Базилик от рака: Семь лучших целебных трав и пряностей, которые всегда должны быть на кухне

Содержание

Семь лучших целебных трав и пряностей, которые всегда должны быть на кухне

Невозможно представить себе народную медицину без лекарственных трав и пряностей. И хотя эти растительные компоненты использовались в течение сотен лет для лечения различных заболеваний, исследователи, наконец, начинают научно обосновывать уникальные способности этих трав, что лишь только увеличивает уверенность в их эффективности. 

Если вы заботитесь о своем здоровье и делаете акцент на лекарственных препаратах натурального происхождения, советуем расширить ваш арсенал домашних средств, добавив в него 7 самых мощных и многофункциональных трав и пряностей, о которых мы расскажем в сегодняшнем обзоре.

1. Куркума: лечит артрит

Куркума — пряность, придающая характерный желтый оттенок карри — может творить настоящие чудеса с нашим здоровьем. Входящий в ее состав куркумин — это мощнейшее противовоспалительное соединение, которое действует по многим фронтам: сокращает отеки и устраняет боли при артрите, предотвращает рак толстой кишки и снижает риски возникновения болезни Альцгеймера. 

В одном исследовании, проведенном в 2006 году, ученые из Калифорнийского университета установили, что куркумин помогает очистить мозг от бляшек, характерных при развитии болезни Альцгеймера. А противораковое действие достигается благодаря содержанию в куркуме кверцетина — еще одного мощного антиоксиданта, содержащегося также в луке, яблоках и капусте.

2. Корица: регулирует уровень сахара в крови

Больше всего корицу ценят за ее натуральные противовоспалительные свойства. Однако в ходе недавнего исследования, проведенного в Германии, было установлено, что ее регулярное употребление помогает понизить уровень сахара в крови больных диабетом 2 типа в среднем на 10%. В исследовании участвовал экстракт корицы, однако чай с этой пряностью или добавление ее в блюда также будет эффективно. 

Помогает корица и при проблемах с холестерином, заметно понижая его уровень. В другом исследовании больных сахарным диабетом, регулярное употребление этой пряности помогло понизить уровень холестерина в крови на 13% и триглицеридов на 23%.

3. Розмарин: защищает от канцерогенов

Знаете ли вы, что в процессе сильного поджаривания продуктов на сковороде или гриле образуются очень опасные соединения — гетероциклические амины, обладающие канцерогенной активностью. Но уровень этих соединений значительно снижается, если предварительно замариновать продукт с добавлением розмарина — об этом нам сообщают исследователи Университета штата Канзас. «Розмарин содержит карнозол и розмариновую кислоту — 2 мощных антиоксиданта, которые разрушают гетероциклические амины «, — объясняет ведущий исследователь Скотт Смит. 

Также розмарин благотворно влияет на нервную систему, защищая от бессонницы, упадка сил и избавляя от тревожности.

4. Имбирь: устраняет тошноту

Имбирь может предотвратить расстройство желудка, возникающее по целому ряду причин, в том числе и при беременности, укачивании и химиотерапии. В одном исследовании пассажиры круизных судов, путешествующие по бурному морю, принимали по 500 миллиграммов имбиря каждые 4 часа — это было столь же эффективно, как и употребление противоукачивающих препаратов. В другом исследовании пациенты принимали по 940 миллиграммов имбиря — результаты даже превзошли эффективность лекарств. 

А еще имбирь способен понизить кровяное давление, регулируя уровень кровотока. А его натуральные противовоспалительные свойства помогут облегчить боли при артрите. В ходе исследования, проведенного в Медицинском университете Майями, почти 100% из 124 обследованных пациентов с остеоартритом коленного сустава отметили существенное снижение боли после курса употребления имбиря.

5. Базилик: побеждает стресс

Классический зеленый базилик, который используется для приготовления песто, обладает поистине целительным воздействием. В первую очередь специалисты отмечают его способность эффективно снижать стресс за счет балансирования уровня адреналина, норадреналина и серотонина. А индийский базилик тулси, часто используемый в аюрведической медицине, еще и облегчает тяжесть в животе и устраняет головные боли. 

Чай из «священного базилика» тулси также уменьшает риск развития рака молочной железы, регулируя уровень кровоснабжения. Листья этого душистого растения чрезвычайно богаты антиоксидантами, которые защищают клетки от преждевременного старения в результате чрезмерного окисления в нашем организме.

6. Зверобой: снимает тревожность

Зверобой — очень популярная в нашей стране трава из мира народной медицины. Наука подтвердила ее полезные свойства: по результатам многочисленных исследований, отвар и препараты со зверобоем способны без побочных эффектов облегчить и устранить умеренный уровень депрессии и тревожности. 

Зверобой благоприятно воздействует на центральную нервную систему, устраняя стресс и напряжение. Эта трава содержит в большом количестве мелатонин — гормон, который регулирует наши циклы сна и бодрствовании, а также стимулирует выработку собственного мелатонина в организме, что улучшает качество сна. Для лечения бессонницы используют и настойку на спирту, и чай из зверобоя.

7. Чеснок: снижает риск рака

По результатам исследования, опубликованного в Американском журнале клинического питания, регулярное употребление чеснока способно уменьшить риск возникновения рака яичников, толстой кишки и других видов рака. Японские клинические испытания также показывают, что употребление чеснока в виде биодобавки способно уменьшить размеры и количество предраковых новообразований. 

Также полезен чеснок и для сердечно-сосудистой системы: в нем содержится более 70 активных фитонутриентов, в том числе аллицин, способный понижать высокое кровяное давление. Чеснок помогает предотвратить риски инсульта — об этом сообщают результаты клинических исследований, проведенных в Калифорнийском университете.

Питание, как профилактика онкологических заболеваний

Многие онкологи считают, что наиболее эффективная профилактика рака — это здоровое питание. Опытным путем выделены некоторые продукты, регулярное употребление которых помогает снизить риск развития онкологических заболеваний:

Брокколи, а также обычная, цветная и брюссельская капуста содержат антиоксиданты, влияющие на снижение риска возникновения опухоли молочной железы и другие виды рака. Вещество изотиоцианат, содержащиеся в капусте, является токсичным для клеток опухоли. При этом оно никак не влияет на нормальные клетки.

Цельные зерна содержат различные противораковые соединения, в том числе антиоксиданты, пищевые волокна и фитоэстрогены. Употребление злаков и цельнозерновых продуктов в адекватных количествах может снизить риск развития рака толстой кишки.

Зелень с темными листьями

 (шпинат, руккола, базилик) — богатый источник каротиноидов, способствующих выведению из организма опасных свободных радикалов.

Виноград содержит ресвератрол, являющимся антиоксидантом, способным предотвратить повреждение клеток.

В состав зелёного чая входят флавоноиды, которые способны предотвратить или замедлить развитие нескольких типов рака, включая рак толстой кишки, печени, молочной железы и простаты.

Томаты — источник соединения под названием ликопин, которое помогает снизить риск рака простаты, молочной железы, легких и желудка.

Черника по сравнению с другими ягодами содержит самое большее количество полезных соединений, которые снижают риск развития любых видов рака.

Льняное семя. В его состав входят лигнаны, способные оказывать на организм эффект антиоксидантов и блокировать или подавлять раковые изменения.

Морские водоросли имеют в своем составе кислоты, которые помогают при лечении рака легких.

Цитрусовые. Грейпфруты содержат монотерпены, которые помогают снизить риск развития рака всех видов, выводя канцерогенные вещества из организма. Некоторые лабораторные исследования также показали, что грейпфруты могут препятствовать развитию рака молочной железы. Апельсины и лимоны содержат лимонен, стимулирующий работу иммунных клеток (пример, лимфоцитов), которые уничтожают раковые клетки.

Кофе снижает риск развития базальноклеточной карциномы — одного из самых распространенных видов рака кожи. К такому выводу пришли ученые из Бостонского отделения Американской ассоциации научных исследований в области раковых заболеваний. Они утверждают также, что кофе полезен для профилактики плоскоклеточной карциномы и меланомы, наиболее редкой и самой опасной формы рака кожи.

Зона риска. Что из пищевых факторов провоцирует рак?

Если постоянно перекусывать сладостями, то риск рака матки резко возрастает, предупреждают женщин шведские ученые из Каролинского института. Дамы, позволяющие побаловать себя печеньем, кексами 2-3 раза в неделю, на 33% чаще страдают от рака. Если есть мучное и сладкое больше трех раз в неделю, то риск увеличивается до 42%.

Оксфордские ученые тоже сделали недавно сенсационное заявление: даже малое количество алкоголя увеличивает риск раковых заболеваний. Согласно их исследованию, каждый десятый британец и одна из 33 британок страдают от рака из-за употребления алкоголя. В первую очередь, спиртное провоцирует возникновение рака груди, ротовой полости, пищевода и кишечника.

Ученые из Немецкого центрального офиса по вопросам алкогольной зависимости (DHS) пришли к похожим выводам. Даже простое пиво повышает риск онкологических заболеваний.   Медики подсчитали, что если каждый день выпивать аналог 50 граммов чистого спирта, шансов заполучить рак становится больше в три раза. Если же количество спиртного в сутки превышает 80 граммов, вероятность заболевания раком становится больше в 18 раз. Когда же сюда добавляется еще и курение, риск увеличивается в 44 раза.

На заметку

Известно более 100 различных форм рака. При этом 80% из них можно вылечить полностью, но при одном условии — болезнь важно диагностировать на ранней стадии. Следует обратиться к онкологу, если:

  • температура 37-37,3 градуса сохраняется более 1-го месяца;
  • длительное время увеличены лимфоузлы;
  • родинки на коже вдруг меняются в размерах, цвете;
  • любые уплотнения в груди, необычные выделения у женщин;
  • затруднение мочеиспускания у мужчин.

При наличии данных симптомов обратитесь к врачу!


Еда против онкологии. 10 продуктов, способных предотвратить рак | Советы | ЗДОРОВЬЕ

Причины развития у людей онкологических заболеваний неизвестны современной медицине. Врачи выделяют лишь ряд факторов, которые могут способствовать появлению рака. Среди них – проблемы окружающей среды, неправильный образ жизни, нездоровое питание. Диетолог Елена Толоконникова рассказывает, какие продукты могут предотвратить развитие онкологических заболеваний в организме.

Брокколи

В брокколи содержится много антиоксидантов, которые оказывают положительное воздействие на организм – в том числе снижают риск заболевания раком. Этот овощ богат сульфорофаном – веществом, поддерживающим иммунную систему человека и сводящим к минимуму возможность образования опухолей. «Брокколи нужно есть хотя бы раз в неделю, — советует диетолог. – Такими же полезными свойствами обладает брюссельская капуста, поэтому эти овощи можно чередовать в своем меню».

Черника

Черника – источник антоциана. Это мощный антиоксидант, который «связывает» свободные радикалы и не дает развиться опухоли. Кроме того, в ней содержится эллаговая кислота, которая не только омолаживает организм, но и блокирует раковые клетки. «Еще в качестве профилактики онкологических заболеваний полезны малина и ежевика, — отмечает Толоконникова. – Но черника в этом списке – самая эффективная. К тому же, она полезна для зрения».

Томаты

Содержащийся в томатах ликопин, который и придает овощу красный цвет, способен уничтожать свободные радикалы и эффективно бороться с раковыми клетками. Особенно много этого вещества в помидорах черри. Чтобы ликопин лучше усваивался, помидоры рекомендуют сбрызгивать оливковым маслом: жиры усилят действие антиоксиданта.

Авокадо

Авокадо известен как очень эффективный антиоксидант благодаря содержанию глутатиона. Это вещество защищает организм от свободных радикалов и предотвращает появление рака. «Из авокадо можно приготовить невероятно количество вкусных и питательных блюд, — говорит диетолог. – Можно порезать его на бутерброд или же приготовить соус гуакамоле»

Цитрусовые

В цитрусовых фруктах немало полезных веществ. Так, апельсины и лимоны стимулируют работу иммунитета и способствуют уничтожению раковых клеток. Грейпфруты же выводят из организма канцерогены, тем самым в разы уменьшая риск появления онкологических заболеваний. Диетолог напоминает, что цитрусовые лучше не есть на пустой желудок во избежание неприятных ощущений и изжоги.

Зеленый чай 

Полезные свойства зеленого чая можно перечислять очень долго. Он успокаивает нервную систему, очищает организм и даже предотвращает появление онкологических заболеваний. Зеленый чай не дает раковым клеткам расти. «Пейте его хотя бы раз в день, — советует Толоконникова. – Ваше самочувствие улучшится!».

Грецкие орехи

Пользу грецких орехов незаслуженно преуменьшают, а ведь они способствуют росту активности иммунных клеток. Врачи считают, что грецкие орехи помогают даже бороться с раком на ранних стадиях, не давая раковым клеткам размножаться.

Имбирь

Корень имбиря обладает антиоксидантными и  антиканцерогенными свойствами. Он укрепляет иммунитет, блокирует раковые клетки и предотвращает рост новообразований в организме. Имбирь можно добавлять не только в еду, но и в чай: это придаст напитку пикантности и оздоровит организм.

Виноград

В винограде содержится ресвератрол – растительный гормон, который убивает раковые клетки. Это вещество даже уже пораженному опухолью организму, не говоря уже о профилактике онкологических заболеваний. И вкусно, и полезно!

Чеснок

Всем известно, что чеснок эффективен в борьбе с вирусами, но, оказывается, он способен предотвратить не только простуду, но и онкологию. Содержащиеся в чесноке фитонциды не дают раковым клеткам размножаться. Один зубчик в день – и ваш организм надежно защищен. При этом чеснок необходимо есть именно в сыром виде: при термической обработке полезные вещества не сохранятся.

Базилик указан как священный продукт против рака! Подойдите к чашке чая с базиликом, успокаивающим и антиоксидантным, защищающим желудок и предотвращающим простуду.

Slow posted this 02 August 2021 По словам Нан Кейко, профессионального консультанта по питанию из Японии, в Древней Греции базилик использовался в качестве лекарства. Согласно журналу Японской ассоциации фармацевтов, базилик и другие специи могут помочь подавить активные формы кислорода, которые могут вызвать рак, поэтому он может противораковые эффекты.

Нан Хуизи также отметила, что бета-каротин в базилике может превращаться в организме в витамин А. Он обладает антиоксидантным действием и может помочь бороться с реактивными формами кислорода, которые могут вызывать артериосклероз, рак и другие заболевания. Национальный институт рака даже внес в список базилик Можно сказать, что растительная пища, которая помогает предотвратить рак, является вполне здоровым и хорошим ингредиентом. (Рекомендация редактора: возрождение после прекращения рака! Самая раздражающая еда однажды спасла ей жизнь)

А самый распространенный на Тайване базилик «Девятислойная пагода», как основная разновидность базилика, по данным Министерства, богат β-каротином. здоровья и благополучия Информация, предоставленная интегрированной справочной службой FDA, показывает, что по сравнению со средним ломтиком базилика, который содержит только 1977 микрограммов на 100 г, высота девятиэтажной башни составляет 9623 микрограмма, что почти в пять раз больше, чем у нее. богаче и питательнее.

Аса, консультант по снижению веса и диетолог из Японии, также отметила, что базилик богат витамином К, который может помочь поддерживать здоровье костей и кровеносных сосудов. Он также содержит мощный антиоксидант витамин Е, который может помочь расширить кровеносные сосуды и улучшить кровь. кровообращение Снимает мышечную усталость, улучшает холодные руки и ноги и другие эффекты.

Нан Хуцзы также подчеркнула, что линалоол, эвгенол и другие ароматические компоненты базилика также обладают успокаивающим и расслабляющим действием, что помогает уменьшить умственную усталость. В то же время базилик также может помочь улучшить работу желудочно-кишечного тракта, уменьшить гастрит и повышенную кислотность. И другие. симптомы, способствуют пищеварению.

Мало того, базилик также обладает мощными бактерицидными и антибактериальными эффектами, которые помогают предотвратить бактериальные заболевания, такие как простуда, бронхит и разбитость рта. Он также содержит такие ингредиенты, как сапонин, который обладает уменьшающим кашель эффектом и имеет ряд полезных для здоровья свойств. эффекты.

Однако Аса также напомнил, что, хотя базилик не имеет явных побочных эффектов, у некоторых людей есть аллергия на базилик, и им следует уделять больше внимания.Кроме того, базилик также может вызывать схватки, поэтому беременным женщинам следует избегать чрезмерного употребления.

Нан Хуэйцзы также рекомендует простой метод приготовления чая с базиликом, который легко содержит множество питательных веществ, содержащихся в базилике:
  1. Положите в чашку 1 чайную ложку сушеного базилика или 5-6 кусочков свежих листьев базилика.
  2. Налейте горячую воду и подождите 3-4 минуты, чтобы насладиться
  3. Вы также можете добавить черный чай, чтобы наслаждаться вместе, или добавить мед по вкусу, чтобы его было легче есть.

Базилик — это разновидность ванили. В зависимости от региона существует множество разновидностей. В Европе и Америке распространены базилик душистый, базилик лимонный, базилик пурпурный, а в азиатской кухне распространена девятиуровневая пагода. многие разновидности, такие как африканский голубой базилик и тайский базилик (Ocimum basilicum var. thyrsiflora).

Девятиэтажная пагода представляет собой разновидность базилика, выращиваемого на Тайване. Соцветия этого базилика накладываются друг на друга, как пагода, отсюда и название. «Девять» — это воображаемое число, описывающее большое количество. Девятиэтажная пагода имеет сильный аромат и подходит для жаркого, соленой хрустящей курицы и других тайваньских блюд для усиления вкуса. (Рекомендация редактора: только не чернейте! Секретный трюк, позволяющий продлить срок хранения девятиэтажной пагоды в 2 раза)

Сладкий базилик — главный ингредиент итальянской кухни. Его внешний вид похож на девятиэтажную пагоду, но листья сладкого базилика округлее и вкуснее, он освежает и немного сладковат, а вкус отличается от девятиэтажной башни.

Исследователи БФУ им. И. Канта выяснили, как сделать базилик полезнее

Биологи БФУ им. И. Канта исследовали возможность повышения концентрации селена в листьях базилика за счет интенсификации биосинтеза биологически активных веществ, влияющие на полезные свойства пряно-ароматического растения. Как рассказала исследователь института живых систем Любовь Скрыпник, селен — это микроэлемент, обладающий двойственным действием на живые организмы. С одной стороны, при недостатке селена в организме человека повышается риск развития некоторых заболеваний, например рака, сердечно-сосудистых заболеваний или диабета. С другой стороны, высокие дозы селена могут вызывать токсические эффекты, как у людей, так и у растений. Поэтому при обогащении растений селеном, очень важно подбирать оптимальные концентрации данного микроэлемента в зависимости от способа применения и вида растения.

«В рамках нашего исследования мы увидели, что введение в питательный раствор микроэлемента селена (в концентрации 5 мкМ) или опрыскивание его раствором растений (в концентрации 10 мкМ) являются оптимальными, обеспечивающими безопасный уровень данного микроэлемента в листьях базилика. Кроме того, при данных концентрациях и способах обработки выявлено увеличение содержания эфирных масел, гидроксикоричных кислот, суммы фенольных соединений и антиоксидантов в базилике», — отметила Любовь Скрыпник.

По словам исследователя, в настоящее время многие овощи, в особенности салатные и пряные растения, культивируются гидропонным методом. Благодаря этому можно не только получать урожай круглый год, но и целенаправленно задавать и контролировать условия выращивания.

«Изменение условий выращивания растений, например, соотношения макро- и микроэлементов в питательной среде, является эффективным способом регуляции вторичного метаболизма растений, а, следовательно, и уровня в них биологически активных соединений. Полученные результаты могут быть использованы агропредприятиями, занимающимися выращиванием базилика для получения более качественной, с точки зрения питательных свойств, продукции».

Результаты исследования, над которыми также работали аспирант 2-го года обучения Элина Токупова и магистрант 1 года обучения Анастасия Новикова, опубликованы в авторитетном научном журнале «Plants».

Как не заболеть раком.

Ученые пока не нашли способ, как не заболеть раком. Но для профилактики возникновения онкологических заболеваний необходимо придерживаться определенных правил в жизни, изменить некоторые привычки.

Виды профилактики

Определенные медициной этапы предупреждения заболевания онкологией способствуют:

· заострению внимания людей на предрасполагающие к раку факторы, которые они могут исключить из своей жизни самостоятельно;

· повышенной настороженности тех, кто находится в группах риска;

· проведению тщательного контроля состояния у тех, кто уже получил противораковое лечение.

Первичная профилактика онкозаболеваний предполагает изменение образа жизни на более здоровый.

Вторичная профилактика рака: выявление лиц, предрасположенных к заболеванию онкологией, их периодическое обследование с целью возможно более ранней диагностики рака, когда возможно наиболее эффективное лечение.

Третичная профилактика злокачественных опухолей заключается в медицинском наблюдении за пациентами, ранее получившими лечение рака. С этой целью проводят лабораторные, инструментальные исследования для выявления рецидивов рака, его метастазирования, появления других видов опухолей.

 

Первичная профилактика: что делать чтоб не заболеть раком?

Недавнее исследование, в ходе которого ученые провели анализ более полутора миллионов историй болезней онкологических больных показало, что есть три основных фактора, провоцирующих рак.

1.        Курение;

2.        Избыточный вес;

3.        Употребление алкоголя.

Важно, что любой человек при желании способен исключить или уменьшить их влияние на свою жизнь.

 

Другие факторы, которые увеличивают вероятность заболевания раком, но которые можно изменить:

·           УФ-излучение;

·           Малоподвижность;

·           Состав питания: сниженное потребление кальция, клетчатки, овощей и фруктов, увлечение продуктами из красного мяса.

·           Инфекционные заболевания, провоцирующие развитие новообразований.

Благодаря внесенным в жизнь изменениям, происходит оздоровление и укрепление организма, и он успешнее противостоит любым болезням.

 

Первичная профилактика онкологических заболеваний строится на соблюдении правила шести «не»:

1.        Не курить. Прекратив вдыхать табачный дым со всеми его канцерогенами, можно снизить вероятность рака легких на 90%.Также значительно уменьшается риск рака мочевого пузыря, печени, языка, губы и других локализаций. Никотин сигарет увеличивает заболеваемость раком груди. Важно бросить курение навсегда, так как даже без табака и никотина сигареты приводят к нарушениям на уровне ДНК.

2.        Не употреблять алкоголь. Снизить риск рака печени, горла, рта, пищевода, кишечника в два раза можно, всего лишь уменьшив крепость потребляемого алкоголя. Для мужчин отказ от спиртного означает, что шанс заболеть раком простаты для них становится меньше на 60%. Для женщин, не употребляющих алкоголь с подросткового возраста, риск рака молочной железы уменьшается в 3-5,5 раз. Если отказаться от рюмки в зрелом возрасте, вероятность злокачественной опухоли в груди будет ниже на 25%.

3.        Не набирать лишний вес. Доказано, что лишние килограммы сопутствуют 60% случаев рака тела матки, половине случаев рака мочевого пузыря, повышают риск онкологии почек и поджелудочной железы. При нормальном весе, когда ИМТ менее 25, шансы заболеть раком уменьшаются вдвое.

4.        Не злоупотреблять солнечными ваннами. Пребывание на солнце не должно быть длительным, так как агрессивное излучение может привести к развитию меланомы – самой опасной формы рака кожи. Онкологи предупреждают, что между 11 и 16 часами находиться на открытом солнце очень вредно. В остальное время кожу также необходимо защищать специальными лосьонами и кремами. Загар в солярии, особенно с молодых лет, еще более опасен: рак кожи у таких людей возникает чаще на 75%.

5.        Не вести сидячий образ жизни. Малоподвижность – путь не только к ожирению и инфаркту, но, по словам ученых, и к раку кишечника и груди у пожилых. Умеренные, но регулярные физические нагрузки укрепляют иммунитет и помогают организму противостоять онкологии.

6.        Не есть вредную пищу.

·           Красное мясо, особенно жирное, лучше есть в минимальном количестве или полностью заменить его на мясо птицы, рыбу. Колбаса, сосиски, жареные и копченые мясопродукты должны быть под запретом для тех, кто решил уберечься от рака. Если в неделю потреблять не больше 70 г красного мяса в переработанном виде, риск развития онкологии снижается на 10%.

·   Сахар, сладкая газировка способствуют заболеванию поджелудочной железы. Если от них отказаться, риск рака поджелудочной становится меньше на 87%.

·    Рацион с недостаточным содержанием кальция, клетчатки, фруктов, зелени, овощей не подходит для защиты от рака. Содержащиеся в вегетарианских продуктах антиоксиданты препятствуют процессам мутации клеток, предотвращая развитие онкологии. Обладают заметной противораковой активностью грибы, помидоры, сливы, абрикосы, персики, ягоды, капуста, лук, чеснок, зеленый чай, оливковое масло, куркума, имбирь, горький шоколад. Их обязательно стоит включать в меню тех, кто не хочет болеть раком.

Стоит добавить, что необходимо избегать ситуаций, в ходе которых можно заразиться инфекционными заболеваниями, провоцирующими онкологические. Это вирусы:

·    папилломы человека – рак шейки матки;

·  Эпштейна-Барра – лимфома, рак желудка, носоглотки, губы, ротовой полости;

·  гепатитов В,С – рак печени;

·  ВИЧ – рак матки, саркома Капоши, ряд лимфоидных опухолей.

Присутствие в ЖКТ особой бактерии Helicobacter pylori вызывает язву желудка и гастрит, но она может провоцировать их злокачественное перерождение.

 

Вторичная профилактика

Меры вторичной профилактики направлены на раннее выявление раковых и предшествующих им заболеваний, выделение групп риска и формирование онкологической настороженности у населения и медицинских работников.

Важно, что успех вторичной профилактики обеспечивается как индивидуальными действиями человека, так и мерами, предпринимаемыми на государственном уровне для уменьшения заболеваемости и смертности.

Что можно сделать самому:

·      Получить больше знаний о болезни. Распространенность онкологии, случаи заболеваний и смерти от них среди близких и знакомых заставляют человека искать больше информации о раке, его причинах и симптомах. На основе этих знаний проводить регулярную самодиагностику.

·      Проходить профилактические осмотры и рекомендуемые врачами обследования. Наиболее важно это для тех, кто находится в группе риска.

·      Срочный визит к врачу в случае появления неясных, подозрительных симптомов.

Исследования, позволяющие выявлять наиболее распространенные виды онкологических заболеваний в ранний период, часто до появления симптомов:

·      ежегодная флюорография – в легких и средостении;

·      УЗИ молочных желез – до 40 лет и маммография женщинам после 40 – раз в год-два;

·      посещение гинеколога и цитологическое исследование мазка из шейки матки – женщинам раз в год;

·      посещение уролога для исследования простаты и анализа на простатспецифический антиген – мужчинам после 40 лет раз в год;

·      цитогенетическое исследование при высокой вероятности патологии, обусловленной генетическими механизмами – рак молочной железы, простаты, яичников;

·      компьютерная томография, МРТ, контрастированием;

·      эндоскопия, гастроскопия – при вероятности развития опухоли желудка, бронхоскопия – когда есть риск рака легких и бронхов;

·      выявление онкомаркеров в анализах крови – у большинства видов рака есть химические вещества, содержание которых увеличивается при росте опухоли.

 

Третичная профилактика злокачественных новообразований

Этот этап профилактики предназначен для тех, кто уже встретился с этим заболеванием и прошел все необходимое лечение. Если диагноз был поставлен в ранние сроки, возможно полное излечение. Но это не гарантирует, что болезнь не вернется.

Что делать, чтобы не заболеть раком повторно?

·           Регулярно посещать онколога для осмотра и проведения необходимых плановых исследований.

·           Строго соблюдать рекомендации по противорецидивной терапии, принимать поддерживающие организм препараты.

·           Поменять образ жизни в соответствии с мерами первичной профилактики.

·           Избегать контактов с возможными канцерогенами, изменить род деятельности, если он ухудшает здоровье.

·           Своевременно лечить инфекции и гормональные нарушения, способные провоцировать онкологию.

В заключение стоит отметить, что вопросы профилактики онкологических заболеваний касаются всех. Полностью исключить влияние канцерогенов на свою жизнь невозможно – они находятся во вдыхаемом воздухе, в пище, в воде. К мутациям клеток, стимулирующим их неконтролируемое размножение, приводят различные химические вещества, применяемые повсеместно. В сочетании с ослабленным иммунитетом вероятность рака возрастает.

Поэтому первый ответ на вопрос как избежать рака – заботиться об укреплении организма, чтобы он имел возможность бороться с атипичными клетками. Звучит банально, но реально работает.

Если задуматься, как уберечь себя от рака, то во вторую очередь следует понять, что в этой борьбе нельзя расслабиться. Все время стоит помнить о факторах риска и своевременно обращаться к врачу, чтобы пройти необходимое обследование.

 


Добавка селена повысила полезность базилика

Ученые из Балтийского федерального университета имени И. Канта установили, что микромолярные концентрации селена увеличивают содержание полезных биологически активных соединений в листьях базилика душистого. Полученные результаты могут быть использованы на агропредприятиях, занимающихся выращиваем этого растения, с целью получения более качественной продукции. Работа опубликована в журнале Plants.

В настоящее время многие сельскохозяйственные растения выращивают гидропонным методом, то есть на искусственных средах без почвы. Питание они получают из раствора, окружающего корни. Этот метод позволяет не только круглый год получать урожай, но также настраивать и контролировать условия выращивания. Одно из них — соотношение макро- и микроэлементов в питательной среде. Изменение элементного состава может изменять метаболизм и уровень биологически активных соединений, которые обуславливают пищевую ценность тех или иных растений.

«Недостаток химического элемента селена в человеческом организме иногда становится причиной сердечно-сосудистых и эндокринных заболеваний. Информация о его влиянии на растительные организмы до сих пор остается противоречивой. Данный микроэлемент не относится к жизненно необходимым для растений. Однако во многих исследованиях показано, что введение низких доз селена в удобрения или питательные среды при гидропонном способе культивирования положительно сказывается на росте и развитии растений. Кроме того, было установлено, что селен влияет на метаболизм, что приводит к более интенсивному накоплению растениями биологически активных веществ различной природы», — рассказывает ведущий автор работы, доцент Института живых систем БФУ имени И. Канта Любовь Скрыпник.

Объектом исследования ученые выбрали базилик душистый (Ocimum basilicum L.), во всем мире известный своими пряно-ароматическими качествами. Базилик обладает бактерицидными и противовоспалительными свойствами. Традиционно он использовался в качестве лекарственного средства при лечении головных болей, кашля, диареи и почечной недостаточности. Его целебные свойства связаны с наличием в листьях множества химических соединений. В частности, они богаты фенольными и гидроксикоричными кислотами, которые вносят основной вклад в антиоксидантные свойства экстрактов листьев базилика. Также большое значение для пищевого применения базилика имеют эфирные масла и витамины, содержащиеся в листьях. Кроме того, базилик, в отличие от многих других растений, не накапливает высокие дозы селена, которые могут вызывать токсические эффекты.

Результаты эксперимента показали, что оптимальная концентрация селена составляет 5 мкМ при его добавлении в питательную среду растений, выращиваемых гидропонным методом, и 10 мкМ при опрыскивании листьев его раствором. Такая концентрация не только безопасна для растения, но и способствует увеличению содержания эфирных масел, гидроксикоричных кислот, фенольных соединений и антиоксидантов. Благодаря этому базилик становится не только вкуснее и ароматнее, но и полезнее.

Экстракт листьев базилика священного снижает онкогенность и метастазирование клеток агрессивного рака поджелудочной железы человека in vitro и in vivo: потенциальная роль в терапии

Abstract

Существует острая необходимость в разработке альтернативных методов лечения смертельного рака поджелудочной железы (РПЖ). Ocimum Santum («Священный базилик») тысячелетиями использовался в традиционной индийской медицине, но его противоопухолевый эффект остается в значительной степени неизученным. Здесь мы показываем, что экстракты О.листья святилища ингибируют пролиферацию, миграцию, инвазию и индуцируют апоптоз клеток PC in vitro . Экспрессия генов, которые способствуют пролиферации, миграции и инвазии клеток РПЖ, включая активированные ERK-1/2, FAK и p65 (субъединица NF-κB), снижалась в клетках РПЖ после обработки O. Sancum . Внутрибрюшинные инъекции водного экстракта значительно ингибировали рост ортотопически трансплантированных клеток PC in vivo (p<0.05). Гены, ингибирующие метастазирование ( E-кадгерин ) и индуцирующие апоптоз ( BAD ), были значительно активизированы в опухолях, выделенных у мышей, получавших экстракты O.sancum , в то время как гены, способствующие выживанию ( Bcl-2, и Bcl -xL ) и резистентность к химио/радиации ( AURKA , Chk1 и Survivin ) были подавлены. В целом, наше исследование предполагает, что листья O. Santum могут стать потенциальным источником новых противораковых соединений в будущем.

Ключевые слова: Василий, Рак поджелудочной железы, терапия, апоптоз, онкогенность

1. Введение

Рак поджелудочной железы (РПЖ) имеет неблагоприятный прогноз с медианой 5-летней выживаемости около 5% [1]. Во многом это связано с внутренней резистентностью клеток РПЖ к химио- и лучевой терапии [2, 3]. Таким образом, были предприняты согласованные усилия по разработке новых лекарств, которые могут преодолеть эту врожденную устойчивость. Химические вещества растительного происхождения (фитохимические) стали потенциальным источником новых противораковых соединений.Было показано, что несколько натуральных продуктов, включая куркумин [4], физетин [5] и тимохинон [6], повышают чувствительность клеток РПЖ к химиотерапевтическим агентам. Хотя первоначально они рекламировались как химиопрофилактические препараты, они также продемонстрировали значительное проапоптотическое, антипролиферативное и антиметастатическое действие на раковые клетки, что вызвало призыв к их внедрению в качестве терапевтических средств.

Ocimum saintum (широко известный как «святой базилик») — лекарственное растение, произрастающее в полутропических и тропических частях Индии.Он использовался в течение тысяч лет в аюрведической и сиддхской системах медицины для лечения различных заболеваний, включая инфекции, заболевания кожи и печени, а также в качестве противоядия от укусов змей и скорпионов [7]. Его применяют как противовоспалительное, иммуномодулирующее, противоинфекционное, антистрессовое, жаропонижающее, противокашлевое, противодиабетическое [8], кардиопротекторное, нейропротекторное и гепатопротекторное средство [9, 10]. Было показано, что инфузии O. Santum защищают лимфоциты человека от генотоксического стресса, вызванного ацетатом ципротерона [4].Хотя предполагалось, что каждая часть растения имеет терапевтическое применение, листья (и экстракты листьев) были изучены наиболее тщательно. Листья О. санктум являются источником эфирного масла, обладающего многочисленными лечебными свойствами. Ранее было показано, что как спиртовые, так и эфирные масла экстрактов базилика обладают антиоксидантным действием [10–15]. Было показано, что этанольные экстракты способствуют эпителизации ран и противодействуют эффекту подавления заживления дексаметазоном у белых крыс [16].Глазные капли, содержащие экстракта листьев O. Santum , защищали от индуцированного хлоридом железа перекисного окисления липидов и проявляли значительную антибактериальную и противогрибковую активность [13]. Другое исследование показало, что эфирное базиликовое масло, скармливаемое самцам крыс Wistar, значительно снижало уровень липидов в сыворотке крови [14], в то время как добавление свежих листьев базилика (2 г/кг) ежедневно в течение 30 дней значительно снижало уровень глюкозы в крови и уровень пероксидированных липидов [17]. .

Несколько исследований также продемонстрировали потенциал O.санктум в качестве противоопухолевого средства [18]. При сравнении цитотоксической активности эфирных масел 17 тайских лекарственных растений O.santum оказался наиболее эффективным в ингибировании пролиферации клеток плоскоклеточного рака ротовой полости человека (KB) и клеток лейкемии мыши (P388) in vitro []. 19]. Другие исследования показали, что его спиртовые экстракты проявляли цитотоксический эффект в отношении клеток рака легкого A549, расщепляли проапоптотическую молекулу поли-(АДФ-рибоза) полимеразы (PARP), способствовали высвобождению цитохрома С, увеличивали активность каспаз 3 и 9 и соотношение Bax/Bcl-2 [20].Это также снизило скорость пролиферации, о чем свидетельствует уменьшение процента клеток в фазе G2/M. Спиртовые экстракты O. Sanctum также ингибировали инвазию клеток мышиного рака легкого Льюиса (LLC) in vitro , связанную со снижением активности матриксной металлопротеиназы-9 (ММР9) [20]. In vivo значительно уменьшил количество метастатических узелков в легких после инъекции клеток LLC через хвостовую вену [21]. В целом, эти исследования показывают, что экстракт листьев растения может вызывать апоптоз, ингибировать развитие клеточного цикла и предотвращать метастазирование.

В настоящем исследовании мы исследовали, могут ли эфирное масло или экстракты, приготовленные из имеющихся в продаже высушенных листьев O. Sancum , ингибировать пролиферацию, выживание и метастазирование клеток РПЖ. Результаты нашего исследования показывают, что как этанольные экстракты (EEOL), так и эфирное масло листьев O. Sanctum (EOOS) значительно ингибируют агрессивность клеток PC и ингибируют рост ортотопически имплантированных клеток PC. В целом, наше исследование является первым, в котором предполагается потенциальная роль O.святилище в терапии PC.

2. Материалы и методы

2.1 Приготовление этанольных экстрактов

листьев O. Sanctum (EEOL)

Мы приобрели капсулы, содержащие порошкообразные высушенные листья O. Sanctum , у четырех поставщиков в США: New Chapter ( Северная Каролина), (New Chapter Inc., Блумингдейл, Иллинойс, США), Club Natural (CN), (Club Natural Inc., Ирвин, Калифорния, США), Superior Herbs (SH), (Swanson Health Products, Фарго, Северная Дакота, США) ) и Морфема (Morph), (Morpheme Remedies Pvt.Ltd., Панчкула, Харьяна, Индия). Мы также приобрели эфирное масло листьев O. Sanctum (EOOS) у Now Foods (Блумингдейл, Иллинойс, США).

Этанольные экстракты листьев O. Santum (EEOL) готовили путем растворения содержимого одной капсулы (400 мг порошкообразных высушенных листьев на капсулу для NC и SH и 450 мг на капсулу для CN и Morph) в 10 мл фильтрованного 100% этанол. Для обеспечения максимального растворения пробирки встряхивали в течение 10 минут перед фильтрованием через фильтр 0.фильтр 2мкм. Экстракты готовили каждую неделю свежими и хранили вдали от яркого света при 4°С. Для экспериментов in vivo экстракты готовили таким же образом, но с использованием дважды дистиллированной воды в качестве растворителя, чтобы избежать токсичности этанола. Концентрацию экстрактов выражали в мкг сухих листьев на мл раствора.

2.2 Культура клеток и химические вещества

Линии клеток РПЖ человека AsPC-1, MiaPaCa и Capan-1 были приобретены в Американской коллекции типовых культур (ATCC).Клеточная линия CD18/HPAF PC была создана в лаборатории доктора Мецгера в Медицинском центре Университета Дьюка. Линии клеток были проверены и аутентифицированы с помощью анализа коротких тандемных повторов. Клетки РПЖ культивировали в среде Иглса, модифицированной Дульбекко (DMEM, Sigma Aldrich, Сент-Луис, Миссури, США), с добавлением 10% эмбриональной бычьей сыворотки (FBS) и антибиотиков (100 мкг/мл пенициллина и стрептомицина). Клетки выращивали при 37°С с 5% СО 2 во влажной атмосфере.

2.3 Анализ жизнеспособности клеток

Влияние экстракта базилика на жизнеспособность клеток оценивали с помощью анализа МТТ.Вкратце, 3×10 3 клеток высевали в 10% DMEM (n=6 повторов на дозу) в 96-луночный планшет. После инкубации в течение ночи среду заменяли свежей 10% DMEM, содержащей различные разведения либо EEOL, либо базиликового масла. Затем клетки инкубировали в течение 48 часов (для определения IC-50) или до 7 дней (для оценки влияния на кинетику роста). В каждую лунку добавляли МТТ (конечная концентрация на лунку: 1,2 мМ) и планшеты инкубировали в течение 4 часов при 37°С. Сформированные кристаллы формазана растворяли в 100 мкл диметилсульфоксида (ДМСО) и измеряли оптическую плотность каждой лунки с помощью устройства для чтения микропланшетов (Molecular Devices Co., Саннивейл, Калифорния, США) при длине волны 560 нм с фоновой длиной волны 670 нм.

Значения IC-50 определяли путем построения графика log 10 (доза) по оси x и процентного ингибирования пролиферации по оси y. Графики были построены с использованием четырех параметрических моделей логистической регрессии с использованием программного обеспечения FindGraph (версия 2.291, Uniphiz labs, Ванкувер, Британская Колумбия, Канада).

Для оценки влияния EEOL/EOOS на кинетику роста клетки ПК высевали с плотностью 1000 клеток на лунку. После инкубации в течение ночи среду заменяли средой, содержащей фиксированную дозу EEOL, EOOS или носителя.Затем клетки возвращали в инкубатор. Жизнеспособность клеток затем оценивали с помощью анализа МТТ, проводимого ежедневно (начиная с 24 часов после обработки) в течение семи дней подряд. Результаты выражали в процентах жизнеспособности (относительно необработанных клеток). В контрольные лунки с носителем добавляли абсолютный этанол, соответствующий концентрации этанола, присутствующей в EEOL.

2.4 Анализ миграции и инвазии через лунки

После трипсинизации клетки дважды промывали PBS и высевали в бессывороточную среду DMEM, содержащую либо EEOL (80 мкг/мл NC), либо EOOS (0.1% об./об.) в верхней камере фильтра из поликарбоната, не содержащего поливинилпирролидона (PVPF) с размером пор 8 мкм. Для анализа инвазии фильтр покрывали смесью 1:1 желатина и коллагена IV типа, имитирующей базальную мембрану. В нижнюю камеру помещали DMEM, содержащую 50% FBS. Клеткам давали возможность мигрировать в течение 24 часов при 37°С. После удаления немигрирующих клеток из верхней камеры клетки, мигрировавшие через фильтр, фиксировали и окрашивали с помощью набора для окрашивания Diff Quik (Mertz-Dade AG, Dade International, Милан, Италия) и подсчитывали под световым микроскопом ( 100-кратное увеличение в 10 случайных полях).Каждый эксперимент проводили в трехкратной повторности. Результаты выражали как среднее число клеток (±SE), мигрирующих в поле высокой мощности (HPF).

2.5 Анализ заживления ран

Чтобы подтвердить влияние EEOL/EOOS на миграционную способность клеток РПЖ, мы провели анализ заживления ран in vitro . Клетки выращивали до 100% слияния в чашке диаметром 100 мм. С помощью стерильного наконечника пипетки на 1000 мкл на планшете наносили серию линейных ран. Клетки однократно промывали полной средой для удаления мертвых и неприлипших клеток.Затем рану фотографировали на исходном уровне (0h). В планшеты добавляли полную среду (10% DMEM), содержащую EEOL, EOOS или этанол (0,2% по объему), и клетки инкубировали при 37°C. Фотографии раны делались с 24-часовыми интервалами до полного закрытия раны в одной из обработанных пластин. Пройденное расстояние рассчитывали по следующей формуле: расстояние между краями раны в момент времени 1- расстояние между краями раны в момент времени 2 .Для каждой клеточной линии брали в среднем восемь ран, чтобы определить среднюю скорость миграции для данной дозы EEOL/EOOS. Опыты повторяли не менее трех раз.

2.6 Анализ клоногенности, зависящей от привязки

Чтобы изучить влияние EEOL/EOOS на клоногенный потенциал клеток PC, мы провели анализ образования колоний in vitro . 250 клеток высевали в трех повторностях в 12-луночный планшет. После инкубации в течение ночи среду заменяли 10% DMEM, содержащей EEOL (или этанол) или EOOS в различных дозах.Планшеты инкубировали еще 2 недели. После этого образовавшиеся колонии фиксировали в метаноле и окрашивали 0,5% кристаллическим фиолетовым в PBS и подсчитывали с использованием функции подсчета колоний программного обеспечения Quantity One (BioRad, Hercules, CA, USA).

2.7 Анализ клеточного цикла

200 000 клеток высевали в полную среду. После того, как им дали прикрепиться в течение ночи, среду заменяли либо свежей средой (без лекарственного средства), либо средой, содержащей EEOL, EOOS или носитель.После 48 часов инкубации клетки трипсинизировали, промывали, фиксировали в 70% этаноле, окрашивали 500 мкл йодистого пропидия (1 мкг/мл) и анализировали с помощью проточной цитометрии.

2.8 Анализ апоптоза

Апоптоз измеряли с помощью набора для обнаружения апоптоза Annexin V-FITC (Roche Diagnostics, Индианаполис, Индиана). Вкратце, 250000 клеток трижды высевали в 10% DMEM. После инкубации в течение ночи среду заменяли либо 10% DMEM, содержащей EEOL, EOOS, либо носителем (этанолом).Клетки инкубировали еще 48 часов. Апоптоз выявляли путем окрашивания клеток аннексином V и раствором йодида пропидия с последующей проточной цитометрией, как описано ранее [22].

2.9 Вестерн-блоттинг

Клетки обрабатывали для вестерн-блоттинга, как описано ранее [22]. Вкратце, всего 20–40 мкг белка из клеточных экстрактов разделяли электрофорезом на 10% SDS-полиакриламидном геле и переносили на поливинилидендифторидную мембрану (PVDF).Мембрану исследовали антифосфорными или общими FAK, антифосфорными или полными ERK (все получены из Санта-Крус, Калифорния), анти-p65 Nf-κB (Cell Signaling Technology, Дэнверс, Массачусетс) и анти-βактином (1 :10 000; антитела Sigma, Сент-Луис, Миссури. Затем мембрану инкубировали с соответствующим вторичным иммуноглобулином, меченным пероксидазой хрена, и сигнал детектировали с использованием набора реагентов для хемилюминесценции (Amersham Pharmacia, Piscataway, NJ).

2.10 Экстракция РНК и ПЦР в реальном времени

Уровни транскриптов определенных генов измеряли в клетках РПЖ, обработанных EEOL, EOOS и опухолях поджелудочной железы, выделенных у мышей, с использованием набора SYBR ® Premix Ex Taq ™.кДНК синтезировали с использованием 2 мкг тотальной РНК, олиго(dT) 18 праймера и Superscript RT (Invitrogen Corp.). Количественную ПЦР в реальном времени проводили с использованием 1 мкл разведения 1:5 кДНК первой цепи с использованием набора SYBR Premix Ex Taq (Takara Bio, Мэдисон, Висконсин, США) и специфических праймеров () на Roche Light Cycler 480. система (Roche Diagnostics, Мангейм, Германия). Каждый образец кДНК использовали в трех повторностях, а реакцию без кДНК использовали в качестве отрицательного контроля. Уровень экспрессии мРНК каждого гена нормализовали до уровня β-актина .Для клеточных лизатов результаты были графически представлены в виде кратной разницы в экспрессии мРНК в обработанных и контрольных клетках. Данные ПЦР в реальном времени для лизатов опухолей представлены в виде средней относительной экспрессии гена мРНК в каждой экспериментальной группе.

Таблица 1

Грунтовки, используемые для ПЦР в реальном времени в исследовании

1 CEACAM6 128 FP Snail Snail 122 Deversivin Survivin Vimentin Vimentin BAX BAX
символ гена Primer Sequence Номер присоединения Длина продукта (BP)

Aurka FP GCTGGAGAGCTTAAAATTGCAG {«Тип»: «Entrez-Nucleotide», «Attrs»: {«Текст»: «NM_198433.1″ , «term_id»: «38327563», «term_text»: «NM_198433.1»}} NM_198433.1 220
RP TTTTGTAGGTCTCTTGGTATGTG
БАД FP AACATTTGTCCTCACAGCC {«type»:»entrez-нуклеотид»,»attrs»:{«текст»:»NM_004322.3″,»term_id»:»197116381″,»term_text»:»NM_004322.3″}}NM_004322. 3 392 392 392
RP CacaaactCGTCactCATCC
BCL-XL FP Aggatacagctggagtcag {«Тип»: «Entrez-Nucleotide», «Attrs»: {«Текст» :»NM_138578.1 «,» term_id «:» 20336334 «,» term_text «:» NM_138578.1 «}} nm_138578.1 416
RP TCTCCTTGTCTACGCTTTCCC BETA ACTIN FP AGCAAGAGAGGCATCCTC {«type»:»entrez-нуклеотид»,»attrs»:{«текст»:»NM_001101.3″,»term_id»:»168480144″,»term_text»:»NM_001101.3″}}NM_001101 .3 474 474
RP RP GCACAGCTTCCCTTAAT FP Gaaatacagaacccaggggagtgtgtgtgtgctgctgtgtgtgctgtgctgtgtgtgtgctgtgctgtgctgtgtgctgtgctgtgctgtgctgtgtgctgtgctgtgtgtgtgtgctgtgctgctgtgtg/201850185 «NM_002483.4 «,» term_id «:» 209862773 «,» term_text «:» NM_002483.4 «}} NM_002483.4 226
RP CAGTGATGTGTGGATAAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAL CHK1 FP TGAGAATCCATCAGCAAGAATTACC {«type»:»entrez-нуклеотид»,»attrs»:{«текст»:»NM_001274.4″,»term_id»:»166295191″,»term_text»:»NM_001274.4″}}NM_001274. 4 128 128
RP rp atccactgggagactctgacacaca «NM_053056.2» , «term_id»: «77628152», «term_text»: «NM_053056.2»}} NM_053056.2 154
RP ACGTCGGTGGGTGTGCAAGC
циклин ACAGCCAGACATCACTAACAG {«type»:»entrez-нуклеотид»,»attrs»:{«текст»:»NM_001237.3″,»term_id»:»166197663″,»term_text»:»NM_001237.3″}}NM_001237 0,3 141
RP AGCACTGACATGGAAGACAG
Е-кадгерин FP ATGAGTGTCCCCCGGTATCT { «Тип»: «Entrez-нуклеотид», «ATTRS»: { «текст «:»NM_004360.3 «,» term_id «:» 1697 «,» term_text «:» NM_004360.3 «}} nm_004360.3 172
RP TCagggagagctcagactagcagcag
GLI1 FP CTACATCAACTCCGGCCAAT {«type»:»entrez-нуклеотид»,»attrs»:{«текст»:»NM_005269.2″,»term_id»:»224809486″,»term_text»:»NM_005269.2″}}NM_005269. 2 155 155
RP CGGCTGAGAGTATAGGCAGA
1
HIF-1α FP FP CCATTAGAAAGCAGTTCCGCCCCCC {«Тип»: «Entrez-Nucleotide»: «Attrs»: {«Текст» :»NM_181054.2 «,» term_id «:» 194473734 «,» term_text «:» NM_181054.2 «}} nm_181054.2 194
RP TGGGTAGGAGATGGAGATGC FP TTCGGACCCACACATTACCT {«type»:»entrez-нуклеотид»,»attrs»:{«текст»:»NM_003068.4″,»term_id»:»324072669″,»term_text»:»NM_003068.4″}}NM_003068. 4 122 122
RP GCAGTGAGGAAGAAAAAAAG FP GCCCTTTCTTGGGGGCTGCG {«Тип»: «Entrez-Nucleotide»: «Attrs»: {«Текст»: » NM_001168.2″ , «term_id»: «59859877», «term_text»: «NM_001168.2»}} NM_001168.2 156
RP TGTTCCTCTATGGGGTCGTCATCTG
VEGFA FP CCTCCGAAACCATGAACTTT {«type»:»entrez-нуклеотид»,»attrs»:{«text»:»NM_001204385.1″,»term_id»:»324120931″,»term_text»:»NM_001204385.1″}}NM_001204385. 1 412 412
RP RP TTTTTTTGTGTCTCATTCACACTATT FP GCAGCTCAAGGGGCCAAGGCA {«Тип»: «Entrez-Nucleotide»: «Attrs»: {«Текст»: NM_003380.3 «,» term_id «:» 240849334 «,» term_text «:» NM_003380.3 «}} NM_003380.3 164
RP CCTGCAATTTTCCCCGGGGGGCG FP CTGGACCCGGTGCCTCAGGA {«type»:»entrez-нуклеотид»,»attrs»:{«текст»:»NM_138761.3″,»term_id»:»163659848″,»term_text»:»NM_138761.3″}}NM_138761. 3 244
RP TGGTGCACAGGGCCTTGAGC

2.10 Животные и лечение

Протокол исследования противоопухолевого действия AEOL на клетки PC in vivo был одобрен Институциональным комитетом по уходу и использованию животных (IACUC) UNMC. Самок бестимусных мышей в возрасте 4–6 недель анестезировали и 2,5×10 90 101 5 90 102 клеток AsPC-1, суспендированных в 50 мкл стерильного PBS, инъецировали ортотопически в головку поджелудочной железы, как описано нами ранее [22, 23]. Клетки AsPC-1 были выбраны после анализа результатов экспериментов in vitro и с учетом того, что эта клеточная линия содержит четыре наиболее распространенные мутации в PC (т.е. KRAS , TP53 , CDKN2A/p16 и SMAD4/DPC4 ) и вызывают хорошо или низкодифференцированную аденокарциному после трансплантации бестимусным мышам [24, 25]. Через неделю после операции мышей взвешивали и лечили либо AEOL (6 мг/мышь), вводимым два раза в неделю путем внутрибрюшинной инъекции, либо эквивалентной дозой дважды дистиллированной воды (контрольная группа). Для эксперимента использовали AEOL от NC, SH и Morph. Перед каждой инъекцией мышей взвешивали.Снижение веса на ≥10% по сравнению с предыдущим весом считалось показанием к эвтаназии мышей. Мышей кормили вволю и контролировали на предмет какого-либо стресса во время каждого лечения. После эвтаназии опухоли поджелудочной железы каждой мыши вырезали, взвешивали и обрабатывали для выделения РНК.

2.11 Статистический анализ

Данные анализировали с использованием программного обеспечения Medcalc для Windows версии 9•6•4•0 (MedCalc Software, Бельгия). Непрерывные переменные сравнивались с использованием двустороннего t-критерия Стьюдента, предполагающего неравную дисперсию, в то время как категориальные переменные сравнивались с использованием двустороннего дисперсионного анализа (ANOVA).Для экспериментов in vivo использование размера выборки из 5 мышей на группу дало нам мощность 0,96 при обнаружении разницы не менее 50% между животными, получавшими неочищенный экстракт, и животными, получавшими контрольный носитель (вода). (при условии, что дисперсия массы опухоли составляет 25% для данного лечения и ошибка типа I (α) равна 0,05). Значение p ≤ 0,05 считалось значимым.

3. Результаты

3.1 Определение оптимальной дозы спиртовых экстрактов

O. Sancum листья (EEOL) и эфирное масло O. святилище листьев (EOOS) для ингибирования пролиферации клеток рака поджелудочной железы in vitro

Сначала мы попытались определить оптимальную дозу EEOLs и EOOS для in vitro лечения клеток РПЖ из различных источников. Для этого клетки PC AsPC-1, MiaPaCa, CD18/HPAF и Capan-1 обрабатывали EEOL (2-кратные серийные разведения от 2 мг/мл до 1 мкг/мл) или EOOS (2-кратные серийные разведения от 2% до 0,001% об./об.) в течение 48 часов. Жизнеспособность клеток определяли с помощью анализа МТТ, а IC-50 рассчитывали, как описано в разделе «Материалы и методы».Как показано на рисунке, IC-50 EEOL из капсул листьев базилика, приобретенных в New Chapter (NC) в США, составляла 46 мкг/мл в клетках AsPC-1. В клетках MiaPaCa EEOL из капсул Morpheme ингибировал пролиферацию с большей скоростью (IC-50 69 мкг/мл), чем экстракты других производителей. EEOL, приготовленные из капсул SH (диапазон IC-50 113–202,5 ​​мкг/мл) и CN (IC-50 230–2086 мкг/мл), были менее цитотоксичны для клеток ПК. IC-50 для EOOS варьировался от 0,17% до 0,20% по объему.

Этанольный экстракт О.санктум (EEOL) и эфирное масло листьев О. санктум (EOOS) ингибируют пролиферацию клеток рака поджелудочной железы

клетки AsPC-1 и MiaPaCa высевали в трех повторностях в 10% DMEM. После инкубации в течение ночи клетки обрабатывали либо EOOS (обозначаемым как масло базилика), New Chapter (NC), Club Natural (CN), Superior Herbs (SH) и Morpheme (Morph) в указанных концентрациях в 10% DMEM. (A) IC-50 EEOL и EOOS в клетках PC. После 48 часов инкубации с EOOL и EOOS цитотоксичность и значения IC-50 оценивали с помощью анализа МТТ (как описано в разделе «Материалы и методы»).(B) Анализ клоногенности In vitro . После 14 дней инкубации с экстрактами базилика образовавшиеся колонии промывали PBS, фиксировали в метаноле и окрашивали 0,1% кристаллическим фиолетовым в PBS. Количество колоний (на лунку) подсчитывали с помощью автоматического инструмента подсчета колоний программного обеспечения Quantity One Imaging. На графиках представлено среднее количество колоний (±SE) для данной обработки. Эксперимент повторяли дважды (*р-значение<0,05). (C) Ингибирование роста клеток PC in vitro .Жизнеспособность клеток оценивали каждые 24 часа, начиная с 24 часов после добавления экстракта базилика, в течение 7 дней с помощью МТТ (как описано в разделе «Материалы и методы»). Результаты выражены как среднее поглощение (А 560 нм — А 670 нм ) в зависимости от количества дней после добавления экстракта базилика (или масла). Были использованы две дозы EEOL (от NC) — 0,8 мкг/мл ( низкая доза NC ) и 80 мкг/мл ( высокая доза NC ). Базиликовое масло (EOOS) также добавляли в двух дозах — 0,001% об./об. ( низкая доза базилика ) и 0.1% об./об. ( высокая доза базилика ). [а-р-значение <0,05 (необработанное по сравнению с низкой дозой базиликового масла), bp-значение <0,05 (необработанное по сравнению с низкой дозой NC), cp-значение <0,05 (необработанное по сравнению с высокой дозой базиликового масла), dp-значение <0,05 (необработанный против высокодозированного NC)]

Мы также протестировали произвольно выбранный диапазон концентраций от 800 мкг/мл до 0,8 мкг/мл (для EEOL) и от 1% до 0,001% об./об. (для EOOS), чтобы определить наиболее эффективная концентрация для длительного ингибирования пролиферации клеток РПЖ. EEOL в концентрации 800 мкг/мл (от всех четырех поставщиков) и EOOS в концентрации 1% по объему полностью ингибировали образование колоний (100% ингибирование) во всех клеточных линиях после инкубации в течение 14 дней после однократного введения. лечения (данные не представлены).Доза 80 мкг/мл (EEOL) и 0,1% об./об. EOOS вызывала значительное снижение количества колоний, в то время как при дозе ≤8 мкг/мл (EEOL) или ≤0,01% (EOOS) эффекта не наблюдалось. ) ().

Из предыдущего эксперимента было определено, что доза 80 мкг/мл EEOL и 0,1% по объему EOOS являются самыми низкими эффективными дозами, которые ингибируют клоногенность клеток РПЖ. Чтобы дополнительно подтвердить эффективность этих двух доз в ингибировании кинетики роста клеток РПЖ, мы исследовали ингибирующий эффект 80 мкг/мл EEOL или 0.1% об./об. EOOS (т.е. высокая концентрация) по сравнению с 0,8 мкг/мл EEOL или 0,001% об./об. EOOS (т.е. низкая концентрация) на рост клеток РПЖ. Поскольку EEOL NC показал самое низкое значение IC-50 () и сильный антипролиферативный эффект (по анализу клоногенности), мы выбрали этот экстракт для анализа кинетики роста. Как показано на рисунке, самая высокая доза как EEOL, так и EOOS значительно ингибировала пролиферацию клеток PC с течением времени. В то время как клетки AsPC-1 и MiaPaCa были чувствительны к самой высокой дозе EOOS, только пролиферация первых ингибировалась самой высокой дозой EEOL.

На основании результатов анализа клоногенности и влияния на кинетику роста мы выбрали дозу 80 мкг/мл и 0,1% об./об. в качестве оптимальной концентрации EEOL и EOOS соответственно для дальнейших in vitro функциональных исследований. Результаты in vitro в этой рукописи сосредоточены на клетках AsPC-1 и MiaPaCa PC. Тем не менее, аналогичные результаты всех экспериментов in vitro были также получены на клеточных линиях CD18/HPAF и Capan-1 PC (данные не представлены).

3.2 EEOL и EOOS подавляют способность к миграции и инвазии клеток рака поджелудочной железы

Затем мы попытались исследовать влияние как экстракта базилика, так и эфирного масла на поведение клеток РПЖ с помощью серии из in vitro функциональных анализов. Чтобы проверить, может ли EEOL / EOOS ингибировать подвижность клеток PC in vitro , мы использовали анализы заживления ран и миграции через лунки. Как EEOL (NC), так и EOOS значительно ингибировали способность клеток PC мигрировать и закрывать царапины (1), а также ингибировали их миграцию в направлении хемотаксического стимула (3).Как EEOL, так и EOOS также ингибировали инвазию клеток PC через фильтр с желатиново-коллагеновым покрытием в направлении хемотаксического стимула (11). EOOS (0,1% об./об.) был более эффективен, чем EEOL (80 мкг/мл) в ингибировании как миграции, так и инвазии клеток РПЖ.

EEOL (NC) и EOOS ингибируют миграцию и инвазию клеток рака поджелудочной железы

(A) Анализ заживления ран. Клетки ПК высевали в чашку диаметром 10 см в полной среде (10% DMEM) и позволяли расти до тех пор, пока они не образовывали конфлюэнтный монослой.Искусственную рану индуцировали в центре монослоя и анализировали способность клеток закрывать рану после добавления EEOL NC (конечная концентрация 80 мкг/мл) или базиликового масла (конечная концентрация 0,1% об./об.). Изображения были получены сразу (t=0 часов) и после инкубации в течение 24 часов и 48 часов. Результаты выражены как исходная ширина царапины в мкм и пройденное расстояние (рассчитанное как разница между шириной царапины в момент времени t=24/48 часов и шириной в момент t=0).Высота графика представляет собой среднее значение шести различных царапин (±SE). (Б) In vitro Миграция клеток РПЖ в направлении хемотаксического стимула. Клетки PC высевали в DMEM без сыворотки на верхнюю часть стерильной вставки Transwell размером 6 см 2 с диаметром пор 8 мкм (n = 3 повторения). Нижняя лунка трансвелла содержала DMEM с добавлением 50% FBS. Клетки инкубировали в течение 24 часов, после чего клетки, мигрировавшие через лунку, фиксировали и окрашивали гематоксилином и эозином.Клетки фотографировали при большом увеличении (100×) и подсчитывали количество клеток по меньшей мере в 15 независимых полях высокой мощности (HPF). Данные представлены как среднее число клеток/HPF (±SE). (C) Способность клеток РПЖ проникать через базальную мембрану в направлении хемотаксического стимула in vitro . Клетки PC высевали в бессывороточной среде DMEM на верхнюю часть стерильной вставки Transwell с размером пор 8 мкм 6 см 2 , покрытой объемным соотношением 1:4 коллагена крысиного хвоста и 1% желатина, имитирующего базальную мембрану (n = 3 повторения).Нижняя часть трансвелла содержала DMEM с добавлением 50% FBS (хемоаттрактант). Клеткам давали проникнуть через лунки с покрытием в течение ночи. Клетки, проникшие через трансвелл, сначала фиксировали (метанолом), а затем окрашивали гематоксилином и эозином. Вторгшиеся клетки на нижней поверхности вставки фотографировали при большом увеличении (100×) и подсчитывали количество клеток по крайней мере в 15 независимых полях высокой мощности (HPF). Данные представлены в виде среднего числа вторгшихся клеток/HPF (±SE).Репрезентативные изображения из трех анализов (40× для заживления ран и 100× для анализов миграции и инвазии) и различных групп лечения (этанол (контроль), EEOL NC при 0,08 мкг/мл и базиликовое масло при 0,1% об./об.) показано.

3.3 EEOL индуцируют апоптоз клеток рака поджелудочной железы

Было оценено влияние EOOS и EEOL на прогрессирование клеточного цикла РПЖ (). В целом влияние экстрактов базилика на прогрессирование клеточного цикла не было окончательным. В клетках AsPC-1 EOOS снижал процент клеток в фазе G2/M, тогда как в фазе S наблюдалось увеличение, а в фазе G1 не отмечалось значительного влияния.С другой стороны, в клетках MiaPaCa экстракты как EOOS, так и EEOL, по-видимому, способствуют продвижению по клеточному циклу, о чем свидетельствует снижение процента клеток, обработанных EOOS и EEOL, в фазе G1 и увеличение процента в фазе S. и фазы G2/M. Тем не менее, процент апоптотических и некротических клеток после обработки экстрактом базилика был проанализирован после окрашивания аннексином V-йодидом пропидия, и результаты показали, что процент апоптотических клеток был значительно выше при обработке EEOL, что свидетельствует о цитотоксическом механизме действия экстракта на клетки ПК ( ).

EEOL и EOOS индуцируют апоптоз клеток рака поджелудочной железы

(A) Анализ клеточного цикла. 2×10 90 101 4 90 102 клеток высевали в трех повторностях в полную среду в 6-луночный планшет. После инкубации клеток PC с этанолом (0,1% об./об.), EEOL NC (80 мкг/мл) или EOOS (0,1% об./об.) в течение 48 часов несинхронизированные клетки (включая клетки в супернатанте среды) собирали, окрашивали с йодидом пропидия (PI) и анализировали с помощью проточной цитометрии. Графики представляют средний процент клеток (±SE) в каждой фазе клеточного цикла.(*значение p<0,05 по сравнению с контрольными клетками) (B) Количественное определение апоптотических и некротических клеток PC. 2,5×10 90 101 5 90 102 клеток высевали в трех повторностях в 10% DMEM. После инкубации в течение ночи среду заменяли либо 10% DMEM, содержащей EEOL (80 мкг/мл NC), EOOS (0,1% об./об.), либо 0,2% об./об. этанола (контроль носителя). Клетки инкубировали с экстрактами в течение 48 часов. Апоптоз выявляли путем окрашивания клеток аннексином V и раствором PI с последующей проточной цитометрией.Показаны репрезентативные результаты диаграмм плотности проточной цитометрии: живые клетки (аннексин V-/PI-), ранние апоптотические клетки (аннексин V+/PI-), поздние апоптотические/некротические клетки (аннексин V+/PI+). Данные представлены в виде среднего числа клеток (±SE). Все эксперименты проводились в трехкратной повторности и повторялись не менее двух раз. (** p-value≤0,001 по сравнению с контрольными клетками)

3,4 EEOL/EOOS снижает экспрессию белков, которые способствуют инвазии и метастазированию рака поджелудочной железы

Поскольку мы наблюдали значительное ингибирование подвижности и инвазии клеток PC с помощью EEOL и EOOS, мы также стремились исследовать, были ли изменения в молекулярных путях, опосредующих эти функции.Для этого клетки AsPC-1 обрабатывали либо EEOL, либо EOOS в течение 48 часов с последующим вестерн-блоттингом и ОТ-ПЦР в реальном времени для изучения изменения экспрессии ключевых белков и генов. Как EEOL, так и EOOS значительно снижали активацию ключевых медиаторов выживания, пролиферации, метастазирования, инвазии и химиорезистентности клеток РПЖ: внеклеточной сигнальной регулируемой киназы (ERK-1/2) и киназы фокальной адгезии (FAK) (). Известно, что активация NF-kB, особенно субъединицы p65, является ключевым активатором путей, которые способствуют пролиферации, инвазии и метастазированию [26].Как EEOL, так и EOOS подавляли экспрессию белка субъединицы p65 NF-kB в клетках РПЖ, предполагая, что ингибирование NF-kB является одним из возможных механизмов, с помощью которых базиликовое масло или экстракт листьев ингибируют агрессивное поведение клеток РПЖ ().

Лечение EEOL и EOOS снижает экспрессию генов и белков, связанных с метастазированием и инвазией рака поджелудочной железы

Клетки AsPC-1 обрабатывали либо EOOS (0,1% об./об.), либо EEOL NC (80 мкг/мл) в течение 48 часы.Общий белок и РНК экстрагировали, а экспрессию ключевых метастазов и белков/генов, связанных с инвазией, анализировали с помощью вестерн-блоттинга (A) и RT-PCR в реальном времени (B) . Данные представлены в виде кратности изменения уровня мРНК (±SE) соответствующего гена в каждой группе лечения. (*р-значение ≤0,05, **р-значение ≤0,005, ***р-значение ≤0,0001 по сравнению с контрольными клетками) β-актин использовали как в качестве контроля загрузки белка, так и в качестве гена контроля «домашнего хозяйства» для каждого эксперимента. Детали экспериментальных процедур показаны в материалах и методах.

Суммарная РНК, выделенная из клеток AsPC-1, подвергалась обратной транскрипции и экспрессии генов, связанных с апоптозом ( BAD , Bcl-xL , BAK ), метастазированием и инвазией ( E-кадгерин , CEACAM6 Виментин ), устойчивость к химиотерапии и лучевой терапии ( AURKA , Chk1, Survivin ) и клеточный цикл ( Cyclin D1 , Cyclin A ) исследовали с помощью RT-PCR в реальном времени (). В соответствии с результатами апоптоза in vitro , клетки AsPC-1, обработанные как EEOL, так и EOOS, показали сильное усиление проапоптотического белка BAD .Тем не менее, не было изменений в экспрессии генов Bcl-xL и BAK . Наблюдалось значительное снижение экспрессии AURKA , Chk1 и Survivin в клетках PC, обработанных обоими экстрактами, что предполагает потенциальное использование базилика в комбинированной терапии против рака. Неожиданно наблюдалось повышение экспрессии CEACAM6 , виментина и циклина D1 в клетках PC, обработанных EOOS, по сравнению с необработанными клетками.

3.5 Водные экстракты

листьев O.sanctum (AEOL) ингибируют онкогенность ортотопически имплантированных клеток AsPC-1 бестимусным мышам экстракты листьев O. Sanctum (EOL) могут ингибировать онкогенность клеток PC in vivo . Из наших исследований in vitro мы заметили, что клетки AsPC-1 были наиболее чувствительны как к EEOL, так и к EOOS.Следовательно, эти клетки были выбраны для исследования влияния экстрактов листьев базилика на рост клеток PC in vivo . Клетки AsPC-1 инъецировали ортотопически в поджелудочную железу самок бестимусных мышей. Начиная с семи дней после инъекции, мышей лечили AEOL NC, SH или Morph (4). Из обзора литературы мы отметили, что острая LD50 AEOL, как сообщается, составляет 6 г/кг массы тела [27]. При среднем весе 22,4 г на мышь в начале исследования каждое животное получило дозу 267.5 мг/кг (т.е. 6 мг/животное) массы тела, что было значительно ниже (примерно в 23 раза), чем заявленная LD 50 . Использовали AEOL (вместо EEOL), поскольку объем этанольного экстракта, необходимый для достижения этой дозы, вызывал значительную интоксикацию (от алкоголя) у мышей в пилотном эксперименте (данные не показаны). Через 3 недели терапии мышей подвергали эвтаназии, резецировали и взвешивали первичные опухоли. По сравнению с контрольными животными (масса опухоли 609 ± 55 мг) у животных, получавших AEOL, опухоли были значительно меньше (285.9±32 мг, 284±64 мг и 398,5±60 мг у животных, получавших AOEL NC, SH и Morph соответственно) (). Однако существенной разницы в частоте появления видимых метастазов у ​​животных, получавших экстракт базилика, не наблюдалось. Возможной причиной отсутствия влияния AEOL на количество видимых метастазов может быть разница в их активности по сравнению с EEOL. Чтобы исследовать эту возможность, мы сравнили IC-50 AEOL с EEOL NC в клетках AsPC-1 с использованием анализа MTT. Эксперимент показал, что при каждой дозе этанольный экстракт почти в 19 раз эффективнее ингибировал пролиферацию AsPC-1, чем водный экстракт (данные не представлены).

Влияние водного экстракта листьев O. Santum (AEOL) на онкогенность клеток рака поджелудочной железы AsPC-1 in vivo

Для изучения влияния AEOL на онкогенный потенциал клеток AsPC-1 in vivo , мы вводили 2,5×10 5 клеток, суспендированных в 50 мкл PBS, в головку поджелудочной железы бестимусных самок мышей. Через семь дней после имплантации мышам вводили AEOL (NC, SH или Morph) внутрибрюшинно в фиксированной дозе 6 мг/мышь.Мышей лечили два раза в неделю в течение 3 недель. ( A ) Схематическое изображение экспериментальной стратегии для оценки влияния AEOL на онкогенность клеток AsPC-1 PC. ( B ) Сравнение массы опухоли (средний вес ± стандартная ошибка) между мышами, не получавшими лечения, и мышами, получавшими AEOL. (*р-значение=0,04, **р-значение=0,004, ***р-значение=0,0004) ( C ) Табличное представление результатов влияния AEOL на частоту появления видимых метастазов AsPC-1 клетки вводят ортотопически в головку поджелудочной железы.Статистические данные рассчитывались по сравнению с контрольной группой.

Аналогично исследованиям in vitro , общая РНК, выделенная из ксенотрансплантатов опухоли, подвергалась обратной транскрипции и экспрессии генов, связанных с апоптозом ( BAD , Bcl-xL , Bcl2 ), клеточным циклом ( Cyclin D1 , Cyclin A ), метастазирование и инвазия ( E-кадгерин , CEACAM6, виментин ), десмоплазия ( Gli1 , Snail ), ангиогенез ( VEGFA) и радиационную стойкость ( AURKA , Chk1 и Survivin ) исследовали с помощью RT-PCR в реальном времени.В подтверждение результатов in vitro у животных, получавших AEOL NC, наблюдалось сильное усиление BAD с понижением Bcl-2 и Bcl-xL , что свидетельствует об увеличении скорости апоптоза (1). В отличие от исследований in vitro также наблюдалось значительное увеличение (почти в 30 раз) экспрессии мРНК E-кадгерина у животных, получавших AEOL (NC>SH>Morph). У животных, получавших NC, также наблюдалось значительное снижение экспрессии CEACAM6 , гена, который, как известно, способствует инвазивности в клетках PC [28]. GLI1 , фактор транскрипции, играющий важную роль в десмопластической реакции при РПЖ, подавлялся почти в 4 раза у животных, получавших AEOL NC. Экспрессия Survivin была значительно снижена у животных, получавших NC и SH, но не Morph. Однако мы наблюдали активацию AURKA и Chk1. HIF-1α , основная мишень анти-PC терапии, была значительно усилена у животных, получавших NC, но значительно снизилась у мышей, обработанных Morph и SH.В целом не было значительного изменения экспрессии Cyclin A , Snail , VEGFA , Vimentin в опухолях, обработанных AEOL, по сравнению с опухолями контрольных животных.

Анализ опухолей поджелудочной железы AsPC-1, выделенных у мышей, обработанных водным экстрактом листьев O. Sanctum (AEOL) гены, связанные с инвазией, анализировали с помощью ОТ-ПЦР в реальном времени.Данные представлены в виде относительной экспрессии мРНК (±SE) в каждой группе лечения. (*значение p<0,05, **значение p<0,005) β актин использовали в качестве гена контроля домашнего хозяйства для каждого эксперимента. Детали экспериментальных процедур показаны в материалах и методах.

4. Дискуссия

О. святая Линн. , также известный как O. tenifluorum или священный базилик, трава, принадлежащая к семейству Lamiaceae, , является хорошо известным лекарственным растением, используемым в течение нескольких тысяч лет в традиционной индийской системе медицины.В то время как большинство исследований были сосредоточены на терапевтическом действии экстрактов листьев O. Santum на доброкачественные заболевания, исследования его противоракового действия редки.

Насколько нам известно, нет опубликованных исследований влияния экстрактов базилика на клетки РПЖ. Мы наблюдали, что как EOOS, так и EEOL значительно ингибировали подвижность и инвазию клеток PC in vitro . Это было связано со значительным подавлением активированного FAK, ключевого медиатора обоих этих процессов в клетках РПЖ. In vivo , в то время как AEOL значительно уменьшал размер опухоли, мы не наблюдали существенной разницы в частоте макроскопических метастазов между животными, получавшими AEOL или носитель (вода). Однако наблюдалась сильная активация E-кадгерина в опухолях мышей, получавших AEOL (12). Одной из возможностей отсутствия наблюдаемых эффектов на метастазирование in vivo является то, что клетки ПК образуют метастазы очень рано, когда опухоль еще мала. Поскольку мышей лечили AEOL через семь дней после ортотопической имплантации, мы предполагаем, что микрометастазы уже были установлены к моменту начала терапии.Сравнение значений IC-50 между AEOL и EEOL показало, что первый почти в 20-40 раз менее эффективен в ингибировании пролиферации PC in vitro . Это говорит о том, что более высокая доза AEOL в нашем эксперименте in vivo с могла ингибировать пролиферацию метастатических отложений. Наши будущие исследования будут направлены на определение влияния отдельных соединений, присутствующих в EOOS, на ингибирование агрессивного поведения клеток PC in vivo .

Кроме того, мы наблюдали, что in vitro инкубация клеток AsPC-1 с EOOL и EOOS и in vivo обработка ортотопически имплантированных клеток AsPC-1 с AEOL снижала экспрессию Survivin , гена, который ранее показано, что он является ключевым медиатором химио- и радиорезистентности при РПЖ и других солидных опухолях [29–32].Таким образом, его подавление в клетках РПЖ предполагает возможность того, что соединения, присутствующие в листьях O. Sanctum , могут потенциально повышать чувствительность клеток РПЖ к химиотерапии и облучению. В настоящее время мы оцениваем влияние EEOL (NC) и EOOS как на сенсибилизацию (путем предварительной обработки), так и на эффективность (в сочетании с) клеток PC к обычной химиотерапии. Мы также оцениваем роль основных соединений, обнаруженных в базилике [11, 33], в терапии ПК. Анализ эфирного масла из свежих листьев О.святилище идентифицировал почти 16 различных компонентов [34]. Из них наиболее распространенным является метилэвгенол, а также эвгенол, линалоол, апигенин, ориентин и виценин.

Ограничением нашего исследования является использование сушеных и свежих листьев базилика для приготовления экстрактов. Хотя это могло привести к меньшей величине эффектов в клетках, обработанных EEOL/AEOL (по сравнению с клетками, обработанными EOOS), это дало нам ценную информацию о потенциальных клинических преимуществах коммерческих добавок базилика.Свежие листья базилика трудно достать и хранить в количествах, достаточно больших для долгосрочных исследований, и они могут отличаться от партии к партии. С другой стороны, мы получили высушенные листья от четырех независимых поставщиков и использовали одну и ту же партию для всего эксперимента. Учитывая отсутствие надежных научных данных в поддержку использования большинства пищевых добавок, наше исследование, благодаря своей беспристрастной и широкой экспериментальной стратегии, предоставляет первые доказательства потенциальной полезности экстракта базилика для лечения одного из самых смертельных злокачественных новообразований. известны человеку.

В заключение мы сообщаем, что этанольный экстракт и эфирное масло О. санктум ингибируют пролиферацию, подвижность и инвазивную способность клеток РПЖ. Внутрибрюшинно введенные водные экстракты значительно снижали онкогенность ортотопически имплантированных клеток AsPC-1. Это было связано со значительным увеличением экспрессии проапоптотических генов с сопутствующим снижением уровня генов, ингибирующих апоптоз или способствующих пролиферации или метастазированию клеток РПЖ.В совокупности эти результаты позволяют предположить, что экстракт или эфирное масло листьев базилика и содержащиеся в них компоненты могут быть потенциально полезны в качестве новых средств для лечения и/или профилактики РПЖ у человека. Эти результаты лягут в основу будущих исследований по изучению влияния отдельных компонентов листьев O.sancum на лечение РПЖ.

Базилик священный: священная трава, помогающая бороться с раком

Базилик – это ароматная листовая трава, которая широко используется во многих кухнях мира.Член семейства мятных, этот кулинарный ингредиент и его многочисленные разновидности обладают значительными лечебными свойствами.

Базилик душистый (Ocimum basilicum), наиболее широко используемый в западной кухне. Эта ароматная итальянская трава, также известная как генуэзский базилик, обладает пряным ароматом и часто используется в рецептах соуса песто и блюдах на основе томатов.

Еще один тип базилика, с которым вы, вероятно, знакомы, — тайский базилик (Ocimum basilicum var. thyrsiflora). Эта азиатская трава имеет приятный аромат, похожий на сладкий базилик, но ее вкус напоминает другие травы, в частности гвоздику, анис и лакрицу.Тайский базилик обычно выращивается в домашних садах и является основным продуктом азиатских рецептов.

Но есть еще один сорт базилика, также произрастающий в Юго-Восточной Азии, который заслуживает признания. Базилик священный, или тулси (Ocimum Santum), более известен своим лечебным применением , чем кулинарным применением. Популярное аюрведическое лекарство, базилик священный известен своей способностью справляться с физическим, химическим, метаболическим и психологическим стрессом благодаря своим уникальным свойствам.

В настоящее время исследователи начинают открывать многие полезные свойства священного базилика для здоровья.В недавнем исследовании индийский исследователь изучил действие экстрактов священного базилика и обнаружил, что они могут снижать выживаемость клеток рака легких. Его выводы подтверждают, что священный базилик является не только мощным адаптогеном, но и эффективным природным лекарством, которое можно использовать для лечения рака.

Базилик святой, противораковая трава

По словам автора исследования, соединения растительного происхождения с лечебными свойствами начинают занимать свою нишу в современной медицине. В последнее время они стали важным источником новых фармацевтических агентов , которые потенциально могут заменить обычно используемые синтетические препараты.

Автор отмечает, что за последние 30 лет до 50 процентов недавно одобренных лекарств были прямо или косвенно получены из натуральных продуктов. Только в области рака 85 из 175 противораковых средств, признанных в настоящее время Управлением по санитарному надзору за качеством пищевых продуктов и медикаментов (FDA), получены из лекарственных растений.

Базилик святой — один из примеров лекарственного растения, богатого многообещающими фармацевтическими агентами. Недавно исследователи обнаружили, что это аюрведическое растение можно использовать для лечения диабета, проблем с сердцем, микробных инфекций и даже некоторых видов рака.Однако не так много исследований изучали противораковые свойства священного базилика.

Для своего исследования Венкатешварлу Ядавалли приготовил три разных экстракта базилика священного с использованием трех разных растворителей, а именно воды, этанола и ацетона. Используя два химических теста, часто используемых для измерения жизнеспособности клеток после лечения, он оценил противораковое действие экстрактов священного базилика на культивируемые клетки рака легких человека.

Ядавалли обнаружил, что из трех экстрактов базилика священного только ацетоновый и этанольный экстракты проявляют противораковую активность.Лечение двумя экстрактами значительно уменьшило количество жизнеспособных клеток рака легких в культуре. Экстракт ацетона показал более высокую токсичность, чем экстракт этанола, снижая жизнеспособность клеток почти на 80 процентов при низкой концентрации 50 микрограммов на миллилитр.

Основываясь на этих выводах, Ядавалли пришел к выводу, что базилик священный является мощным противораковым средством, которое необходимо дополнительно изучить для будущего использования в клинической практике.

Пищевое и другое лекарственное использование священного базилика

Базилик священный получил прозвище «королева трав» не только за свои целебные свойства, но и за впечатляющий питательный профиль.Также по этим причинам священный базилик в настоящее время набирает обороты в качестве кулинарного ингредиента, а также травяной добавки, несмотря на его пряный и горький вкус.

Базилик священный богат важными питательными веществами, такими как витамины А и С, кальций, железо и цинк. Это также отличный источник хлорофилла, растительного пигмента, обладающего ранозаживляющими, кроветворными, дезодорирующими, антивозрастными и противораковыми свойствами. Помимо добавления его в пищу, вы также можете использовать листья и цветы священного базилика для приготовления успокаивающего травяного чая.

В аюрведической медицине священный базилик считается тонизирующим средством для ума, тела и духа. Как высокоэффективный адаптоген, эта трава может улучшить вашу способность справляться с физическими, химическими и эмоциональными стрессорами. Различные части священного базилика также можно использовать для лечения различных заболеваний.

Прочитайте полную статью здесь: https://www.food.news/2020-10-15-holy-basil-sacred-herb-helps-fight-cancer.html

Исследование показывает, что растение «святой базилик» подавляет рост рака молочной железы — Новости Школы медицины

В сфере биотерапии и терапии натуральными растениями базилик священный может стать следующим большим прорывом в бурлящем движении по борьбе с раком.

Группа ученых Медицинского факультета Государственного университета Уэйна и исследователей Института рака Барбары Энн Карманос в Детройте продемонстрировала в экспериментальной системе опухолей, что ocimum gratissimum, также известный как африканский базилик, подавляет рост клеток карциномы молочной железы человека.

Открытие может привести к клиническим испытаниям с использованием растения в концентрированной форме для лечения рака молочной железы и, возможно, других видов рака.

Даже приготовление пищи с растением или употребление его в сыром виде может быть полезным для здоровья, сказал главный исследователь Авраам Раз, доктор философии.Д., профессор патологии, радиационной онкологии и онкологии медицинского факультета WSU.

«Мы узнаем после клинических испытаний. Это лекарство можно принимать постоянно, так как оно не имеет побочных эффектов и нетоксично», — сказал доктор Раз.

Исследование «Ocimum gratissimum замедляет рост и прогрессирование рака молочной железы и является естественным ингибитором матриксных металлопротеаз» опубликовано на майской обложке научного журнала Cancer Biology & Therapy.

Растение, диетическое растение из семейства мятных Lameacea, уже используется благодаря своим фармакологическим свойствам, включая противораковую активность.По данным Службы охраны природных ресурсов Министерства сельского хозяйства США, он отсутствует в континентальной части Соединенных Штатов, но растет в диком виде на Гавайях.

Исследование WSU показывает, что трава ингибирует деградирующий фермент, ответственный за облегчение инвазии и метастазирования рака молочной железы в другие части тела, сказал доктор Раз. Фермент, матриксные металлопротеиназы или MMP, представляет собой семейство по меньшей мере 28 структурно и функционально родственных цинк-зависимых эндопротеиназ, которые избирательно разрушают различные компоненты внеклеточного матрикса и приводят к росту раковых клеток, согласно исследовательской статье.Из различных типов ММР, которые, как считается, связаны с раком, группа WSU сосредоточила внимание на ММР-2 и ММР-9, поскольку они избыточно экспрессируются в различных злокачественных опухолях, а их экспрессия и активность часто связаны с агрессивными опухолями и плохой экспрессией. прогноз для больных. Повышенные уровни обоих обнаруживаются при раке молочной железы, головного мозга, яичников, поджелудочной железы, колоректального рака, мочевого пузыря, предстательной железы, легких и меланомы. В исследовании сообщается, что ocimum gratissimum подавляет рост рака, отчасти из-за его свойства в качестве естественного, нетоксичного ингибитора MMP-2 и MMP-9.

Исследование находится на переднем крае растительной терапии и биотерапевтической революции, сказал доктор Раз.

«Многие традиционные или народные средства имеют под собой реальную основу — то есть они работают — и являются основой современной медицины», — добавил он.

Помимо доктора Раза, в исследовательскую группу входили исследователи из отделений патологии и отделения онкологии Медицинской школы WSU; Факультет биологической и химической инженерии Инженерного колледжа WSU; Химический факультет Колледжа свободных искусств и наук WSU, а также исследователь из Педагогического университета Чунцина в Китае.

Исследование финансировалось за счет гранта Национального института рака (R37CA046120-19).

Базилик рекомендуется при раке молочной железы в умеренных количествах

Базилик ( Ocimum basilicum ) является отличным источником витамина К и очень хорошим источником витамина А (благодаря относительно высокому содержанию бета-каротина). Кроме того, базилик является хорошим источником лютеина, розмариновой и урсоловой кислот, а также карнозола, эстрагола, эвгенола и линалоола. Базилик также известен как сладкий базилик .Обладает антиоксидантными, противовоспалительными, противогрибковыми и нейропротекторными свойствами. Базилик может помочь облегчить диабет 2 типа, улучшая чувствительность к инсулину. Было показано, что карнозол, компонент базилика, ингибирует канцерогенез клеток рака простаты человека и гормональных рецепторов (ER+/PR+) рака молочной железы. Хотя данные о том, может ли базилик замедлять образование опухоли печени у экспериментальных мышей, неоднозначны, было показано, что он подавляет метастазирование рака печени. Было обнаружено, что экстракты листьев базилика очень эффективны в ингибировании канцероген-индуцированных опухолей легких у экспериментальных мышей, а также в снижении роста клеток глиобластомы и меланомы, а также клеток рака легких, мочевого пузыря, толстой кишки, яичников и поджелудочной железы.Было показано, что базиликовое масло и его компоненты обладают значительной антипролиферативной активностью в отношении клеток лейкемии и рака почки. Кроме того, было обнаружено, что базиликовое масло значительно ингибирует канцероген-индуцированную плоскоклеточную карциному в желудках экспериментальных мышей. Сообщается, что фиолетовый базилик имеет более высокое общее содержание фенольной кислоты и большую антиоксидантную активность, чем зеленый базилик, исходя из содержания в нем антоцианов (которые придают растению фиолетовый цвет). Это может привести к более высокой противораковой активности, хотя исследований по этой теме мало.

Эффекты, связанные с раком молочной железы потребление Бэзил

Рекомендации по употреблению базилика для больных раком молочной железы и выживших основаны на исследованиях клеток и животных; исследований на людях немного. Тем не менее, базилик следует употреблять в умеренных количествах, а эфирного масла базилика следует избегать, как описано ниже.

Клеточные исследования

В многочисленных исследованиях было показано, что экстракт базилика снижает пролиферацию и вызывает апоптоз (запрограммированную гибель клеток) как в ER+/PR+, так и в тройных негативных (ER-/PR-/HER2-) клетках рака молочной железы.

Микроэлементы базилика

Бета-каротин

Сообщается, что женщины, потребляющие значительное количество каротиноидов, таких как бета-каротин, имеют более низкий риск рака молочной железы и его рецидивов, чем женщины с низким потреблением, хотя не все исследования совпадают. Скандинавское исследование показало, что диетический (но не дополнительный) бета-каротин оказывает защитное действие против лобулярного рака молочной железы у женщин в постменопаузе. Другое европейское исследование показало, что высокое потребление бета-каротина защищает от рака молочной железы у женщин в постменопаузе, получающих заместительную гормональную терапию (ЗГТ).В том же исследовании также было обнаружено, что диетический бета-каротин был связан со сниженным риском рака молочной железы у женщин в постменопаузе с относительно высоким потреблением алкоголя. Бета-каротин усиливал цитотоксичность адриамицина (доксорубицина) как в ER+/PR+, так и в тройных негативных клетках рака молочной железы в одном исследовании. Также было продемонстрировано, что бета-каротин снижает множественную лекарственную устойчивость раковых клеток.

Лютеин

Базилик является хорошим диетическим источником каротиноидов лютеина.В нескольких эпидемиологических исследованиях было обнаружено, что потребление лютеина и уровень циркулирующего лютеина связаны со снижением риска рака молочной железы. Было показано, что лютеин ингибирует прогрессирование как ER + / PR +, так и тройных негативных клеток рака молочной железы в условиях гипоксии, состояния с низким содержанием кислорода, при котором могут развиваться солидные опухоли молочной железы. Также было показано, что лютеин усиливает действие таксановых химиотерапевтических препаратов (таксол и таксотер) на клетки рака молочной железы.

Розмариновая кислота

Хотя орегано и розмарин имеют гораздо более высокое содержание розмариновой кислоты, базилик также является ее источником.Было показано, что розмариновая кислота уменьшает адриамицин-индуцированную кардиомиопатию (поражение сердца) без снижения ее цитотоксического действия на клетки рака молочной железы ER+/PR+.

Урсоловая кислота

Базилик также является хорошим источником урсоловой кислоты, которая, как было показано, устраняет множественную лекарственную устойчивость в клетках рака молочной железы. Одно исследование показало, что урсоловая кислота обращает устойчивость к таксолу при тройном негативном раке молочной железы, устойчивом к таксолу. В другом исследовании сообщалось, что урсоловая кислота ресенсибилизирует клетки рака молочной железы с множественной лекарственной устойчивостью ER+/PR+ к химиотерапии адриамицином.Еще в одном исследовании сообщалось, что урсоловая кислота повышает чувствительность тройных негативных клеток рака молочной железы к адриамицину.

Линалоол

Линалоол, еще один компонент базилика, также увеличивает индуцированную адриамицином цитотоксичность и проапоптотические эффекты в клеточных линиях рака молочной железы, устойчивых к химиотерапии.

Базилик и лечение рака молочной железы

Потребление базилика безопасно и полезно во время химиотерапии.Как отмечалось выше, было показано, что компоненты базилика снижают или обращают вспять множественную лекарственную устойчивость, усиливают цитотоксические эффекты адриамицина, таксола и таксотера как в ER+/PR+, так и в тройных негативных клетках рака молочной железы, а также защищают от вызванного адриамицином повреждения сердца.

Базилик не является эстрогенным и может употребляться во время эндокринного лечения ER+ рака молочной железы. Было показано, что карнозиновая кислота, которая тесно связана с карнозолом, содержащимся в базилике, повышает эффективность тамоксифена в сочетании с ним на мышиной модели рака молочной железы..

Концентрированные источники базилика не рекомендуются

Даже органический базилик, как правило, содержит значительное количество тяжелых металлов, что является одной из причин, по которой его следует употреблять в умеренных количествах.

Когда базилик используется в качестве пищевого ингредиента, он относительно безопасен, но эфирное масло базилика может вызвать рак в больших количествах, поскольку оно содержит эстрагол. Эстрагол представляет собой органическое соединение, которое в больших дозах действует как канцероген для грызунов. Доля эстрагола в эфирном масле базилика может быть значительной.

Соус песто, основным ингредиентом которого обычно является базилик, также может содержать довольно значительный компонент эстрагола. Одно голландское исследование, в котором проводилась оценка риска соусов песто на основе базилика, показало, что примерно 1 раз в день можно безопасно употреблять, исходя из содержания эвгенола и эстрагола. Песто также может содержать умеренно высокие уровни меди, которые могут способствовать ангиогенезу и метастазированию рака молочной железы, особенно у женщин с воспалительным раком молочной железы (IBC) или тройным негативным (ER-/PR-/HER2-) заболеванием.Поэтому мы рекомендуем не потреблять все эфирное масло базилика, кроме небольшого количества, и умеренно употреблять песто из базилика (возможно, два-четыре раза в месяц).

Дополнительные комментарии

Хотя они тесно связаны, базилик — это не то же самое растение, что базилик святой ( Ocimum Santum ), о котором рассказывается на его собственной веб-странице. Свежий или сушеный базилик обычно используется в качестве пищевого ингредиента, тогда как священный базилик обычно употребляется в качестве травы в США. Неорганический базилик необходимо очень тщательно промыть, чтобы максимально удалить остатки пестицидов. Ниже приведены ссылки на недавние исследования, касающиеся этого продукта питания и его компонентов. Для более полного списка исследований, пожалуйста, нажмите на базилик.

Польза базилика для здоровья

Родом из Индии, Азии и Африки, базилик считался священной и благородной травой. На самом деле слово «вазилик» происходит от древнегреческого «басилихон», что означает «царский».

Сегодня Ocimum basilicum (научное название базилика) растет во многих местах по всему миру. Многие люди даже выращивают базилик на своих кухнях или в саду.Эта ароматная трава используется в качестве приправы к различным блюдам и играет ключевую роль в итальянской и тайской кухне.

Существует более 60 разновидностей базилика, из которых базилик душистый является одним из наиболее широко используемых. Трава имеет округлые листья, часто заостренные. Это ярко-зеленое растение, хотя листья некоторых сортов имеют пурпурный или красный оттенок.

Базилик душистый имеет очень сильный запах и узнаваемый вкус. Различные сорта базилика имеют немного разные вкусы.Например, лимонный базилик имеет острый лимонный вкус, а мятный базилик имеет освежающий мятный вкус.

Базилик станет ярким и ароматным дополнением ко многим различным блюдам. Это также может обеспечить некоторые серьезные преимущества для здоровья.

Польза для здоровья

Базилик содержит множество витаминов и минералов, а также антиоксиданты, такие как лютеин, зеаксантин, бета-каротин и бета-криптоксантин. Многие полезные свойства базилика связаны с наличием этих антиоксидантов, а также его эфирных масел.Эти соединения в основном исчезают в процессе сушки, поэтому по возможности выбирайте свежий базилик, чтобы получить максимальную пользу.

Базилик полезен для здоровья:

Снижение окислительного стресса

Базилик полон антиоксидантов. Сладкий базилик содержит соединение под названием эвгенол, а базилик из лайма и лимона содержит лимонен. Эти антиоксиданты, наряду с другими, такими как антоцианы и бета-каротин, помогают бороться со свободными радикалами в организме, которые в противном случае могут привести к повреждению клеток и увеличить риск различных заболеваний, включая рак, болезни сердца, артрит и диабет. .

Рак Профилактика

Священный базилик, также называемый тулси, немного отличается от сладкого базилика, который вы используете в своих любимых рецептах. Тем не менее, его фитохимические вещества могут помочь защитить от различных видов рака, включая рак легких, рак печени, рак ротовой полости и рак кожи.

Уровень сахара в крови Постановление

Добавление базилика в ваш рацион может помочь снизить высокий уровень сахара в крови. В исследовании, проведенном на крысах с диабетом, экстракт базилика помог именно в этом.Базилик также может быть полезен при лечении долгосрочных последствий высокого уровня сахара в крови.

Заболевания сердца Профилактика

Эвгенол в базилике может блокировать кальциевые каналы, что может помочь снизить кровяное давление. Эфирные масла в траве могут помочь снизить уровень холестерина и триглицеридов. Базилик также содержит магний, который может помочь улучшить кровоток, позволяя мышцам и кровеносным сосудам расслабиться.

Улучшение психического здоровья

Туласи — популярное растение в аюрведической медицине.Исследования показали, что он имеет много преимуществ, включая улучшение вашего психического здоровья. В нем есть соединения, которые могут помочь облегчить тревогу и депрессию, повысить вашу способность ясно мыслить и снизить риск возрастной потери памяти.

Уменьшенный I Воспаление

Эфирные масла базилика, включая эвгенол, линалоол и цитронеллол, могут помочь в борьбе с воспалением в организме. Эти противовоспалительные свойства могут помочь снизить риск воспалительных состояний, таких как артрит.болезни сердца и проблемы с кишечником.

Защита от инфекций

Базилик обладает антибактериальными свойствами. Масла в траве могут помочь бороться с бактериями у людей с инфекциями дыхательных путей, мочевыводящих путей, брюшной полости и кожи.

Питательные вещества на порцию

В 2 столовых ложках (5 граммах) свежего нарезанного базилика содержится:

  • Калории: 1 
  • Белки: 0,2 грамма
  • Жиры: 0 граммов 4,19045
  • Углеводы 4,9045
  • 0 Волокно: 0.1 грамм
  • Сахар: 0 грамм

Базилик также содержит много других жизненно важных питательных веществ. Эти питательные вещества включают:

Как приготовить базилик

Вы можете купить свежий базилик в отделе продуктов в большинстве продуктовых магазинов. Если вам нужен сушеный базилик, вы, скорее всего, найдете его с другими сушеными травами и специями. При покупке свежего базилика ищите яркие темно-зеленые листья. Храните его в холодильнике, завернув в слегка влажную ткань или бумажное полотенце.

Есть много способов насладиться базиликом.Если вы хотите включить его в свой рацион, обратите внимание на следующие продукты:

  • Выложите базилик со свежим сыром моцарелла и ломтиками помидоров, добавьте немного свежемолотого черного перца и сбрызните оливковым маслом 
  • Используйте его, чтобы закончить свежий приготовленная пицца или паста (целиком или нарезанная)
  • Добавьте ее в домашние супы или соусы
  • Добавьте ее в домашний песто или хумус
  • Поместите ее с овощами в лазанью
  • Добавьте в салат, например, в жареную кукурузу салат или арбузный салат
  • Украсьте ванильное мороженое парой маленьких листьев базилика

Помните, что когда вы готовите с базиликом, лучше всего добавлять листья ближе к концу процесса.Масла летучи, поэтому добавление травы в конце позволяет сохранить больше восхитительного аромата.

Обзор, применение, побочные эффекты, меры предосторожности, взаимодействие, дозирование и обзоры

Ахтар, М. С. и Мунир, М. Оценка противоязвенного действия на желудок Solanum nigrum, Brassica oleracea и Ocimum basilicum у крыс. J Этнофармакол. 1989; 27(1-2):163-176. Посмотреть реферат.

Альхусаини В., Пайни А., Пунт А., Луиза Дж., Спенкелинк А., Вервоорт Дж., Делатур Т., Scholz, G., Schilter, B., Adams, T., van Bladeren, PJ, and Rietjens, IM Идентификация неваденсина как важного растительного компонента, ингибирующего биоактивацию эстрагола, и основанное на физиологии биокинетическое моделирование его возможного эффекта in vivo . Toxicol Appl.Pharmacol 6-1-2010;245(2):179-190. Посмотреть реферат.

Амрани, С., Харнафи, Х., Гади, Д., Мехфи, Х., Легссьер, А., Азиз, М., Мартин-Низард, Ф., и Боска, Л. Вазорелаксант и средство против агрегации тромбоцитов действие водного экстракта базилика базилика.J Этнофармакол. 17.08.2009;125(1):157-162. Посмотреть реферат.

Balambal, R., Thiruvengadam, K.V., Kameswarant, L., Janaki, V.R., and Tambiah, A.S. Ocimum basilicum при вульгарных угрях — контролируемое сравнение со стандартным режимом. J.Assoc.Physicians India 1985;33(8):507-508. Посмотреть реферат.

Бенедек Д., Парву А.Е., Онига И., Тойу А. и Типерчук Б. Влияние экстракта базилика базилика на экспериментальное острое воспаление. Rev.Med.Chir Soc.Med.Nat.Iasi 2007;111(4):1065-1069.Посмотреть реферат.

Бозин Б., Мимика-Дукич Н., Симин Н. и Анаков Г. Характеристика летучего состава эфирных масел некоторых специй яснотковых и антимикробной и антиоксидантной активности всех масел. J Agric.Food Chem. 3-8-2006;54(5):1822-1828. Посмотреть реферат.

Чанг С.Л., Чо И.К. и Ли К.Х. Инсектицидная активность базиликового масла, транс-анетола, эстрагола и линалоола в отношении взрослых плодовых мушек Ceratitis capitata, Bactrocera dorsalis и Bactrocera cucurbitae.Ж Экон.Энтомол. 2009;102(1):203-209. Посмотреть реферат.

Чанг, Л. К., Нг, Л. Т., Ченг, П. В., Чанг, В. и Лин, К. С. Противовирусная активность экстрактов и отдельных чистых компонентов базилика базилика. Clin Exp.Pharmacol.Physiol 2005;32(10):811-816. Посмотреть реферат.

Дейли, Т., Дживан, М.А., О’Брайен, Н.М., и Ахерн, С.А. Содержание каротиноидов в обычно потребляемых травах и оценка их биодоступности с использованием модели пищеварения in vitro. Растительные продукты Hum.Nutr. 2010;65(2):164-169.Посмотреть реферат.

Данези Ф., Элементи С., Нери Р., Маранези М., Д’Антуоно Л.Ф. и Бордони А. Влияние сорта на защиту кардиомиоцитов от окислительного стресса эфирными маслами и водными экстрактами базилика (Ocimum basilicum L.). J Agric.Food Chem. 11-12-2008;56(21):9911-9917. Посмотреть реферат.

Дасгупта Т., Рао А. Р. и Ядава П. К. Химимодулирующая эффективность листьев базилика (Ocimum basilicum) в отношении метаболизирующих лекарств и антиоксидантных ферментов, а также в отношении канцероген-индуцированного папилломагенеза кожи и преджелудка.Фитомедицина. 2004;11(2-3):139-151. Посмотреть реферат.

Де Винченци М., Силано М., Майалетти Ф. и Скаццоккио Б. Компоненты ароматических растений: II. Эстрагол. Фитотерапия 2000;71(6):725-729. Посмотреть реферат.

de, Алмейда, И., Альвиано, Д.С., Виейра, Д.П., Алвес, П.Б., Бланк, А.Ф., Лопес, А.Х., Альвиано, К.С., и Роза, Мдо С. Антигиардиальная активность эфирного масла Ocimum basilicum. Параситол.Рес. 2007;101(2):443-452. Посмотреть реферат.

Дель Фаббро С. и Нацци Ф.Репеллентное действие соединений базилика сладкого на клещей Ixodes ricinus. Exp.Appl.Acarol. 2008;45(3-4):219-228. Посмотреть реферат.

Дорман Х. Дж. и Хилтунен Р. Базилик базилик л.: фенольный профиль и антиоксидантная активность. Нац.прод.коммун. 2010;5(1):65-72. Посмотреть реферат.

Эрлер Ф., Улуг И. и Ялчинкая Б. Репеллентная активность пяти эфирных масел против Culex pipiens. Фитотерапия 2006;77(7-8):491-494. Посмотреть реферат.

Гульчин И., Эльмастас М. и Абул-Энейн Х.Y. Определение антиоксидантной и радикальной активности базилика (Ocimum basilicum L. Family Lamiaceae) с помощью различных методик. Phytother.Res 2007;21(4):354-361. Посмотреть реферат.

Хеннинг С.М., Чжан Ю., Сирам Н.П., Ли Р.П., Ван П., Бауэрман С. и Хебер Д. Антиоксидантная способность и фитохимическое содержание трав и специй в сухих, свежих и смешанных травах пастообразная форма. Int J Food Sci Nutr 2011;62(3):219-225. Посмотреть реферат.

Иоаннидис Д., Боннер Л., and Johnson, CB. УФ-В требуется для нормального развития сальных желез у Ocimum basilicum L. (базилик душистый). Энн.Бот. 2002;90(4):453-460. Посмотреть реферат.

Итен, Ф. и Саллер, Р. [Чай с фенхелем: оценка риска растительного моновещества эстрагола по сравнению с натуральной многокомпонентной смесью]. Forsch.Komplementarmed.Klass.Naturheilkd. 2004;11(2):104-108. Посмотреть реферат.

Айер, Л.В., Хо, М.Н., Шинн, В.М., Брэдфорд, В.В., Танга, М.Дж., Нат, С.С., и Грин, К.E. Глюкуронирование 1′-гидроксиэстрагола (1′-HE) человеческими UDP-глюкуронозилтрансферазами UGT2B7 и UGT1A9. Toxicol Sci 2003;73(1):36-43. Посмотреть реферат.

Jayasinghe, C., Gotoh, N., Aoki, T. и Wada, S. Состав фенолов и антиоксидантная активность сладкого базилика (Ocimum basilicum L.). J Agric.Food Chem. 7-16-2003;51(15):4442-4449. Посмотреть реферат.

Кейта С. М., Винсент К., Шмит Дж., Рамасвами С. и Беланже А. Влияние различных эфирных масел на Callosobruchus maculatus (F.) (Coleoptera: Brchidae). J Stored.Prod.Res 10-15-2000;36(4):355-364. Посмотреть реферат.

Костич М., Попович З., Бркич Д., Миланович С., Сивцев И. и Станкович С. Ларвицидная и антифидантная активность некоторых соединений растительного происхождения в отношении Lymantria dispar L. (Lepidoptera: лимантрииды). Биоресурс.Техн. 2008;99(16):7897-7901. Посмотреть реферат.

Лалко Дж. и Апи А.М. Исследование потенциала кожной сенсибилизации различных эфирных масел в анализе местных лимфатических узлов.Food Chem Toxicol 2006;44(5):739-746. Посмотреть реферат.

Lee, K.G. и Shibamoto, T. Определение антиоксидантного потенциала летучих экстрактов, выделенных из различных трав и специй. J Agric.Food Chem 8-14-2002;50(17):4947-4952. Посмотреть реферат.

Лев, Э. Наркотики, хранящиеся и продаваемые фармацевтами еврейской общины средневекового (11-14 вв.) Каира, согласно спискам materia medica, найденным в коллекции Taylor-Schechter Genizah, Кембридж. J Этнофармакол. 3-21-2007;110(2):275-293.Посмотреть реферат.

Li, Z., Wang, X., Chen, F., and Kim, H.J. Химические изменения и сверхэкспрессия генов в базилике сладком (Ocimum basilicum L.) при обработке метилжасмонатом. J Agric.Food Chem. 2-7-2007;55(3):706-713. Посмотреть реферат.

Лафрин, Дж. Х. и Каспербауэр, М. Дж. Свет, отраженный от цветной мульчи, влияет на аромат и содержание фенолов в листьях базилика сладкого (Ocimum basilicum L.). J Agric.Food Chem. 2001;49(3):1331-1335. Посмотреть реферат.

Матиз Г., Осорио М.Р., Камачо Ф., Атенсия М. и Херазо Дж. [Эффективность противомикробных составов для лечения акне на основе эфирных масел апельсина (Citrus sinensis) и сладкого базилика (Ocimum basilicum L). Биомедика. 2012;32(1):125-133. Посмотреть реферат.

Miele, M., Dondero, R., Ciarallo, G. и Mazzei, M. Метилэвгенол в Ocimum basilicum L. Cv. генуэзский великан. J Agric.Food Chem. 2001;49(1):517-521. Посмотреть реферат.

Miele, M., Ledda, B., Falugi, C., и Mazzei, M. Изменения метилэвгенола и эвгенола в Ocimum basilicum cv.Genovese gigante выращивают в теплице и в пробирке. Boll.Soc.Ital.Biol.Sper. 2001;77(4-6):43-50. Посмотреть реферат.

Мюллер, Л., Каспер, П., Мюллер-Тегетофф, К., и Петр, Т. Генотоксический потенциал in vitro и in vivo аллилбензоловых эфирных масел эстрагола, базиликового масла и транс-анетола. Mutat.Res 1994;325(4):129-136. Посмотреть реферат.

Муруган К., Муруган П. и Нортин А. Ларвицидный и репеллентный потенциал Albizzia amara Boivin и Ocimum basilicum Linn против переносчика лихорадки денге, Aedes aegypti (Insecta:Diptera:Culicidae).Биоресурс.Техн. 2007;98(1):198-201. Посмотреть реферат.

Niture, S.K., Rao, U.S., и Srivenugopal, K.S. Химиопрофилактические стратегии, направленные на ремонтный белок MGMT: усиленная экспрессия в лимфоцитах и ​​опухолевых клетках человека с помощью спиртовых и водных экстрактов нескольких индийских лекарственных растений. Int J Oncol. 2006;29(5):1269-1278. Посмотреть реферат.

Опалченова Г. и Обрешкова Д. Сравнительные исследования активности базилика — эфирного масла из Ocimum basilicum L. — в отношении полирезистентных клинических изолятов родов Staphylococcus, Enterococcus и Pseudomonas с использованием различных методов испытаний.J.Microbiol.Methods 2003;54(1):105-110. Посмотреть реферат.

Патхак, А.К., Бутани, М., Наир, А.С., Ан, К.С., Чакраборти, А., Кадара, Х., Гуха, С., Сети, Г., и Аггарвал, Б.Б. Урсоловая кислота ингибирует путь активации STAT3, ведущий к подавлению пролиферации и химиосенсибилизации клеток множественной миеломы человека. Mol.Cancer Res 2007;5(9):943-955. Посмотреть реферат.

Павела Р. Инсектицидная активность некоторых лекарственных растений. Фитотерапия 2004;75(7-8):745-749. Посмотреть реферат.

Pavela, R. Ларвицидное действие различных евроазиатских растений на личинки Culex quinquefasciatus Say (Diptera: Culicidae). Параситол.Рес. 2008;102(3):555-559. Посмотреть реферат.

Phasomkusolsil, S. и Soonwera, M. Репеллентная активность лекарственных растительных масел в отношении Aedes aegypti (Linn.), Anopheles minimus (Theobald) и Culex quinquefasciatus Say на основе времени защиты и скорости укуса. Юго-Восточная Азия J Trop.Med.Public Health 2010;41(4):831-840. Посмотреть реферат.

Цяо, С., Li, W., Tsubouchi, R., Haneda, M., Murakami, K., Takeuchi, F., Nisimoto, Y. и Yoshino, M. Розмариновая кислота ингибирует образование активных форм кислорода и азота в RAW264. 7 макрофагов. Free Radic.Res 2005;39(9):995-1003. Посмотреть реферат.

Ради, М. Р. и Назиф, Н. М. Содержание розмариновой кислоты и RAPD-анализ регенерированных in vitro растений базилика (Ocimum americanum). Фитотерапия 2005;76(6):525-533. Посмотреть реферат.

Ренцулли К., Гальвано Ф., Пьердоменико Л., Сперони Э.и Guerra, M.C. Влияние розмариновой кислоты на повреждение клеток, вызванное афлатоксином B1 и охратоксином-A, в клеточной линии гепатомы человека (Hep G2). J Appl Toxicol 2004;24(4):289-296. Посмотреть реферат.

Саккетти Г., Медичи А., Майетти С., Радиче М., Муццоли М., Манфредини С., Браччоли Э. и Бруни Р. Состав и функциональные свойства эфирного масла базилика амазонского, Ocimum micranthum Willd., Labiatae по сравнению с коммерческими эфирными маслами. J Agric.Food Chem. 6-2-2004;52(11):3486-3491.Посмотреть реферат.

Санторо, Г.Ф., Кардосо, М.Г., Гимарайнс, Л.Г., Мендонка, Л.З., и Соарес, М.Дж. Trypanosoma cruzi: действие эфирных масел из Achillea millefolium L., Syzygium flavorumum L. и Ocimum basilicum L. на эпимастиготы и трипомастиготы. Эксп.Паразитол. 2007;116(3):283-290. Посмотреть реферат.

Сингх, С. Оценка противоязвенной активности нелетучих масел Ocimum basilicum Linn в желудке. и его возможный механизм действия. Индийский J Exp.Biol. 1999;37(3):253-257.Посмотреть реферат.

Сюрин С. А. Влияние эфирного масла на перекисное окисление липидов и липидный обмен у больных хроническим бронхитом. Клин.Мед (Моск) 1997;75(10):43-45. Посмотреть реферат.

Скрованкова С., Мисуркова Л. и Мачу Л. Антиоксидантная активность и защитные свойства распространенных лекарственных растений. Adv.Food Nutr Res 2012;67:75-139. Посмотреть реферат.

Тоньолини М., Барочелли Э., Баллабени В., Бруни Р., Бьянки А., Кьяварини М. и Импиччиаторе М.Сравнительный скрининг эфирных масел растений: фенилпропаноидный фрагмент как основное ядро ​​антитромбоцитарной активности. Жизнь наук. 2-23-2006;78(13):1419-1432. Посмотреть реферат.

Тохти И., Турсун М., Умар А., Турди С., Имин Х. и Мур Н. Водные экстракты Ocimum basilicum L. (базилик душистый) снижают агрегацию тромбоцитов, индуцированную АДФ и тромбин in vitro и тромбоз артериовенозного шунта у крыс in vivo. Thromb.Res 2006;118(6):733-739. Посмотреть реферат.

Цай, П.Дж., Цай, Т.H., Yu, CH, and Ho, S.C. Оценка NO-подавляющей активности некоторых средиземноморских кулинарных специй. Пищевая хим.токсикол. 2007;45(3):440-447. Посмотреть реферат.

Tuntipopipat, S., Muangnoi, C., и Failla, ML. Противовоспалительная активность экстрактов тайских специй и трав с активированными липополисахаридами мышиными макрофагами RAW 264.7. J Med.Food 2009;12(6):1213-1220. Посмотреть реферат.

Умар А., Имам Г., Йимин В., Керим П., Тохти И., Берке Б. и Мур Н. Антигипертензивные эффекты Ocimum basilicum L.(OBL) на артериальное давление у крыс с реноваскулярной гипертензией. Hypertens.Res 5-7-2010; Посмотреть реферат.

Varney, E. и Buckle, J. Влияние вдыхаемых эфирных масел на умственное истощение и умеренное выгорание: небольшое экспериментальное исследование. J Altern.Complement Med. 2013;19(1):69-71. Посмотреть реферат.

Ядав С., Миттал П.К., Саксена П.Н. и Сингх Р.К. Влияние синергиста пиперонилбутоксида (ПБО) на токсичность некоторых эфирных масел против личинок комаров. J Commun.Dis. 2009;41(1):33-38.Посмотреть реферат.

Ямасаки К., Накано М., Кавахата Т., Мори Х., Отаке Т., Уэба Н., Оиси И., Инами Р., Ямане М., Накамура М. ., Мурата Х. и Наканиши Т. Активность трав против ВИЧ-1 у губоцветных. Biol.Pharm Bull 1998;21(8):829-833. Посмотреть реферат.

Йи, К.Г., Чой, Б.Р., Парк, Х.М., Парк, К.Г., и Ан, Ю.Дж. Фумигантная токсичность эфирных масел растений для Thrips palmi (Thysanoptera: Thripidae) и Orius strigicollis (Heteroptera: Anthocoridae). Ж Экон.Энтомол.2006;99(5):1733-1738. Посмотреть реферат.

Юсиф, А. Н., Скаман, С. Х., Дюранс, Т. Д., и Жирар, Б. Летучие вещества вкуса и физические свойства сладкого базилика, высушенного в вакуумной микроволновой печи и на воздухе (Ocimum basilicum L.). J Agric.Food Chem. 1999;47(11):4777-4781. Посмотреть реферат.

Юн Ю. С., Накадзима Ю., Иседа Э. и Кунуги А. Определение антиоксидантной активности трав с помощью СОЭ. Shokuhin Eiseigaku Zasshi 2003; 44 (1): 59-62. Посмотреть реферат.

Желязков В.Д., Каллахан А.и Кантрелл, К.Л. Урожайность и состав масла 38 образцов базилика (Ocimum basilicum L.), выращенных в Миссисипи. J Agric.Food Chem. 1-9-2008;56(1):241-245. Посмотреть реферат.

Abd El-Ghffar EA, Al-Sayed E, Shehata SM, Eldahshan OA, Efferth T. Защитная роль Ocimum basilicum L. (Basil) против вызванной аспирином язвы желудка у мышей: влияние на окислительный стресс, воспаление, двигательную активность нарушения и тревожноподобное поведение. Функция питания 2018 15 августа; 9 (8): 4457-4468. Посмотреть реферат.

Ахмадифард М., Ярахмади С., Ардалан А., Эбрахимзаде Ф., Бахрами П., Шейхи Э.Эффективность местного эфирного масла базилика при облегчении мигрени: рандомизированное тройное слепое исследование. Дополнение Med Res. 2020;27(5):310-318. Посмотреть реферат.

Электронный свод федеральных правил. Раздел 21. Часть 182. Вещества, общепризнанные безопасными. Доступно по адресу: https://www.accessdata.fda.gov/scripts/cdrh/cfdocs/cfcfr/CFRSearch.cfm?CFRPart=182

Ferriotto G, Marchetti N, Costa V, et al. Отобранные терпены из листьев Ocimum basilicum L. индуцируют накопление гемоглобина в клетках человека К562.Фитотерапия. 2018 июнь; 127: 173-178. Посмотреть реферат.

Fetrow CW, Avila JR. Справочник профессионалов по дополнительным и альтернативным лекарствам. 1-е изд. Springhouse, PA: Springhouse Corp., 1999.

Kiec-Swierczynska M, Krecisz B, Chomiczewska D, et al. Профессиональный аллергический контактный дерматит, вызванный базиликом (Ocimum basilicum). Контактный дерматит 2010;63(6):365-7. Посмотреть реферат.

Sakkas H, Papadopoulou C. Антимикробная активность эфирных масел базилика, орегано и тимьяна.J Microbiol Biotechnol 2017;27(3):429-38. Посмотреть реферат.

Брокколи с базиликом | Противораковый рецепт месяца

11.12.2018

Автор:

Когда дело доходит до борьбы с раком или его предотвращения, то, что вы едите, может иметь такое же значение, как и то, что вы делаете. В этой продолжающейся серии клинических диетологов Института рака здоровья AMITA Health Cancer Institute каждый месяц рекомендуется новый рецепт, который помогает укрепить вашу иммунную систему и повысить общую эффективность вашего плана лечения.Даже если у вас нет рака, эти вкусные блюда помогут вам почувствовать себя лучше.

Брокколи с базиликом

Быстрая и простая в приготовлении брокколи с базиликом придает любому блюду оживленный танец благодаря сочетанию цитрусовых, перечных, сладких и землистых ароматов.

С точки зрения борьбы с раком, в пикантной стороне есть все. Звезда шоу, брокколи, естественным образом содержит глюкозинолаты, серосодержащие соединения, которые распадаются на несколько активных противораковых соединений, включая индол-3-карбинол и сульфорафан.Брокколи также богата витамином С и бета-каротином, которые помогают снизить риск развития рака, защищая клетки от повреждения ДНК.

Завершает усиление вашей иммунной системы антиоксидант ликопин (любезно предоставленный красными овощами), который нейтрализует свободные радикалы в вашем организме, уменьшая повреждение клеток. И последнее, но не менее важное: чеснок широко известен своими противораковыми свойствами. По данным Национального института рака, несколько популяционных исследований показывают связь между повышенным потреблением чеснока и снижением риска некоторых видов рака, включая рак желудка, толстой кишки, пищевода, поджелудочной железы и молочной железы.Было высказано предположение, что чеснок может помочь блокировать образование канцерогенных веществ в организме, улучшить восстановление ДНК, уменьшить пролиферацию раковых клеток и даже убить раковые клетки.

Время подготовки : 10 минут | Время приготовления : 5 минут | Количество порций:  4

Ингредиенты
  • 1 пучок брокколи
  • Морская соль
  • 2 ст.л. оливковое масло первого холодного отжима
  • 1 ст.л. мелко нарезанный чеснок
  • Хлопья красного перца
  • ½ чашки нарезанных кубиками красного сладкого перца или помидоров черри
  • 1 ст.л.свежевыжатый лимонный сок
  • 2 ч. л. лимонная цедра
  • ¼ чашки свежего базилика, мелко нарезанного
Инструкции
  1. Вскипятите большую кастрюлю с водой.
  2. Срежьте соцветия брокколи со стеблей, затем очистите стебли и нарежьте их на небольшие кусочки. Добавьте в кипящую воду соцветия и стебли и щепотку морской соли. Бланшировать 20 секунд.
  3. Слейте воду с брокколи и промойте ее под холодной водой (это поможет сохранить пышный зеленый цвет)
  4. Нагрейте оливковое масло в сотейнике.Добавьте чеснок и щепотку хлопьев красного перца. Обжаривайте в течение 30 секунд или до появления аромата.
  5. Добавьте в сковороду сладкий перец и щепотку морской соли; обжаривать 1 минуту.
  6. Добавьте соцветия и стебли брокколи, а также ¼ ч. л. морской соли и обжаривайте в течение 2 минут (брокколи должна быть твердой).
  7. Аккуратно вмешайте лимонный сок, лимонную цедру и базилик; служить немедленно.

Примечание: рецепт взят с сайта RebeccaKatz.com

Диета, питание и интегративная онкология

Диета

является краеугольным камнем интегративной онкологии, нового подхода к лечению рака, который дополняет традиционные методы лечения (т.например, химиотерапия, облучение и т. д.) с режимом физических упражнений, модификацией образа жизни и снижением стресса. Если рассматривать рак как сорняк, а традиционные методы лечения — как «убийцу сорняков», то интегративная онкология фокусируется на оптимизации «почвы» вашего тела. Укрепляя вашу иммунную систему, интегративная онкология помогает вашему телу естественным образом бороться с раком. Это облегчает ваши симптомы, помогает предотвратить рецидив и улучшает качество вашей жизни в долгосрочной перспективе.

.

Добавить комментарий

Ваш адрес email не будет опубликован.