2 принадлежит к Coronaviridae , семейству РНК-вирусов с положительным смыслом, которые инфицируют широкий круг позвоночных, включая человека ( 4 , 5 ). Вирион SARS-CoV-2 состоит из двухслойной мембраны и мембранных белков шипа (S), оболочки (E) и матрикса (M). Геном вирусной РНК заключен внутри вирусной частицы и инкапсулирован вирусным нуклеокапсидным белком (N). Инфекция клетки-хозяина требует связывания белка S с клеточным рецептором ACE2 ( 6 ).После проникновения вирус высвобождает свою вирусную РНК в клетку-хозяина для синтеза вирусного белка, транскрипции и репликации генома с помощью вирусной РНК-полимеразы.

В настоящее время для лечения гриппа и CoV-инфекций доступны различные противовирусные препараты, включая ингибиторы РНК-полимеразы фавипиравир и ремдесивир ( 7 9 ). Кроме того, доступны или разрабатываются вакцины, нацеленные на белок HA или S, для предотвращения инфекции и распространения IAV и SARS-CoV-2 ( 10 ).К сожалению, вакцины против новых РНК-вирусов недоступны, а существующие РНК-вирусы могут стать устойчивыми к противовирусным препаратам и избежать иммунного давления из-за их относительно высокой скорости мутации ( 11 , 12 ). Поэтому организации здравоохранения рекомендуют использовать средства индивидуальной защиты (СИЗ), такие как маски для лица, для предотвращения распространения респираторного вируса, и несколько исследований подтвердили их эффективность ( 13 15 ). Однако противники использования лицевых масок указали на усложняющие факторы, в том числе на наблюдения, что респираторные вирусы устойчивы на тканях от нескольких дней до нескольких часов и что респираторы N95 требуют тщательной дезинфекции для повторного использования ( 16 19 ). . Другими соображениями являются дополнительные экологические отходы, которые производят одноразовые маски для лица, плохое прилегание некоторых масок и потенциальная опасность для здоровья, которую представляют выброшенные маски ( 20 , 21 ).Разработка средств индивидуальной защиты, которые могут улавливать и инактивировать респираторные вирусы, может помочь решить некоторые из этих проблем или упростить их использование в повседневной жизни.

Предыдущие исследования показали, что IAV и CoV могут быть инактивированы металлическими поверхностями, такими как медь и цинк ( 22 24 ). Хотя точные механизмы инактивации до конца не изучены, данные свидетельствуют о том, что ионы металлов могут вызывать гидролиз РНК, дестабилизацию мембран или инактивацию или деградацию вирусных белков ( 25 27 ). До сих пор в нескольких исследованиях изучалось, могут ли ионы металлов, встроенные в ткани, инактивировать РНК-вирусы, отчасти потому, что различия в абсорбции и плотности ткани между тканями представляют собой смешанные факторы, которые не учитываются протоколами, утвержденными для тестирования инактивирующих свойств поверхностей.

Чтобы решить некоторые из этих противоречивых вопросов, мы здесь измерили способность различных тканей, таких как хлопок, полиамид 6.6 (PA66) и полипропилен (PPP), улавливать вирус h2N1 IAV и пандемический SARS-CoV-2, и мы изучили, как мы можем удалить эти вирусы из тканей, чтобы проверить их инактивацию.Мы обнаружили, что хлопок и PA66 легко поглощают респираторные вирусы, и что ионы цинка, встроенные в ткани на основе PA66, привели к примерно 2-логарифмическому снижению титра вируса, что более чем достаточно для инактивации количества инфекционных вирусных частиц IAV (~ 24 бляшкообразующие единицы [БОЕ]), присутствующие при кашле ( 28 ). Инактивация вируса со временем стабилизировалась. В целом, эти результаты дают новое представление о защитных свойствах тканей, используемых для лицевых масок, и о разработке «свободных от патогенов» тканей.

Результаты

Поглощение вируса гриппа хлопком, полипропиленом и полиамидом

Различные исследования изучали фильтрационные свойства тканей и изучали такие факторы, как воздухопроницаемость, гидрофобность и/или электростатичность. Ткани также имеют разный вес на квадратный метр (грамм/м 2 ) и разную способность удерживать влагу: хлопок поглощает до 500% своего веса, а PA66 поглощает всего 0,3% своего веса, в зависимости от условий окружающей среды ( 29 ).Эти различные свойства могут влиять на то, как ткани улавливают и/или выделяют аэрозоли или капли жидкости, содержащие РНК-вирусы. Например, средства индивидуальной защиты с плохими абсорбирующими свойствами, которые становятся зараженными вирусами, могут удерживать эти вирусы на своей поверхности, что становится потенциальной опасностью для здоровья, если их не утилизировать должным образом. В настоящее время не совсем понятно, как удержание влаги коррелирует с поглощением вирусных частиц. Чтобы исследовать эту взаимосвязь, мы добавили штамм IAV A/WSN/33 (h2N1) к хлопку, выпущенному Международным антимикробным советом (IAC), текстильной ткани PA66 или PPP из одноразовой 3-слойной лицевой маски типа II ().После 30-минутной инкубации при комнатной температуре ткани промывали PBS для удаления неабсорбированного вируса (1). Для оценки количества оставшейся жидкости на каждой ткани каждую пробирку с образцом ткани взвешивали и сравнивали с ее сухой массой. Как показано на рисунках и , хлопок и PA66 сохраняют больше жидкости, чем PPP, как по отношению к нанесенному объему, так и по отношению к весу ткани. Последующий анализ титра ВГА в исходных и смывных тканях показал, что хлопчатобумажные и тканые ткани PA66 легко поглощали нанесенный вирус, в то время как ткань PPP наблюдала меньше вируса (, ), что согласуется с гидрофобностью PPP ( 30 ).

Поглощение и высвобождение IAV и SARS-CoV-2 из тканей.

A) Фотографии контрольных образцов хлопка, PA66 и полипропиленовой ткани. B) Схема экспериментальной процедуры по выявлению и выделению РНК-вируса из тканей. C) Анализ удержания вирусной среды тканями на объем вводимой среды. Значения были получены путем взвешивания каждой ткани до и после добавления вирусной среды и после удаления вирусной среды. D) Анализ удержания вирусной среды тканями, нормализованными по сухой массе каждой ткани.Значения были получены путем взвешивания каждой ткани до и после добавления вирусной среды и после удаления вирусной среды. E) Анализ бляшек IAV, присутствующих в вирусной среде после удаления среды с каждой ткани. F) Количественное определение количества вируса, оставшегося на каждой ткани, нормализованное по сухому весу каждой ткани. G) Влияние различных концентраций твина-80 на показания анализа бляшек IAV. H) Влияние 0,05% твина-80 в PBS на количество вируса, высвобождаемого из каждой ткани. I) Количественное определение титров ВГА после абсорбции вируса на ткани и промывания тканей PBS или PBS, содержащими различные концентрации твин-80. J) Количественное определение титров SARS-CoV-2 после абсорбции вируса на ткани и промывания тканей PBS или PBS, содержащими различные концентрации твин-80. Столбики погрешностей указывают на стандартное отклонение. Звездочка указывает p-значение, где * p<0,05, ** p<0,005 и ns p>0,05.

Для удаления ВГА с тканей из хлопка и ПА66 без инактивации вируса в промывочный буфер PBS добавляли различные концентрации полисорбата-80 (твин-80) – мягкого детергента, который также используется в препаратах вакцины против ВБК ( ).Мы не наблюдали каких-либо цитопатических эффектов детергента на клетках почки собак Madin-Darby (MDCK), используемых для анализа бляшек, но обнаружили, что присутствие 0,05–0,1% твина-80 увеличивает видимый титр вируса по сравнению с инфекциями. в PBS (1), в то время как 0,25–0,5% твин-80 уменьшали видимый размер бляшек ВБК (1). Мы обнаружили, что 0,05% твин-80 удалось восстановить более 94% вируса из тканого материала PA66, тогда как 61% был удален из хлопчатобумажной ткани (и). Более высокие концентрации, такие как 1% Tween-80, предотвращали инфекцию IAV (4).

Чтобы подтвердить, можно ли удалить другие вирусы из хлопка и ткани PA66, мы повторили эксперимент с SARS-CoV-2. Мы обнаружили, что более 92% SARS-CoV-2 можно выделить из ткани PA66 с использованием 0,05% твина-80, в то время как из хлопчатобумажной ткани можно выделить до 59% (). В совокупности эти результаты демонстрируют, что IAV и SARS-CoV-2 сильно поглощаются хлопком и PA66, что позволяет предположить, что эти материалы могут задерживать респираторные вирусы внутри лицевых масок. В то же время эти данные свидетельствуют о том, что PPP плохо улавливает респираторные вирусы.Поскольку IAV и SARS-CoV-2 можно удалить с ткани PA66 с помощью мягкого моющего средства, этот протокол может быть полезен для тестирования инактивирующих свойств тканей.

Вирус гриппа инактивируется ионами цинка.

26 , 31 ).При внедрении в полимеры ионы цинка имеют преимущества перед ионами меди, поскольку цинк имеет гораздо более высокую склонность к ионизации, чем медь, и, таким образом, обеспечивает гораздо более быстрый реакционный потенциал. Кроме того, оксид цинка, который мы внедрили в используемый здесь полимер PA66, считается FDA общепринятым безопасным (GRAS) соединением, что может ускорить процесс разработки. Наконец, цинк не вызывает обесцвечивания полимера или ткани, что обеспечивает более широкое применение. Однако, как и медь, ионы цинка цитотоксичны в культуре тканей (1), что затрудняет анализ их влияния на вирусные титры.Мы обнаружили, что добавление эквимолярной концентрации ЭДТА после инкубации вируса с ионами цинка (1) может эффективно хелатировать ионы цинка и предотвращать цитотоксические эффекты (3). ЭДТА сама по себе не оказывает цитотоксического действия и не снижает титры вируса (12).

IAV инактивируется ионами цинка.

A) Анализ налета, показывающий влияние различных концентраций хлорида цинка и ЭДТА на титры IAV. B) Экспериментальный подход к инактивации ВГА ионами цинка и нейтрализации ионов цинка с помощью ЭДТА. C) Анализ цитотоксичности хлорида цинка и ЭДТА в клетках MDCK. D) Титры IAV после воздействия хлоридом цинка и нейтрализации ЭДТА, измеренные на клетках MDCK. E) Вестерн-блот IAV Уровни белков HA и NP после воздействия хлоридом цинка и нейтрализации ЭДТА. На верхней панели показано количественное определение западного сигнала, а на средней панели — западный сигнал, обнаруженный с помощью LI-COR. На нижней панели показан анализ RT-qPCR сегмента NA вируса IAV после воздействия хлоридом цинка и нейтрализации ЭДТА.Столбики погрешностей представляют собой стандартное отклонение. Звездочка указывает p-значение, где * p<0,05, ** p<0,005 и ns p>0,05.

Чтобы выяснить, могут ли ионы цинка напрямую инактивировать IAV, мы инкубировали вирус гриппа с различными концентрациями хлорида цинка. Через 60 минут реакцию останавливали эквимолярным количеством ЭДТА и затем разбавляли для определения титра вируса методом анализа бляшек (1). Как показано на рисунке, мы обнаружили, что добавление хлорида цинка приводит к значительному снижению титра IAV.Предыдущие исследования показали, что ионы металлов могут дестабилизировать вирусные белки ( 25 ). Чтобы лучше понять механизм инактивации вируса, уровни вирусного белка в образцах, обработанных хлоридом цинка, были проанализированы с помощью вестерн-блоттинга. Как показано на рисунке, мы обнаружили, что в присутствии хлорида цинка уровни ГК снижались в зависимости от концентрации, в то время как уровни NP не снижались (1). Таким образом, этот результат предполагает, что ионы цинка могут влиять на поверхностные белки IAV более значительно, чем на внутренние белки.Чтобы проверить, были ли затронуты уровни РНК IAV, мы добавили РНК-шип длиной 120 нуклеотидов к каждому образцу, экстрагировали вирусную РНК и выполнили обратную транскрипцию (RT) с использованием 3-концевого праймера NA. Уровни кДНК затем количественно определяли с помощью количественной полимеразной цепной реакции (КПЦР) сегмента, кодирующего ген NA, и нормализовали к уровню шиповой РНК (1). Никакого влияния хлорида цинка на уровни вирусного сегмента NA обнаружено не было. Вместе эти результаты подразумевают, что ионы цинка могут инактивировать штамм IAV (h2N1) путем дестабилизации поверхностных белков вируса.

Штаммы гриппа и коронавируса инактивируются на тканях, содержащих ионы цинка

Приведенные выше результаты позволяют предположить, что ионы цинка могут непосредственно инактивировать штамм IAV h2N1. Чтобы исследовать, присутствуют ли эти инактивирующие свойства также при внедрении ионов цинка в матрицу PA66, мы использовали 0,4 грамма текстильной ткани PA66, содержащей 328 частей на миллион ионов цинка (эквивалентно 2,5 мМ; сокращенно KF1). Инкубация KF1 с вирусом и промывание тканей буфером PBS, содержащим 0.05% твин-80 и 10 мМ ЭДТА (PBSTE; ) приводили к примерно 2-логарифмическому снижению титров IAV и SARS-CoV-2 по сравнению с контрольной тканью PA66 через 1 час ( и ). Чтобы подтвердить, что инактивация этих вирусов произошла на KF1, уровни вирусного белка анализировали в элюате промывки PBSTE с помощью вестерн-блоттинга (и ). Любой вирус, оставшийся в ткани после экстракции с помощью PBSTE, лизировали и экстрагировали с помощью тризола, а также анализировали с помощью вестерн-блоттинга. Вестерн-блоты показали снижение уровня белка HA и S в элюате вируса, который был удален из ткани KF1, по сравнению с элюатом контрольной ткани для IAV и SARS-CoV-2 соответственно ( и ).Сигнал, полученный от вируса, оставшегося на каждой ткани после экстракции PBSTE, был близок к фоновому, что соответствует наблюдениям в , и мы смогли количественно определить только сигнал SARS-CoV-2, но не обнаружили статистически значимой разницы. В целом, мы пришли к выводу, что инактивация IAV и SARS-CoV-2 происходит на ткани, покрытой оксидом цинка, аналогично ранее наблюдаемому воздействию оксида меди ( 31 ). Чтобы лучше исследовать скорость восстановления, мы инкубировали KF1 с вирусом в течение различных промежутков времени и вычитали титр абсорбированного вируса в отрицательном контроле из уровня восстановления в ткани KF1 и подгоняли данные к логарифмическому уравнению (). Максимальное снижение произошло между 30 секундами и 5 минутами инкубации, а снижение титра вируса достигло плато примерно через 50 минут.

Инактивация IAV и SARS-CoV-2 на тканях.

A) Схема процедуры испытания тканей без или с внедренным оксидом цинка. B) Титр IAV на входе, или контроль PA66, или тканевые элюаты KF1. C) Титр SARS-CoV-2 на входе, или контроль PA66, или тканевые элюаты KF1. Показан один репрезентативный эксперимент. D) Вестерн-блот-анализ уровней белка IAV HA и NP после воздействия IAV на KF1 или контрольную ткань. Был проанализирован как вирус, который был удален (элюат) с каждой ткани с помощью PBSTE, так и вирус, оставшийся на каждой ткани. E) Вестерн-блот анализ уровней белков S и N SARS-CoV-2 после воздействия вируса на KF1 или контрольную ткань. Был проанализирован как вирус, который был удален (элюат) с каждой ткани с помощью PBSTE, так и вирус, оставшийся на каждой ткани. F) Динамика снижения титра IAV или SARS-CoV-2 с помощью ткани KF1 за вычетом снижения титра с помощью контроля PA66 без внедренного цинка. Показан один репрезентативный временной ход. Данные соответствовали логарифмическому уравнению. G) Скорость снижения титра IAV или SARS-CoV-2 после воздействия ткани KF1. Точки данных были получены в результате экспериментов с временными промежутками, в которых мы варьировали вирусную нагрузку и впоследствии оценивали максимальную скорость снижения (экспоненциальная фаза) для каждого временного промежутка.Сокращение нормализовали до pfu·грамм -1 ·мин -1 , используя вес сухой ткани. Точки данных IAV и SARS-CoV-2 соответствовали линейной линии, и между двумя подборами не наблюдалось никакой разницы. Показан R 2 для установки IAV. H) Содержание цинка в ткани КГ6 после многократной стирки в соответствии со стандартизированным протоколом испытаний домашней стирки AATCC M6–2016. Показан один репрезентативный эксперимент для одной партии ткани. I) Скорость снижения титра ВГА после воздействия на нестираную или стираную ткань КГ6.Столбики погрешностей представляют собой стандартное отклонение. Звездочка указывает p-значение, где * p<0,05 и ns p>0,05.

Инактивация чешуек IAV и коронавирусов вирусной нагрузкой

Чтобы исследовать надежность и уровень насыщения инактивации тканями, содержащими внедренный оксид цинка, мы затем провели эксперименты с KF1 и варьировали вирусную нагрузку, добавленную к каждой ткани, в диапазоне 10 3 до 10 7 БОЕ. Объем жидкости, наносимой на каждую ткань, поддерживали постоянным.После инкубации в течение различных периодов времени ткани промывали PBSTE, титры вируса оценивали с помощью анализа бляшек и рассчитывали скорость снижения титра вируса на основе кратчайшего времени инкубации. Степень уменьшения впоследствии нормализовали по сухому весу каждой ткани. Как показано на рисунке, скорость снижения титра вируса (в БОЕ·грамм -1 ·мин -1 ) зависела от вирусной нагрузки. На логарифмическом графике данные могут соответствовать линейному уравнению. Чтобы подтвердить достоверность этих результатов, мы провели те же эксперименты с SARS-CoV-2 и обнаружили аналогичное поведение (2).

Чтобы выяснить, сохраняют ли ткани, изготовленные из волокон, содержащих ионы цинка, содержание оксида цинка после стирки, ткань KF1 с содержанием ионов цинка 500 ppm (эквивалентно 5,3 мМ; внутренний код KG6) стирали 25 или 50 раз с использованием стандартизированного теста на стирку в домашних условиях. протокол ААТСС М6–2016. Последующий анализ содержания цинка после стирки показал, что содержание цинка оставалось относительно постоянным в тканях PA66 до 50 стирок (10). Затем мы подтвердили, способны ли эти промытые ткани по-прежнему снижать титры вируса, и инкубировали 0.4 г нестираной или стираной ткани с фиксированным количеством ВГА и удаленным инактивированным вирусом с ПБСТЭ. Анализ титров вируса показал, что обе промытые ткани были способны снижать титр ВГА примерно на 2 логарифма (). В целом эти результаты показывают, что ткань PA66, содержащая цинк, может инактивировать как IAV, так и SARS-CoV-2, и что это свойство сохраняется после 50 стирок.

Обсуждение

Инфекции респираторными РНК-вирусами вызывают регулярные сезонные эпидемии и периодические пандемии и, таким образом, ложатся тяжелым бременем на наше личное здоровье, системы здравоохранения и экономику.В то время как сезонные респираторные вирусы, в том числе более 160 различных риновирусов, человеческие штаммы CoV NL63, OC43, HKU1 и 229E, вирусы гриппа A, B и C, респираторно-синцитиальный вирус человека, вирусы парагриппа человека и метапневмовирус человека, как правило, вызывают легкие заболевания, IAV и CoV также были связаны со вспышками зоонозов и смертельными пандемиями. Вакцины и противовирусные препараты доступны или разрабатываются для различных респираторных вирусов, но появление устойчивости к противовирусным препаратам или вакцинам является известной или потенциальной проблемой.В отсутствие новых вакцин или противовирусных препаратов одним из способов борьбы с РНК-вирусами является ограничение распространения респираторного вируса с помощью эффективных средств индивидуальной защиты.

Чтобы лучше понять, как респираторные РНК-вирусы поглощаются и инактивируются на тканях, мы добавили IAV и SARS-CoV-2 к хлопку, PA66 и PPP. Мы обнаружили сильное поглощение хлопком и PA66 в стандартном лабораторном буфере PBS, и добавление твин-80 приводит к эффективному высвобождению вируса из PA66, но не из хлопка. Предыдущее клиническое испытание показало, что хлопковые маски с сильными абсорбирующими свойствами могут быть связаны с более высоким риском заражения при повторном использовании, и наш вывод о том, что хлопок не высвобождает IAV или SARSCoV-2 эффективно после стирки, согласуется с этим наблюдением ( 16 ). .Напротив, удерживание вируса на PPP, используемом для изготовления одноразовых трехслойных масок, плохое в соответствии с его гидрофобными свойствами ( 30 ). Этот результат означает, что респираторные вирусы остаются на поверхности этих масок, и вместе с выводами о том, что SARS-CoV-2 может выживать на различных поверхностях от нескольких часов до нескольких дней и даже 7 дней на хирургических масках для лица на основе PPP ( 19 , 32 ), маски на основе PPP могут увеличить риск заражения, если с ними неправильно обращаться и утилизировать. Тем не менее, PPP, конечно же, обладает альтернативными свойствами, такими как хорошая воздухопроницаемость, фильтрация и электростатические свойства, и, таким образом, в правильной ситуации он будет полезен.

Использование любой маски для лица или других средств индивидуальной защиты, даже если они используются временно, но правильно для предотвращения распространения инфекции, лучше, чем ношение маски для лица, поскольку это может снизить риск заражения респираторными вирусами ( 13 15 ). Тем не менее, приведенные выше соображения предполагают, что существует потенциал для использования средств индивидуальной защиты, инактивирующих патогены, т.е.е. ткани, которые могут как поглощать, так и инактивировать вирусы. В частности, перспективным в этом отношении является использование ионов цинка и меди в СИЗ, поскольку эти металлы могут инактивировать ВБИ и SARS-CoV-2 (, ) ( 22 , 24 , 26 ). Используя ткань на основе PA66, из которой мы могли легко удалить абсорбированный вирус с помощью мягкого моющего средства (), мы проверили влияние ионов цинка, встроенных в матрицу, на инфекционность IAV и пандемического SARS-CoV-2. Мы постоянно обнаруживали быстрое снижение титра всех протестированных вирусов и при вирусной нагрузке, которая намного превышает количество инфекционных частиц IAV, присутствующих в кашле ().После стирки тканей по стандартному протоколу как содержание цинка, так и инактивирующие свойства ткани PA66 сохранились, что позволяет предположить, что эту ткань можно использовать повторно не менее 50 раз. Это свойство может иметь особое значение для разработки многоразовых средств индивидуальной защиты, которые могли бы помочь уменьшить количество отходов в окружающей среде, передачу вирусов и затраты.

Мы также исследовали механизм инактивации IAV и SARS-CoV-2 ионами цинка. Анализ RT-qPCR не показал значительного снижения целостности вирусной РНК после обработки ионами цинка. Напротив, анализ стабильности вирусных поверхностных и капсидных белков выявил снижение стабильности вирусных поверхностных белков HA и S для IAV и SARS-CoV-2, соответственно, после воздействия ионов цинка, при отсутствии влияния на внутреннюю обнаружены нуклеопротеины или нуклеокапсидные белки. Мы наблюдали аналогичное изменение отношения поверхностного белка к нуклеопротеину после воздействия цинксодержащей ткани PA66 KF1. В совокупности эти результаты позволяют предположить, что снижение титра вируса после воздействия ионов цинка происходит за счет инактивации поверхностных белков вируса.Это соответствует предыдущим исследованиям с использованием ионов меди ( 25 ). Исследования показали, что ионы цинка и меди также могут вызывать окислительные реакции, инактивацию протонных каналов вируса или дестабилизацию вирусной мембраны, и мы не можем исключить, что эти процессы также могут играть роль в инактивации ( 27 , 33 , 34 ).

В целом, эти результаты убедительно свидетельствуют о том, что ткани, инактивирующие вирусы, могут обеспечить повышенную безопасность по сравнению с широко используемыми СИЗ на основе хлопка и PPP.Таким образом, наши результаты могут быть важны для медицинских работников, которые длительное время контактируют с инфицированными пациентами, людей с основными факторами риска, нуждающихся в дополнительной защите, и людей, которым необходимо часто снимать свои СИЗ.

Методы

Вирусы и клетки гриппа

Клетки MDCK изначально были получены из ATCC. Вирус гриппа A/WSN/33 (h2N1) был выделен из плазмид ( 35 ) и выращен на клетках MDCK в минимальной основной среде (MEM), содержащей 0.5% эмбриональная телячья сыворотка (FBS) при 37 °C и 5% CO 2 . Анализы налета проводили на 100% конфлюэнтных клетках MDCK в MEM, содержащем 0,5% FBS с 1% покрытием агарозы. Десятикратные разведения вируса выращивали на 1% агарозе в MEM, содержащей 0,5% FBS, в течение 2 дней при 37 °C. Жизнеспособность клеток измеряли с помощью анализа CellTiter Blue (Promega).

Коронавирусы и клетки

SARS-CoV-2 (Bavpat-1 и USA-WA1/2020) выращивали на клетках эпителия почек африканской зеленой мартышки Vero-E6 в минимальной основной среде Дульбекко (DMEM) с добавлением 10% FBS.Для анализа бляшек клетки Vero-E6 высевали в 12-луночные планшеты и инфицировали при 100% слиянии. Десятикратные разведения вируса выращивали под слоем 1% агарозы в среде DMEM, содержащей 0,5% FBS, в течение 2 дней при 37 °C. Эксперименты проводились в лаборатории BSL3 в соответствии с утвержденными стандартами биобезопасности.

Ткани

Образцы тканей вырезали очищенными ножницами. Хлопчатобумажная ткань выдана и сертифицирована IAC (номер лота IACVC01012020). Ткани PA66 с ионами цинка (Microban Additive Zo7; EPA Reg.№ 42182-8) и контрольная ткань без ионов цинка были произведены и предоставлены компанией Ascend Performance Materials. Одноразовая трехслойная лицевая маска PPP типа II (Medical Products Co, Ltd) соответствует стандарту BS EN14638:2019 типа II. Ткани PA66 стирали в соответствии со стандартизированным протоколом тестирования домашней стирки AATCC M6-2016. Анализ с индуктивно-связанной плазмой (ICP) использовали для определения содержания цинка после стирки ткани.

Абсорбция и экстракция вируса

Для проверки способности тканей снижать титры вируса мы использовали модифицированный протокол ISO 18184.Вкратце, 100 мкл штамма IAV A/WSN/33 (h2N1) наносили в виде капель по 5–10 мкл на хлопок, текстильную ткань PA66 или PPP, вырезанные из масок для лица медицинского назначения. Размер тканей варьировал от 1 см 2 до 0,4 грамма, как показано на рисунках. После инкубации при комнатной температуре, как указано, ткани промывали PBS, PBS, содержащим твин-80, или PBS, содержащим 0,05% твин-80 и 10 мМ ЭДТА, путем встряхивания. После удаления вируса к каждой ткани добавляли 1 мл тризола (Invitrogen) для извлечения оставшихся вирусных белков и РНК.Опыты проводили в трехкратной повторности, если не указано иное. Данные анализировали в Graphpad Prism 8 с использованием однофакторного дисперсионного анализа.

RT-qPCR и вестерн-блоттинг

Экстракцию РНК из тризола проводили, как описано ранее ( 36 ), в то время как белок экстрагировали из интерфазы, используя изопропаноловое осаждение ( 37 ). Осажденный белок промывали в этаноле, ресуспендировали в загрузочном буфере 5x SDS-PAGE, обрабатывали ультразвуком в течение 10 секунд и кипятили в течение 10 минут перед анализом 8% SDS-PAGE.Вестерн-блоттинг проводили с использованием антител, направленных против IAV HA (Invitrogen, PA5-34929) и NP (GeneTex, GTX125989) и SARS-CoV-2 S (Abcam ab272504) и N (GeneTex, GTX632269). Мембраны промывали в TBS, содержащем 0,1% твин-20. Спайковая РНК была приобретена у IDT и имела последовательность 5-AGUAGAAACAAGGCGGUAGGCGCUGUCCUUUAUCCAGACAACCAUUACCUGUCCACACAAUCUGCCCUUUCGAAAGAUCCCAACGAAAAGAGAGACCACACAUGGUCCUUCCUGCUUUUGCU-3. Выделенную РНК подвергали обратной транскрипции с использованием SuperScript III и праймера, связывающегося с 3′-концом NA-сегмента ( 36 ).кПЦР выполняли, как описано ранее ( 36 ). Данные анализировали в Graphpad Prism 8 с использованием однофакторного дисперсионного анализа с множественными поправками.

Благодарности

Мы благодарим Shanaka Rodrigo, Natasha Virjee, Chris Hsiung и Benjamin Tenoever за полезные обсуждения, материалы и информацию. AtV поддерживается совместным грантом Wellcome Trust и Королевского общества 206579/Z/17/Z и грантом Национального института здравоохранения R21AI147172.

Сноски

Конкурирующие интересы

Это исследование частично финансировалось компанией Ascend Performance Materials.VG и W-sY используются компанией Ascend Performance Materials. MH нанят ResInnova и нанят Ascend Performance Materials для проведения экспериментов и анализа данных. Медицинская школа Икана на горе Синай и Кембриджский университет получили от Ascend Performance Materials гонорары за консультационные услуги за экспериментальную работу и анализ данных.

Ссылки

1. McCullers JA. 2014. Копатогенез вирусов гриппа с бактериями в легких.
Нат Рев Микробиол 12: 252–62. [PubMed] [Google Scholar]2.Хатчинсон Э.К., Чарльз П.Д., Хестер С.С., Томас Б., Трудгиан Д., Мартинес-Алонсо М., Фодор Э. 2014. Консервативные и специфичные для хозяина особенности архитектуры вириона гриппа. Нац Коммуна 5:4816. [Бесплатная статья PMC] [PubMed] [Google Scholar]3. Те Вельтуис А.Дж., Фодор Э. 2016. РНК-полимераза вируса гриппа: понимание механизмов синтеза вирусной РНК. Нат Рев Микробиол 14: 479–93. [Бесплатная статья PMC] [PubMed] [Google Scholar]4. Zhu N, Zhang D, Wang W, Li X, Yang B, Song J, Zhao X, Huang B, Shi W, Lu R, Niu P, Zhan F, Ma X, Wang D, Xu W, Wu G, Gao GF , Тан В., Китайский новый коронавирус I, Исследование Т.2020. Новый коронавирус от пациентов с пневмонией в Китае, 2019 г. N Engl J Med 382: 727–733. [Бесплатная статья PMC] [PubMed] [Google Scholar]5. Исследовательская группа Coronaviridae Международного комитета по таксономии V. 2020. Вид Коронавирус, связанный с тяжелым острым респираторным синдромом: классификация 2019-nCoV и присвоение ему названия SARS-CoV-2.
Нат Микробиол 5: 536–544. [Бесплатная статья PMC] [PubMed] [Google Scholar]6. Летко М., Марци А., Мюнстер В. 2020. Функциональная оценка проникновения в клетки и использования рецепторов для SARS-CoV-2 и других бета-коронавирусов линии B.Нат Микробиол 5: 562–569. [Бесплатная статья PMC] [PubMed] [Google Scholar]7. Голдхилл Д.Х., Те Велтуис А.Дж.В., Флетчер Р.А., Лангат П., Замбон М., Лакенби А., Барклай В.С. 2018. Механизм устойчивости к фавипиравиру при гриппе. Proc Natl Acad Sci U S A 115:11613–11618. [Бесплатная статья PMC] [PubMed] [Google Scholar]8. Pruijssers AJ, George AS, Schafer A, Leist SR, Gralinksi LE, Dinnon KH 3rd, Yount BL, Agostini ML, Stevens LJ, Chappell JD, Lu X, Hughes TM, Gully K, Martinez DR, Brown AJ, Graham RL, Perry JK, Du Pont V, Pitts J, Ma B, Babusis D, Murakami E, Feng JY, Billello JP, Porter DP, Cihlar T, Baric RS, Denison MR, Sheahan TP.2020. Ремдесивир ингибирует SARS-CoV-2 в клетках легких человека и химерный SARS-CoV, экспрессирующий РНК-полимеразу SARS-CoV-2 у мышей. Представитель ячейки 32:107940. [Бесплатная статья PMC] [PubMed] [Google Scholar]9. Уильямсон Б.Н., Фельдманн Ф., Шварц Б., Мид-Уайт К., Портер Д.П., Шульц Дж., Ван Доремален Н., Лейтон И., Йинда К.К., Перес-Перес Л., Окумура А., Ловаглио Дж., Хэнли П.В., Суббота Г., Босио К.М., Анзик С., Барбиан К., Чихлар Т., Мартенс С., Скотт Д.П., Мюнстер В.Дж., де Вит Э. 2020. Клиническая польза ремдесивира у макак-резусов, инфицированных SARS-CoV-2.Природа 585: 273–276. [Бесплатная статья PMC] [PubMed] [Google Scholar]10. ван Риэль Д., де Вит Э. 2020. Платформы вакцин нового поколения для COVID-19. Нат Матер 19:810–812. [PubMed] [Google Scholar] 11. Экерле Л.Д., Беккер М.М., Халпин Р.А., Ли К., Вентер Э., Лу Х, Щербакова С., Грэм Р.Л., Барик Р.С., Стоквелл Т.Б., Спиро Д.Дж., Денисон М.Р. 2010. Неверность репликации вируса, мутантного по Nsp14-экзонуклеазе SARS-CoV, выявляется с помощью полного секвенирования генома. PLoS Патог 6:e1000896. [Бесплатная статья PMC] [PubMed] [Google Scholar]12.Чунг П.П., Рогозин И.Б., Чой К.Т., Нг Х.И., Пейрис Д.С., Йен Х.Л. 2015. Сравнительный мутационный анализ вирусов гриппа А. РНК 21:36–47. [Бесплатная статья PMC] [PubMed] [Google Scholar]13. Ганди М., Бейрер С., Гусби Э. 2020. Маски не просто защищают других во время COVID-19: сокращение инокулята SARS-CoV-2 для защиты владельца. J Gen Intern Med doi: 10.1007/s11606-020-06067-8 [бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]14. Джефферсон Т., Дель Мар С.Б., Дули Л., Феррони Э., Аль-Ансари Л.А., Бавазир Г.А., ван Дриэль М.Л., Наир С., Джонс М.А., Торнинг С., Конли Дж.М.2011. Физические вмешательства для прерывания или уменьшения распространения респираторных вирусов. Кокрановская база данных Syst Rev doi:10.1002/14651858.CD006207.pub4:CD006207. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]15. У Дж., Сюй Ф., Чжоу В., Фейкин Д.Р., Линь С.И., Хе Х., Чжу З., Лян В., Чин Д.П., Шучат А. 2004. Факторы риска атипичной пневмонии среди лиц, не контактировавших с больными атипичной пневмонией, Пекин, Китай. Возникновение инфекции Dis 10: 210–6. [Бесплатная статья PMC] [PubMed] [Google Scholar]16. Макинтайр Ч.Р., Сил Х., Дунг Т.С., Хиен Н.Т., Нга П.Т., Чухтай А.А., Рахман Б., Дуайер Д.Э., Ван К.2015. Кластерное рандомизированное исследование тканевых масок по сравнению с медицинскими масками у медицинских работников. БМЖ Открытый 5:e006577. [Бесплатная статья PMC] [PubMed] [Google Scholar]17. Ван И, Тянь Х, Чжан Л, Чжан М, Го Д, Ву В, Чжан Х, Кан ГЛ, Цзя Л, Хо Д, Лю Б, Ван Х, Сунь Ю, Ван Ц, Ян П, Макинтайр ЧР. 2020. Снижение вторичной передачи SARS-CoV-2 в домашних хозяйствах за счет использования лицевых масок, дезинфекции и социального дистанцирования: когортное исследование в Пекине, Китай. BMJ Глоб Здоровье 5. [Бесплатная статья PMC] [PubMed] [Google Scholar]18.Фишер Р.Дж., Моррис Д.Х., Ван Доремален Н., Сарчетт С., Мэтсон М.Дж., Бушмейкер Т., Йинда К.К., Зайферт С.Н., Гэмбл А., Уильямсон Б.Н., Джадсон С.Д., де Вит Э., Ллойд-Смит Д.О., Мюнстер В.Дж. 2020. Эффективность обеззараживания и повторного использования респиратора N95 против вируса SARS-CoV-2. Возникновение инфекции Dis 26. [Бесплатная статья PMC] [PubMed] [Google Scholar]19. Chin AWH, Chu JTS, Perera MRA, Hui KPY, Yen HL, Chan MCW, Peiris M, Poon LLM. 2020. Стабильность SARS-CoV-2 в различных условиях окружающей среды. Ланцет Микроб 1:е10.[Бесплатная статья PMC] [PubMed] [Google Scholar]20. Prata JC, Silva ALP, Walker TR, Duarte AC, Rocha-Santos T. 2020. Последствия пандемии COVID-19 для использования пластмасс и обращения с ними. Экологические научные технологии 54:7760–7765. [PubMed] [Google Scholar] 21. Адиль ТМ. 2020. Накопление пластиковых отходов во время COVID-19. Наука 369: 1314–1315. [PubMed] [Google Scholar] 22. Noyce JO, Michels H, Keevil CW. 2007. Инактивация вируса гриппа А на медных поверхностях по сравнению с поверхностями из нержавеющей стали. Appl Environ Microbiol 73:2748–50.[Бесплатная статья PMC] [PubMed] [Google Scholar]23. Бирюков Дж., Бойдстон Дж.А., Даннинг Р.А., Йегер Дж.Дж., Вуд С., Риз А.Л., Феррис А., Миллер Д., Уивер В., Зейтуни Н.Е., Филлипс А., Фрибургер Д., Хупер И., Ратнесар-Шумате С., Йолиц Дж., Краузе М., Уильямс Г., Доусон Д.Г., Херцог А., Дабиш П., Валь В., Хеви М.С., Альтамура Л.А. 2020. Повышение температуры и относительной влажности ускоряет инактивацию SARS-CoV-2 на поверхностях. мсфера 5. [Бесплатная статья PMC] [PubMed] [Google Scholar]24. Уорнс С.Л., Литтл З.Р., Кивил К.В.2015. Человеческий коронавирус 229E остается заразным на обычных материалах, к которым прикасаются. mBio 6: e01697–15. [Бесплатная статья PMC] [PubMed] [Google Scholar]25. Фухимори Ю., Сато Т., Хаята Т., Нагао Т., Накаяма М., Накаяма Т., Сугамата Р., Судзуки К. 2012. Новые противовирусные характеристики наноразмерных частиц йодида меди (I), демонстрирующие инактивационную активность против пандемического вируса гриппа h2N1 2009 года. Appl Environ Microbiol 78:951–5. [Бесплатная статья PMC] [PubMed] [Google Scholar]26. Имаи К., Огава Х., Буй В.Н., Иноуэ Х., Фукуда Дж., Охба М., Ямамото Ю., Накамура К.2012. Инактивация высоко- и низкопатогенных подтипов вируса птичьего гриппа Н5 ионами меди, включенными в цеолитотекстильные материалы. Противовирусный рез 93:225–233. [PubMed] [Google Scholar] 27. Биндер Х., Арнольд К., Ульрих А.С., Зшорниг О. 2001. Взаимодействие Zn2+ с фосфолипидными мембранами. Биофиз Хим 90:57–74. [PubMed] [Google Scholar] 28. Линдсли В.Г., Ноти Дж.Д., Блашер Ф.М., Тьюлис Р.Э., Мартин С.Б., Отумпангат С., Нурбахш Б., Голдсмит В.Т., Вишну А., Палмер Дж.Е., Кларк К.Е., Бижольд Д.Х. 2015. Жизнеспособный вирус гриппа А в частицах, переносимых по воздуху при кашле человека.J оккупировать Environ Hyg 12:107–13. [Бесплатная статья PMC] [PubMed] [Google Scholar]29. Круз Дж., Лейтао А.С., Силвейра Д., Пичанди С., Пинто М., Фангейро Р. 2017. Изучение характеристик влагопоглощения хлопчатобумажных махровых полотенец. Процедиа Инжиниринг 200: 389–398. [Google Академия] 30. Эрбиль Х.И., Демирель А.Л., Авчи Ю., Мерт О. 2003. Превращение простого пластика в супергидрофобную поверхность. Наука 299: 1377–80. [PubMed] [Google Scholar] 31. Борков Г., Чжоу С.С., Пейдж Т., Габбай Дж. 2010. Новая противогриппозная респираторная маска для лица, содержащая оксид меди.PLoS Один 5:e11295. [Бесплатная статья PMC] [PubMed] [Google Scholar]32. ван Доремален Н., Бушмейкер Т., Моррис Д.Х., Холбрук М.Г., Гэмбл А., Уильямсон Б.Н., Тамин А., Харкорт Дж.Л., Торнбург Н.Дж., Гербер С.И., Ллойд-Смит Д.О., де Вит Э., Мюнстер В.Дж. 2020. Стабильность аэрозоля и поверхности SARS-CoV-2 по сравнению с SARS-CoV-1. N Engl J Med 382: 1564–1567. [Бесплатная статья PMC] [PubMed] [Google Scholar]33. Ганди К.С., Шак К., Лир Д.Д., Дикманн Г.Р., ДеГрадо В.Ф., Лэмб Р.А., Пинто Л.Х. 1999. Ингибирование Cu(II) механизма транслокации протонов белка М2 вируса гриппа А.J Биол Хим 274: 5474–82. [PubMed] [Google Scholar] 34. Окада А., Миура Т., Такеучи Х. 2003. Цинк- и рН-зависимый конформационный переход в предполагаемой междоменной линкерной области матричного белка M1 вируса гриппа. Биохимия 42:1978–84. [PubMed] [Google Scholar] 35. Фодор Э., Девениш Л., Энгельхардт О.Г., Палезе П., Браунли Г.Г., Гарсия-Састре А. 1999. Спасение вируса гриппа А из рекомбинантной ДНК. Журнал вирусологии 73:9679–9682. [Бесплатная статья PMC] [PubMed] [Google Scholar]36. Те Вельтус А.Дж.В., Лонг Дж.К., Бауэр Д.Л.В., Фан Р.Л.И., Йен Х.Л., Шарпс Дж., Зигерс Дж.Ю., Киллип М.Дж., Френч Х., Олива-Мартин М.Дж., Рэндалл Р.Э., де Вит Э., ван Риэль Д., Пун Л.М., Фодор Э.2018. Минивирусные РНК действуют как агонисты врожденного иммунитета во время инфекции вируса гриппа. Нат Микробиол 3:1234–1242. [Бесплатная статья PMC] [PubMed] [Google Scholar]37. Симоес А.Е., Перейра Д.М., Амарал Х.Д., Нуньес А.Ф., Гомес С.Е., Родригес П.М., Ло А.К., Д’Хуге Р., Стир С.Дж., Тибодо С.Н., Борральо П.М., Родригес К.М. 2013. Эффективное извлечение белков из нескольких исходных образцов после экстракции РНК TRIzol((R)) или TRIzol((R))LS и длительного хранения. Геномика BMC 14:181. [Бесплатная статья PMC] [PubMed] [Google Scholar]

Гонка за разработку маски для лица, которая может разорвать коронавирус на части

В первые дни пандемии COVID-19 Цзясин Хуан наблюдал, как новый вирус захлестнул больницы в его родной Китай.Профессор материаловедения и инженерии в Северо-Западном университете, он связался с коллегами на родине, чтобы обсудить, как применить их опыт для смягчения последствий будущих пандемий, и отправил впоследствии опубликованные предложения в Национальный научный фонд.

Jiaxing Huang [Фото: любезно предоставлено Северо-Западным университетом] У NSF была похожая идея, и в конечном итоге он призвал к предложениям грантов для немедицинских исследований быстрого реагирования для борьбы с распространением вируса SARS-CoV-2.Но не раньше, чем наградить Хуана. В середине марта он стал первым материаловедом, получившим грант в размере 200 000 долларов на разработку химического дополнения к традиционным маскам, которое может уничтожить COVID-19. Теперь Хуан и его команда отложили свои другие исследования, чтобы сосредоточиться на этом новом проекте.

«Я пытался мотивировать своих сверстников и студентов, что, хотя мы и не работаем на передовой или в исследованиях, связанных с вирусами, мы все же можем помочь», — говорит Хуанг. «Мы хотим участвовать в долгосрочных усилиях по внесению своего вклада не только в нынешнюю пандемию, но и в том, чтобы лучше подготовиться к будущим.

Исследования показали, что маски и респираторы снижают распространение коронавируса и уровень заражения, и несколько штатов вводят их обязательно в общественных местах или когда не практикуется социальное дистанцирование. Повышенный спрос в сочетании с дефицитом привел к тому, что их средние цены выросли в четыре раза. По оценкам аналитической компании медицинских технологий Life Science Intelligence, глобальные продажи масок и респираторов превысят допандемические оценки на 211% и 305% соответственно, в зависимости от того, как распространяется вирус COVID-19.

Постдокторант Северо-Западного университета Хун Пак (слева) и аспирант Хайюэ Хуанг . [Фото: любезно предоставлено Северо-Западным университетом] Из-за нехватки медицинских масок и респираторов для медицинских работников и гражданских лиц, которые обходятся импровизированными тканевыми версиями, поиски более эффективной, противомикробной и многоразовой защиты лица для всех продолжаются. Это особенно актуально в США, мировом лидере по количеству случаев COVID-19, число которых достигло почти 1.4 миллиона и угрожает ухудшиться, поскольку государства ослабляют меры по укрытию на месте.

Использование меди в масках


В настоящее время золотым стандартом защиты людей от вируса является одноразовый медицинский респиратор N95, который улавливает частицы через слои фильтров и электростатический заряд. Это позволяет респираторам N95 отфильтровывать 95% немасляных частиц размером до 0,3 микрона в диаметре. Хотя коронавирус меньше, от 0,05 до 0,2 микрона в диаметре, ношение масок с меньшими порами проблематично, потому что они затрудняют дыхание.Вместо этого маски N95 преграждают путь вирусу несколькими слоями, в то время как статическое электричество притягивает SARS-CoV-2 к ткани. Однако они предназначены для одноразового использования, поскольку жидкости и влажность (в том числе аэрозольные капли, чихание и выдох) ослабляют эти заряды и делают маски менее эффективными по мере их ношения.

Еще до пандемии исследователи и производители со всего мира пытались создать многоразовые маски, которые и фильтровали бы , и уничтожали бактерии и вирусы.В ряде антимикробных масок, уже представленных на рынке, используются медные фильтры и наноткани, в состав которых входят мельчайшие частицы, придающие им улучшенные свойства, такие как водостойкость, устойчивость к запаху и микробам.

Медь обладает давно установленными антимикробными свойствами, включая уничтожение вируса COVID-19 в течение четырех часов. Положительно заряженные ионы меди притягивают и захватывают бактерии и большинство вирусов, которые заряжены отрицательно. Затем ионы меди проникают в микробы и уничтожают их способность к размножению, значительно уменьшая количество инфекционных частиц, которые могут проникнуть через поры маски.(Ионы серебра и цинка, также используемые в некоторых масках, обезвреживают микробы аналогичным образом.)

Но одного антимикробного слоя или покрытия недостаточно. Люди, покупающие такие маски, должны учитывать комбинацию факторов — размер пор, количество и тип слоев, а также уплотнение. Например, медицинские респираторы N95 имеют металлические стержни, которые пользователи могут согнуть, чтобы верхний край соответствовал их переносице и нижней части щек.

«Один из путей распространения COVID-19 — через выделения из носа и рта (капельная передача) и, вероятно, воздушно-капельный путь (например, выдыхание вируса)», — говорит Карл Фихтенбаум, профессор инфекционных заболеваний в Университете Цинциннати Медицинский колледж.«Если кто-то чихает или кашляет, маска не должна спадать с лица. Таким образом, вы должны знать, обладают ли медные или другие химически усиленные маски той же способностью, что и маска N95, образовывать плотное уплотнение, и достаточно ли слоев для предотвращения проникновения капель или частиц в воздухе».

Если кто-то чихает или кашляет, маска не должна спадать с лица».

Carl Fichtenbaum

Маски, в которых используется медная технология, сильно различаются по степени эффективности, цене и долговечности: некоторые предназначены для использования в здравоохранении, а другие предназначены исключительно для модернизации тканевых масок.Стоимость одиночных масок обычно составляет от 10 до 70 долларов, а антимикробные свойства сохраняются от 30 стирок до срока службы продукта. Некоторые компании тестировали свои продукты против других вирусов, но ни одна из них не тестировала COVID-19, для чего требуются высокоспециализированные средства, которых нет в наличии. «Размер вируса, уровень инфекционности и химические свойства различаются и влияют на то, насколько хорошо работают маски», — добавляет Фихтенбаум.

Некоторые высокотехнологичные маски продаются по высокой цене, в диапазоне от 50 до 70 долларов.У израильской компании по производству волокон Argaman есть маска с четырьмя пропитанными медью слоями и фильтрами из оксида меди от чешской фирмы Respilon, которая также продает маски собственного производства. Израильский стартап Sonovia использует покрытие из оксида цинка и пятимикронную фильтрацию, срок действия которой должен составлять год.

Компании, специализирующиеся на антимикробной одежде с добавлением меди, и специализированные магазины масок предлагали более доступные версии. Copper Compression и британская компания Copper Clothing предлагают четырехслойные маски, блокирующие 99% твердых частиц, в то время как Copper Mask использует шестислойную медь и фильтры HEPA, блокирующие 92%.Другая компания, Kuhn Copper Solutions, основанная микробиологом Филлис Кун, одним из первых сторонников использования меди в больницах, специализируется на медных сетчатых масках и вставках, которые можно комбинировать с традиционными или тканевыми версиями.

Вы также можете найти хлопковые маски с пропиткой медью в некоторых магазинах мебели и одежды, таких как The Futon Shop, CustomInk и обувь Atoms, которые перешли на медь, используя существующие производственные конвейеры.

Благородно, некоторые из этих компаний внесли свой вклад в решение проблемы нехватки масок.Компания Copper Compression пожертвовала 18 000 масок больницам Нью-Йорка и Нью-Джерси, в то время как Atoms жертвует одну маску на каждую проданную маску Жилищному управлению Нью-Йорка.

Инженерные маски, которые дезинфицируют сами себя


Пандемия также побудила университеты со всего мира активизировать исследования в области новых технологий масок, в первую очередь за счет интеграции противовирусных химикатов или перепрофилирования методов фильтрации воды.

Вместо того, чтобы заново изобретать пропитанную медью маску, Huang из Northwestern ищет недорогой способ включения химических веществ, традиционно используемых в санитарно-гигиенических средствах, которые, как известно, дезактивируют широкий спектр вирусов.Он изучает спреи, а также химически обработанные ткани, пластыри и вставки для одноразовых масок или масок, сделанных своими руками, — все это повысит эффективность существующих масок. «Нам нужно беспокоиться о том, как исправить эти агенты, чтобы они не [высвобождались] легко, когда люди вдыхают и попадают в их легкие», — говорит он. «Но тогда нам нужно, чтобы они исчезли во время выдоха. Это задача науки».

Лучше всего мы можем показать людям, что эта идея работает».

Jiaxing Huang

Грант Хуанга дает ему год на публикацию своих открытий, которые, как он надеется, вдохновят других на разработку продуктов с их использованием.«Что мы можем сделать лучше всего, так это действительно показать людям, что эта идея работает», — говорит он. «Это наш вклад: ускорить технические решения».

Тем временем израильские исследователи попытались применить аналогичный подход, который уже проходит испытания в Медицинском центре Галилеи. Профессор машиностроения Эяль Зуссман из Израильского технологического института Технион возглавил команду, которая разработала напечатанную на 3D-принтере нановолоконную наклейку, покрытую антисептиками, которые улавливают частицы и нейтрализуют вирусы в каплях, попадающих на маску.Наклейка прикрепляется к традиционной маске для обеспечения дополнительной защиты.

Другие исследователи находят способы применить технологию очистки воды к фильтрации воздуха. Крис Арнуш, профессор исследования воды в Университете Бен-Гуриона (BGU), также в Израиле, потратил пять лет на разработку пористых графеновых мембран с антимикробными и противовирусными свойствами для использования в очистке воды. Теперь он пытается проверить технологию для воздуха, чтобы адаптировать ее для масок или воздушных фильтров.Чистый графен — это слой графита толщиной в атом, компонент, используемый в графите карандаша, который невероятно прочен и проводит электричество. Арнуш создает пенообразную форму графена для своих фильтров, тренируя лазер на пластиковых поверхностях. Получив начальное финансирование от BGU и правительства Израиля, он теперь объединяется со стартапом для коммерциализации этого и других продуктов.

«В случае моих фильтров для воды поры больше, чем бактерии и вирусы», — говорит Арнуш.«Но если вы электризуете поверхность в воде, это убивает бактерии и вирусы, когда они проходят через нее. Я пытаюсь посмотреть, работает ли он в воздухе. После проверки нам просто нужно адаптировать его к маске или воздушному фильтру».

Графен, индуцированный лазером, также заинтересовал исследователей Гонконгского политехнического университета, которые наносят этот материал на одноразовые хирургические маски, чтобы сделать их самостерилизующимися и сверхводоотталкивающими, чтобы вирусные капли скатились. В апрельской статье они отметили, что солнечный свет теоретически может стерилизовать маску с графеновым покрытием, нагревая ее до 176°F.

После проверки нам просто нужно адаптировать его к маске или воздушному фильтру».

Крис Арнуш

Исследователи Университета Цинциннати также разрабатывают фильтры для масок, адаптируя технологию фильтрации воды к воздуху. Проект включает в себя интеграцию нагревателя из углеродных нанотрубок в ткань, изготовленную из углеродных нанотрубок и полимерных волокон. Небольшие диаметры нанотрубок и большая общая площадь поверхности могут эффективно разделять микробы, а нагревание углерода может их убить.Успешно применив этот метод обогревателя из углеродных нанотрубок в отрасли очистки воды, команда пытается использовать его для фильтрации воздуха при поддержке Национального института безопасности и гигиены труда, подразделения Центров по контролю и профилактике заболеваний.

Исследователи, работающие с нанотрубками. [Фото: предоставлено Университетом Цинциннати] В борьбе с COVID-19 даже самые эффективные маски должны работать в сочетании с другими мерами защиты, такими как социальное дистанцирование и мытье рук.И, возможно, еще слишком рано знать, работают ли высокотехнологичные маски лучше, чем их более простые собратья.

«Суть, конечно, в том, что вам нужно протестировать это в реальных условиях, чтобы убедиться, что то, что вы говорите, действительно работает», — говорит Фихтенбаум. «Было тестирование различных масок с разными результатами от разных вирусов. Не все вирусы одинаковы».

Произошла ошибка при настройке пользовательского файла cookie

Этот сайт использует файлы cookie для повышения производительности.Если ваш браузер не принимает файлы cookie, вы не можете просматривать этот сайт.


Настройка браузера на прием файлов cookie

Существует множество причин, по которым файл cookie не может быть установлен правильно. Ниже приведены наиболее распространенные причины:

  • В вашем браузере отключены файлы cookie. Вам необходимо сбросить настройки браузера, чтобы принять файлы cookie, или спросить вас, хотите ли вы принимать файлы cookie.
  • Ваш браузер спрашивает, хотите ли вы принимать файлы cookie, и вы отказались.Чтобы принять файлы cookie с этого сайта, нажмите кнопку «Назад» и примите файл cookie.
  • Ваш браузер не поддерживает файлы cookie. Попробуйте другой браузер, если вы подозреваете это.
  • Дата на вашем компьютере в прошлом. Если часы вашего компьютера показывают дату до 1 января 1970 г., браузер автоматически забудет файл cookie. Чтобы это исправить, установите правильное время и дату на своем компьютере.
  • Вы установили приложение, которое отслеживает или блокирует установку файлов cookie.Вы должны отключить приложение при входе в систему или проконсультироваться с системным администратором.

Почему этому сайту требуются файлы cookie?

Этот сайт использует файлы cookie для повышения производительности, запоминая, что вы вошли в систему, когда переходите со страницы на страницу. Предоставить доступ без файлов cookie потребует от сайта создания нового сеанса для каждой посещаемой вами страницы, что замедляет работу системы до неприемлемого уровня.


Что сохраняется в файле cookie?

Этот сайт не хранит ничего, кроме автоматически сгенерированного идентификатора сеанса в файле cookie; никакая другая информация не фиксируется.

Как правило, в файле cookie может храниться только информация, которую вы предоставляете, или выбор, который вы делаете при посещении веб-сайта. Например, сайт не может определить ваше имя электронной почты, если вы не решите ввести его. Разрешение веб-сайту создавать файлы cookie не дает этому или любому другому сайту доступ к остальной части вашего компьютера, и только сайт, создавший файл cookie, может его прочитать.

Полиамидные ткани с добавлением цинка эффективно поглощают и инактивируют SARS-CoV-2

Международная группа ученых недавно продемонстрировала, что полиаминовые волокна с добавлением цинка могут эффективно поглощать и инактивировать респираторные вирусы человека, включая вирус гриппа А и коронавирус тяжелого острого респираторного синдрома 2 (SARS-CoV-2).Таким образом, ожидается, что маска для лица или другие средства индивидуальной защиты (СИЗ), изготовленные из этого волокна, обеспечат лучшую защиту от передачи вируса. Исследование в настоящее время доступно на сервере препринтов bioRxiv *.

С момента возникновения пандемии коронавирусной болезни 2019 (COVID-19) в конце декабря 2019 года высококонтагиозный вирус SARS-CoV-2 заразил почти 48 миллионов человек и унес более 1,22 миллиона жизней во всем мире. До тех пор, пока не будут разработаны конкретные терапевтические средства или вакцины, надлежащее применение немедикаментозных мер, таких как ношение масок для лица или использование других средств индивидуальной защиты, частое мытье/дезинфицирующая обработка рук и ограничение движения, считается наилучшим способом сдерживания распространения инфекции. распространения SARS-CoV-2.

Хотя маски для лица могут защитить органы дыхания от прямой вирусной инфекции, вирусы могут оставаться активными в течение нескольких часов на поверхности СИЗ. В таких обстоятельствах всегда существует риск дальнейшей передачи вируса, если СИЗ/маска для лица не утилизируются надлежащим образом после использования.

В текущем исследовании ученые стремились сконструировать особый тип пропитанной цинком ткани и определить ее эффективность в поглощении и инактивации респираторных вирусов человека, таких как вирус гриппа А и SARS-CoV-2.Несколько исследований показали, что металлы, такие как медь и цинк, эффективно инактивируют вирусы. Скорее всего, это связано со способностью ионов металлов вызывать гидролиз РНК, разрушение мембран или деградацию вирусных белков.

Поглощение и высвобождение IAV и SARS-CoV-2 из тканей. А) Фотографии образцов хлопка, PA66 и полипропиленовой ткани. B) Схема экспериментальной процедуры по выявлению и выделению РНК-вируса из тканей. C) Анализ удержания вирусной среды тканями на объем вводимой среды.Значения были получены путем взвешивания каждой ткани до и после добавления вирусной среды и после удаления вирусной среды. Г) Анализ удержания вирусной среды тканями, нормализованный по сухой массе каждой ткани. Значения были получены путем взвешивания каждой ткани до и после добавления вирусной среды и после удаления вирусной среды. E) Анализ бляшек IAV, присутствующих в вирусной среде после удаления среды с каждой ткани. F) Количественное определение количества вируса, оставшегося на каждой ткани, нормализованное по сухому весу каждой ткани.G) Влияние различных концентраций твина-80 на показания анализа бляшек IAV. H) Влияние 0,05% твина-80 в PBS на количество вируса, высвобождаемого из каждой ткани. I) Количественное определение титров IAV после абсорбции вируса тканью и промывания тканей PBS или PBS, содержащими различные концентрации твин-80. J) Количественное определение титров SARS-CoV-2 после поглощения вируса тканями и промывания тканей PBS или PBS, содержащими различные концентрации твин-80.Столбики погрешностей указывают на стандартное отклонение. Звездочка указывает значение p, где * p<0,05, ** p<0,005 и ns p>0,05.

Текущий дизайн исследования

Ученые проверили вирусопоглощающую способность различных тканей, в том числе хлопка, полиамида 66 и полипропилена. Также они проверили, способны ли ионы цинка, внедренные в ткани, инактивировать вирусы.

Важные замечания

Способность тканей поглощать вирусы зависит от многих факторов, таких как гидрофобность, воздухопроницаемость и электростатичность.Чтобы определить взаимосвязь между способностью ткани удерживать влагу и поглощать вирусы, ученые последовательно наносили жидкие образцы, содержащие вирус гриппа А и SARS-CoV-2, на хлопок, полиамид 66 и полипропилен. Через 30 минут инкубации они проверили способность тканей удерживать жидкость и поглощать вирусы. Согласно результатам исследования, ткани из хлопка и полиамида удерживают больше жидкости и впитывают больше вирусов, чем ткань из полипропилена. Однако с точки зрения удаления вируса из тканей хлопок оказался менее благоприятным, чем ткани из полиамида.Это указывает на то, что маски для лица или СИЗ, изготовленные из хлопка или полиамида, будут более эффективно улавливать респираторные вирусы.

В качестве металла для заливки они выбрали цинк, а не медь, из-за относительно более высокой склонности цинка к ионизации. Это делает цинк быстро доступным для реакции. Для дальнейших экспериментов они внедрили оксид цинка в полимер полиамида 66 и проверили его способность инактивировать вирус гриппа А и SARS-CoV-2. Согласно результатам исследования, ионы цинка значительно снижали титр вируса за счет дестабилизации поверхностных белков вируса, таких как гемагглютинин и шиповидный белок.Кроме того, они наблюдали, что максимальное снижение титра вируса происходило между 30 секундами и 5 минутами инкубации вируса с полиамидной тканью, залитой цинком.

Примечательно, что ученые заметили, что полиамидная ткань с цинковым покрытием может эффективно инактивировать широкий спектр вирусных нагрузок и что скорость инактивации может превышать количество инфекционного вируса, выделяемого при кашле.

Значение исследования

Результаты исследования показывают, что лицевые маски или другие средства индивидуальной защиты, изготовленные из полиамидных волокон с цинковым покрытием, могут обеспечить лучшую защиту от высокоинфекционных респираторных вирусов, таких как SARS-CoV-2 и вирус гриппа А.Исследование также предполагает, что хлопковые маски с более высокой способностью поглощать вирусы и более низкой способностью выделять вирусы могут фактически увеличить риск вирусной инфекции при повторном использовании без надлежащей стирки. Точно так же маски на основе полипропилена с более низкой способностью поглощать вирусы могут ускорить передачу вируса.

*Важное примечание

bioRxiv публикует предварительные научные отчеты, которые не рецензируются экспертами и, следовательно, не должны рассматриваться как окончательные, направляющие клиническую практику/поведение, связанное со здоровьем, или рассматриваться как установленная информация.

Цинковая маска ShamWow Обзор и где купить?

Возможно, вы видели предложение Винса во многих рекламных роликах As Seen on TV, таких как Shamwow Chamois, SlapChop Food Chopper и Schticky.

Учитывая пандемию Covid-19 и необходимость носить лицевые маски в определенных местах, компания представила антибактериальную тканевую маску из цинка под названием ShamWow Zinc Face Mask.

В марте найти маску для лица было почти невозможно, и из-за дефицита люди даже начали воровать их из больниц, изготавливать их сами или даже использовать нижнее белье, чтобы прикрыть лицо.

К счастью, маски для лица можно найти практически везде. Заправочные станции, универмаги, круглосуточные магазины, черт возьми, вы даже можете маркировать их так, как захотите. Маски для лица постепенно становятся модным аксессуаром.

Однако при покупке лицевой маски следует обращать внимание на качество и ее способность защитить вас от частиц, которые могут проникнуть внутрь.

В этой статье мы рассмотрим цинковую маску для лица ShamWow и посмотрим, подойдет ли она вам.

Посмотреть рекламный ролик о маске для лица ShamWow

С веб-сайта маски ShamWow

Согласно веб-сайту ShamWow, маска Shamwow изготовлена ​​из защитной ткани, изготовленной из зиновых волокон, которые, как известно, защищают вас от частиц которые с большей вероятностью проникнут через дешевые маски для лица.Известно, что цинковые волокна содержат антимикробные волокна, которые обеспечивают химический защитный слой. Поскольку маска сконструирована таким образом, что материал является нетканым, создается меньше зазоров для попадания любых частиц внутрь маски для лица.

Хлопковая подкладка мягкая и не раздражает кожу. Кроме того, хлопковый материал, используемый для подкладки маски Shamwow, обеспечивает воздухопроницаемость, поэтому вы можете чувствовать себя комфортно в маске в помещении или на улице.

Маска для лица Shamwow также имеет лямки из эластичного материала, которые позволяют легко надевать и снимать маску.Он может подстроиться под любую форму и размер лица.

Маски многоразовые и их можно стирать в машине, так что вы можете положить их сразу в стиральную машину, как только вы их наденете.

Чем маска ShamWow отличается от других масок?

Исследования показали, что противомикробные волокна могут снизить вероятность заражения. Это преимущество может дать пользователям маски ShamWow больше уверенности при выходе на публику.

Если вам приходилось носить лицевую маску в жарком климате, то вы знаете, насколько раздражающим может быть ношение лицевой маски или как это может вызвать проблемы с дыханием.К счастью, эта маска сделана из дышащего материала.

Другие маски для лица, представленные на рынке, могут не обеспечивать такой же уровень защиты, как маска ShamWow. Благодаря продуманному дизайну с цинковыми волокнами и дополнительному защитному слою, вы, вероятно, будете безопаснее носить эту маску, чем некоторые дешевые маски из мусорных баков.

Где купить маски ShamWow?

Маски ShamWow производятся в США. Во время пандемии мы рекомендуем поддерживать местный бизнес, а покупая эту маску, вы поддерживаете американские рабочие места.

Важно отметить, что эта маска не сертифицирована CDC как медицинская маска, несмотря на то, что ее сравнивают с масками медицинского назначения. По этой причине медицинские работники должны носить обычные маски.

Если вы хотите купить маску ShamWow Mask, вы можете легко приобрести ее в Интернете на некоторых веб-сайтах или найти прямо здесь, на нашем веб-сайте As Seen on TV за 29,99 долларов США. Мы являемся партнером официального сайта ShamWow.

ДЕТАЛИ ПРЕДЛОЖЕНИЯ:

Маска ShamWow® с цинком имеет внутренний слой из хлопка для комфорта.Всего за 19,95 долларов вы получите маску ShamWow и бесплатную доставку. Кроме того, если вы сделаете заказ сегодня, мы отправим вам вторую маску ShamWow®, просто заплатите отдельную плату в размере 9,95 долларов США, и ваш заказ будет доставлен бесплатно.

Налог с продаж будет применяться к заказам из Калифорнии и Флориды.

К заказам от AK, HI & PR будет применяться дополнительная плата за доставку в размере 9,95 долларов США.

Преимущества маски для лица ShamWow

  • Дополнительная защита Термоскрепленный нетканый материал
  • Содержит цинковые антибактериальные волокна для борьбы с бактериями
  • Машинная стирка, многоразовое использование Немецкий материал, изготовленный в США.Не сделано в Китае
  • Создано в соответствии с рекомендациями CDC

Что скрывается за противовирусной маской?

Поскольку окончательного излечения от пандемии COVID-19 по-прежнему не существует, во всем мире стремительно развивается новый вариант одного из наиболее рекомендуемых средств сдерживания вируса — лицевых масок, но масок, обработанных противовирусным компонентом. От Новой Зеландии до Соединенного Королевства и от Израиля до Соединенных Штатов текстильные технологи внедряют маски с «этим небольшим дополнением», которое, по их словам, поможет остановить распространение вируса.

Независимо от того, используют ли они металлический компонент, такой как медь или оксид цинка, или неметаллическую молекулярную структуру, которая дезактивирует патогены, эти маски обеспечивают предполагаемое спокойствие и экологичность повторного использования. И, хотя эксперты в области общественного здравоохранения говорят, что нет точного мнения о том, насколько обработанные маски более эффективны, чем одноразовые маски или необработанные тканевые маски, их известность является выходом на еще более широкий рынок тканей, убивающих патогены, которые они давно изучают. до того, как разразилась пандемия.

«Мы вписываемся в эту тенденцию, но мы не трендовая компания», — говорит Лиат Голдхаммер, главный технический директор Рамат-Гана, израильского стартапа Sonovia. Корни компании, по словам Голдхаммера, восходят к 2013 году, когда она применяла исследования в области ультразвуковой обработки тканей в Университете Бар-Илан для борьбы с внутрибольничными инфекциями.

Аналогичным образом, в 2016 году компания Livinguard из Цюриха, Швейцария, впервые применила антипатогенные маски для борьбы с передачей туберкулеза; Менеджер компании в США Маркус Хатнак сказал, что маски — это лишь часть миссии компании.

«Наш опыт заключается в гигиене и химии и в создании составов, которые можно наносить на все виды поверхностей и подложек и делать их менее восприимчивыми к биологическому обрастанию, и мы можем делать это на текстиле, в жидкостях, в лосьонах и встраивать их в пластмассы», — сказал Хутнак.

Ли Райли, доктор медицинских наук, профессор и заведующий кафедрой инфекционных заболеваний и вакцинологии Школы общественного здравоохранения Калифорнийского университета в Беркли, сказал, что бум противовирусных масок, вероятно, найдет аудиторию, поскольку американское общество массово маскируется.

— Рынок есть всегда, — сказала Райли. «Это своего рода бутиковая культура. В таком месте, как США, чтобы превратить это в культурное поведение, у вас должен быть какой-то трюк. Противовирусные маски были бы одной из форм уловок, которая была бы привлекательна для определенных рынков. И это в конечном итоге приведет к культурному признанию, и в этом смысле эти маски могут быть очень полезными».

 

Противовирусная маска: новый взгляд на концепт 10-летней давности

Майкл Шмидт, профессор микробиологии и иммунологии в Медицинском университете Южной Каролины, сказал, что новаторская работа по созданию противовирусных масок, наполненных медью, была проведена в 2010 году исследователями из Cupron Scientific в Израиле и Microbac Laboratories в Стерлинге, штат Вирджиния.Эти исследователи пропитывали маски (N95 или тип IIR) оксидом меди, который оказался эффективным вирулицидным средством против гриппа. По словам Шмидта, нынешний поток предложений противовирусных масок основан на этом принципе, и заявления о революционных возможностях следует воспринимать с долей скептицизма; Milliken & Co., например, в 2007 году представила антимикробную одежду, обработанную ионами серебра, для спортсменов и охотников.

Большинство масок, предлагаемых населению, предлагают аналогичные заявления об уничтожении вируса SARS-CoV-2, более 99 процентов.Они отличаются по технологии, времени до убийства и долговечности. Цена масок варьируется; например, Марк Цукерман, партнер Coppermedics, представителя США по маске Virus Buster, разработанной южнокорейским стартапом Medifiber, сказал, что компания нацелена на работников, оказывающих помощь на переднем крае, по цене не более 10 долларов за маску. Sonomask доступен на Amazon по цене 69 долларов за одну, 43 доллара за штуку при покупке партиями по шесть штук или 34,90 доллара за штуку партиями по 10 штук (компания заявляет, что маска теперь проверена на эффективность в течение 65 коммерческих циклов стирки).Маска Livinguard продается по цене 24,95 доллара за двухслойную модель и 29,95 доллара за трехслойную (согласно компании, ее можно стирать еженедельно в течение 30 недель).

Шмидт сказал, что большая часть общедоступной информации о заявленной эффективности масок для уничтожения вирусов не соответствует количеству научной строгости, показанной в статье 2010 года, и нынешний нормативный климат в США, вероятно, не прояснит, какие, если таковые имеются, из новых масок может быть наиболее эффективным.

«Эта технология уничтожения вредителей существует уже давно, — сказал он.«Но в основном это регулируется EPA в соответствии с законом под названием «Федеральный закон об инсектицидах, фунгицидах и родентицидах».

Шмидт сказал, что закон, принятый в 1910 году, был главным образом разработан для регулирования пестицидов в сельском хозяйстве. «Но поскольку это статья, и она убивает «вредителей», у Агентства по охране окружающей среды действительно есть юрисдикция — у FDA, NIOSH и OSHA есть доля кожи в игре, но никто не стал владельцем противомикробных масок. Нынешняя администрация выпотрошила EPA.Они против регулирования, и это было обнародовано в Министерстве труда, которое контролирует OSHA, и, честно говоря, я не думаю, что у CDC есть время беспокоиться об этом. Они позволяют потребителю быть информированным покупателем. Пусть покупатель будет бдителен.»

 

Кто такой информированный покупатель?

Шмидт также сказал, что потенциальные клиенты, пытающиеся выяснить, является ли противовирусная маска более защитной, чем ухоженная необработанная многослойная тканевая маска, не получат большой помощи от поставщиков или регулирующих органов.

«Ответ на этот вопрос заключается в том, что эти исследования не проводились, и их сложно провести», — сказал он. «Помните, если вы настаиваете на общественном здравоохранении, все люди разные. Я мою руки, наверное, чаще, чем другие, потому что знаю, что делаю с ними, тогда как другие люди не обращают на это никакого внимания. Таким образом, существует огромное разнообразие».

Цукерман сказал, что Coppermedics старается не превышать параметры, изложенные в разрешении FDA на экстренное использование антипатогенных масок.

«Мы не претендуем, но представляем отчет, выданный по результатам исследования поверхностного материала. И мы, конечно же, не утверждаем, что маска может вылечить или защитить владельца от болезни. Мы можем сказать, что эта маска обеспечивает лучшие шансы, учитывая результаты поверхностного материала».

Райли сказал, что, по его мнению, противовирусные маски действительно могут деактивировать патогены, но, как и Шмидт, сказал, что хорошая базовая гигиена и маска достаточной плотности, вероятно, достаточны для обеспечения безопасности людей.

«Я думаю, что они обеспечивают противовирусный эффект, но здесь это не так важно», — сказал он. «Это действительно эффективность фильтрации. Производители масок оправдывают использование этого типа масок тем, что люди, как правило, прикасаются к своим маскам, и если живой вирус все еще находится на маске, вы можете заразиться от рук. Но опять же, людям постоянно говорят использовать дезинфицирующие средства для рук, так что это, вероятно, будет более эффективно, чем просто полагаться на противовирусный эффект маски. Да, я думаю, что эти маски действительно способствуют уменьшению распространения вируса, но влияние этого, я думаю, будет просто постепенным.

Несмотря на то, что влияние усиленных масок на нынешнюю пандемию может быть, а может и не быть, разработчики говорят, что повсеместно распространенные в культурном отношении предписания носить маску также будут стимулировать устойчивую готовность задуматься о том, насколько широко распространены патогены, а также о возможности выхода на рынки далеко за пределы кончик носа.

«Это определенно развивающийся рынок, — сказал Цукерман из Coppermedics. «Люди будут принимать решения о своем защитном поведении более осознанно, поскольку мир движется вперед от этого.Во время сезона гриппа люди будут больше осознавать, как защитить себя в определенных ситуациях, и это будет гораздо более распространенным явлением».

«Да, отношение людей к маске как к еще одному предмету, который они носят с собой, определенно изменилось», — сказал Голдхаммер из Sonovia. «Но мы не видим себя просто компанией по производству масок. Теперь люди понимают, что мы подвергаемся воздействию вирусов и бактерий в целом. Мы уже работали над пилотными проектами с партнерами по автомобильной промышленности задолго до начала этой пандемии.Почему? Из-за появления автономных транспортных средств и других транспортных средств, которые используются более чем одним пользователем. Это будет повсюду, и не только для масок».

.

Добавить комментарий

Ваш адрес email не будет опубликован.