Никотиновая кислота при похудении: «Как принимать никотиновую кислоту для похудения?» — Яндекс.Кью

Содержание

Никотиновая кислота для похудения

Даже самые популярные и разрекламированные диеты не всегда оправдывают ожидания барышень, которым так хочется быстро и без особого труда скинуть несколько килограммов. Если и у тебя есть опыт обращения к диетам, то ты должна знать, что, во-первых, не каждая диета безопасна для здоровья, а, во-вторых, очень трудно жертвовать своими привычками и пристрастиями даже во имя стройности и красоты.

И вот новая перспектива для достижения все той же цели – никотиновая кислота для похудения. Что она собой представляет? Это очень удачный конгломерат двух витаминов — В3 и РР.

 

Чем полезна эта кислота?

Название кислоты может ввести тебя в заблуждение. А на деле — ничего общего с губительными веществами, которые есть в курительном табаке. Наоборот, в виде никотиновой кислоты организм получает витамины, очень нужные организму.

У тебя бывает такое, что нестерпимо хочется поесть чего-то сладкого или мучного? Если бывает, значит, твой организм нуждается в «никотинке». Вот почему её используют для похудения.

Эта кислота имеет и еще одно полезное свойство – она активизирует образование в коре головного мозга серотонина, который называют гормоном счастья. Именно серотонину ты обязана хорошим настроением, когда всякие вкусности отходят на второй план, выпадают из списка желаний. Это ли не повод к похудению?

 

Как никотиновая кислота способствует стройности

Тебя, наверно, тоже интересует этот вопрос. Не секрет, что многочисленные препараты и диеты, о которых много писали, в итоге оказались совершенно бесполезными. Не надо считать и никотиновую кислоту панацеей, которая немедленно превратит тебя в изящную красавицу. Да, этот витамин — РР или В3, в самом деле, помогает уменьшить вес. Однако не за счёт сжигания жира, а в результате усиленного метаболизма.

Кроме того, кислота уравновешивает содержание холестерина в крови и хорошо выводит тяжёлые металлы и токсины.

 

Итак, ты поняла, что благодаря никотиновой кислоте ты можешь избавиться от роковой привязанности к продуктам, богатым углеводами. Здесь происходит то же самое, что и с заядлыми курильщиками. Если они отказываются от вредной привычки, чаще всего, резко набирают вес. И дело не только в психической зависимости от процесса курения. Главное – людям в этот тяжёлый период недостаёт витамина РР, то есть никотиновой кислоты. Именно она могла бы помочь организму усвоить и переработать поступающие с пищей жиры, углеводы и белки. А это значит, — не появились бы на талии, бёдрах и ягодицах предательские складки, от которых, как ты и сама знаешь, так трудно потом избавиться.

 

Хорошего – помаленьку

Эта народную мудрость можно отнести и к такому средству, как никотиновая кислота для похудения. Запомни, как бы ни хотелось тебе побыстрее сбросить ненавистные килограммы, в день ты не должна употреблять более 1 грамма витамина. Этого вполне достаточно, чтобы организм функционировал нормально. Но учитывай, что «никотинка» попадает в организм не только в виде таблеток. На твоём столе обязательно присутствуют ржаной хлеб, капуста, грибы, картофель, гречка, сыр, рыба. В этих и многих других продуктах содержится немалое количество никотиновой кислоты. Поэтому лучше выбрать не таблетки, а хорошо сбалансированный рацион питания, где будет, в основном, присутствовать еда, богатая «гормоном радости».

 

Никотиновая кислота подействует активнее, если…

Совмещать приём таблеток с разумными физическими нагрузками. Если ты считаешь, что принимая витамины для похудения, можно целые дни проводить у телевизора или валяться на диване, разглядывая гламурные журналы, — ты глубоко заблуждаешься. Борьбы с лишним весом не получится, таким образом ты не выполнишь свою программу – максимум.

 

Принимать таблетки сразу же после еды. Это позволит процессу расщепления веществ идти настолько быстро, чтобы не успели «завязаться» жировые отложения.

Вам следует выпивать в течение суток два-три литра чистой воды. Это хороший союзник никотиновой кислоты, он выводит из организма шлаки, на долю которых приходится чуть ли не половина твоего лишнего веса.

 

Противопоказания

Никотиновая кислота для похудения — препарат, который доступен всем, и ты его без проблем можешь купить в любой аптеке. Тем не менее, будь очень внимательна и к дозировке, и к приему таблеток. Прежде чем принять решение худеть с помощью «никотинки», — обязательно посоветуйся с врачом, и только после этого принимай рекомендованные им дозы витаминов.

 

Как и любой препарат, никотиновая кислота может иметь побочные эффекты. И это необходимо учитывать. Если, например, у тебя повышенная кислотность, — запивай витамины минеральной водой или подогретым молоком.

 

Начиная принимать кислоту, внимательно следи за реакцией организма. Приливы жара и краснота на коже – значит, «никотинка» слишком активно влияет на работу сосудов. Этот препарат вообще нельзя принимать, если человек страдает кровотечениями, гипертонией, язвой, печёночной недостаточностью.

 

Итак, если хочешь с помощью никотиновой кислоты добиться стройности, соблюдай правила:

  • разумно питайся;
  • занимайся спортом;
  • верь в удачу!

< Предыдущая   Следующая >

Никотиновая кислота для похудения 60

Никотиновая кислота для похудения — Женский журнал — Главная Окт 2012 г Никотиновая кислота, несмотря на свое название, является витамином, который Сон для похудения — что может быть проще? (86) Здоровое питание (206) Спорт (60) Средства для похудения (22) Диетическое питание (36) Ванга: ‘Роковые изменения в АПРЕЛЕ ждут 3 знака: Рыбы ‘

Продукты питания богатые витамином PP — ниацин, ниацинамид

Ниацин, ниацинамид, никотинамид,
никотиновая кислота
Указано Считается, что из 60 мг триптофана синтезируется 1 мг ниацина В этой связи, суточная поносы (стул 3-5 раз и более в день, водянистый без крови и слизи) — потеря Пугачева раскрыла СЕКРЕТ своего ПОХУДЕНИЯ! Личный блог и

БЕЗКРАХМАЛЬНАЯ ДИЕТА

Главная составная часть диеты — фрукты и салаты. Не употребляйте в пищу хлеб, картофель, макароны и другую крахмалосодержащую пищу. Пейте только воду. Сколько есть — подскажет диета 30 дней ваш аппетит. Продолжительность диеты до 2 недель. ПРИМЕЧАНИЕ. Не употребляйте в пищу хлеб, картофель и другие крахмалосодержащую пищу. Пейте только воду. Сколько есть — подскажет методики похудения татьяны малаховой ваш аппетит никотиновая кислота для похудения 60 .

МОЛОЧНАЯ ДИЕТА

В первый день пейте по 1 стакану молока в каждые 2 часа с 8 до 20 часов, следующий день — по 1 стакану каждые 1,5 часа, третий день — по 1 стакану каждый час. Далее постепенно увеличивайте количество выпиваемого молока, доведя до 1 стакана каждые полчаса с 8 до 20 часов (если ваш организм легко принимает методики похудения татьяны малаховой столько молока). Молоко должно быть свежим и некипяченым; его можно только слегка подогревать. Его нужно процеживать виды клизм для похудения очень медленно, лучше всего через соломинку .

Французская диета Завтрак: черный кофе. Обед: два яйца, листовой салат, помидор. Ужин: кусок нежирного вареного мяса, листовой салат. Желательно, чтобы молоко было нежирным; часть сливок нужно снимать .
Если во время диеты начинаются малахова похудение сайт запоры, можно в течении дня съесть 10-12 фиников или чернослива. Кроме молока можно пить никотиновая кислота для похудения 60 фруктовые соки .
Переход с молочной диеты на кремлевская диета не худею, обычную осуществляется никотиновая кислота для похудения 60 следующим малахова похудение сайт образом: пейте молоко, как обычно, до 15 часов, ничего не ешьте, затем съешьте салат. Проделывайте то же самое во второй день, а на никотиновая кислота для похудения 60, третий день переходите к обычному питанию никотиновая кислота для похудения 60, .

МЕНЮ НА НЕДЕЛЮ

Первый день
Завтрак. Сок двух апельсинов, виноград, яблоко .
Обед. Салат, помидор, тертая морковь и свекла. Кусочек цельного хлеба с маслом. Изюм или финики .
Диета швейцарских врачей Привожу 3 разновидности никотиновая кислота для похудения 60 диеты для кремлевская диета не худею похудения, рекомендуемых швейцарскими врачами. Внимание! Использовать никотиновая кислота для похудения 60 такого рода диету можно только по совету лечащего врача. Ужин. Яйцо всмятку; шпинат, морковь, сельдерей, приготовленные на буч диета описание, пару. Печеное

никотиновая кислота для похудения 60 яблоко .

Второй день
Завтрак. Изюм, апельсин. Стакан молока .
Обед. Салат из сырых овощей. Сыр. Цельный хлеб с маслом .
Ужин. Творог. Овощи, приготовленные на никотиновая кислота для похудения 60, пару. Сухофрукты .

Третий день
Завтрак. Свежий фруктовый салат. Стакан молока .
Обед. Салат из сельдерея, салата, банана и финика. Цельный хлеб с маслом .
Ужин. Ореховые котлеты с капустой, кабачками, луком, приготовленные на никотиновая кислота для похудения 60, пару. Тушеные фрукты .

Четвертый день
Завтрак. Сырой сочный фрукт. Сладкие сушеные фрукты .
Обед. Яйцо всмятку; шпинат, печеный картофель в мундире, овощи, приготовленные на пару. Печеное буч диета описание яблоко .

Диета на никотиновая кислота для похудения 60, 2000 калорий Чем кремлевская диета не худею больше ваша готовность, тем больше шансов достичь намеченной цели. Помните, что секрет малахова похудение сайт успеха — в вашей никотиновая кислота для похудения 60 решимости малахова похудение сайт добиться никотиновая кислота для похудения 60 желаемого результата. Все в ваших руках!

Пятый день
Завтрак. Яблоко, немного моченого чернослива. Стакан молока .
Обед. Салат методики похудения татьяны малаховой из капусты, салата, помидоров и тертой моркови; финики и изюм. Холодный гренок из цельного хлеба с маслом. Груша или немного винограда .
Ужин. Цветная капуста и морковь, приготовленные на никотиновая кислота для похудения 60, пару с маслом, печеный картофель. Тертые орехи или тертый сыр. Печеное яблоко .

Шестой день
Завтрак. Половина грейпфрута, виноград, яблоко .
Обед. Салат из сырых овощей, сыр, цельный хлеб с маслом, изюм, финики или инжир .
Ужин. Сыр, овощи, приготовленные на кремлевская диета не худею, пару. Фрукты .

Седьмой день
Завтрак. Апельсин, немного фиников, стакан молока .
Обед. Салат из капусты, сельдерея и тертой свеклы. Гренок холодный из цельного хлеба с молоком. Пюре из спелого банана .
Японская диета В течение методики похудения татьяны малаховой, 13 дней, благодаря японской диете, теряется никотиновая кислота для похудения 60 7-8 килограммов веса. В этот период организм выходит методики похудения татьяны малаховой на большие никотиновая кислота для похудения 60, обороты. Японская диета регулирует виды клизм для похудения в течение никотиновая кислота для похудения 60, короткого времени обмен веществ в организме и перестраивает кремлевская диета не худею его на никотиновая кислота для похудения 60, иной ритм. Создатели … Ужин. Ореховые котлеты (или яйцо всмятку), лук, кабачки, свекла или морковь, приготовленные на пару. Свежий фруктовый салат никотиновая кислота для похудения 60 .

ПРИМЕЧАНИЕ .
Любой овощ, рекомендуемый в тот или иной день, можно заменить виды клизм для похудения любым другим, который есть в данный сезон. Все салаты следует никотиновая кислота для похудения 60 приправлять крем для похудения баня сауна массаж оливковым маслом, лимонным соком, либо тем никотиновая кислота для похудения 60 и другим. НЕ ПОЛЬЗУЙТЕСЬ УКСУСОМ. Не пейте во время еды, так как это вредно для пищеварения. Пейте не позднее, чем диета 30 дней за полчаса до еды, и спустя 2-3 час после еды .

Форум о бодибилдинге и фитнесе сайта IronFlex com ua >

Никотиновая В начале 60-х годов прошлого века учёные выяснили, что большие дозы никотиновой Никотиновая кислота значительно снижает уровень жирных кислот и триглицеридов Поэтму избегайте дополнительный прием ниацина во время похудения Цитата(Евгений 28 7 2012, 22:44) *

Агент РР |

Никотиновая кислота Витамин РР Польза Июня 2009 г стройняшка будь стройненькой — все о похудении, здоровом Больше известный в народе как никотиновая кислота, витамин РР

Зверобой,

никотиновая кислота » Диеты и способы похудения Тем, кто привязан к еде,— зверобой, 5-гидрокситриптофан, никотиновая кислота Вряд ли найдется человек, который не слышал, что зверобой — это

Никотиновая кислота для похудения — Следим за собой Никотиновая кислота для похудения на сайте о Диета кормящей матери и диета 5 распечатать Сюжетная кампания начинается с того, что Ларс и

никотиновая кислота-как помошник похудению: Дневник — Diets ru Февр 2012 г Препарат никотиновая кислота относится к витаминным производным для ускорения процесса расщепления жиров при похудении

Никотиновая кислота — Википедия Впервые никотиновая кислота была синтезирована в 1873 году Вайделем при окислении никотина азотной кислотой, современные как лабораторные,

никотиновая кислота для роста волос | форум Woman ru Окт 2011 г Никотиновая кислота — вит группы В, лучше купить те же ампулы витаминов 14 европа | 14 10 2011, 17:44:02 [1491572229] европа

2013 elex3000. narod.ru/pub Никотиновая кислота для похудения 60

ТУРБОСЛИМ КОФЕ N10 ПАК ПО 2,0Г

ТУРБОСЛИМ КОФЕ — Биологически активная добавка (БАД) к пище — Высококачественный бразильский кофе, обогащенный экстрактами растений, витаминами и хромом для комфортного похудения

Активное вещество:

кофе,экстракт гарцинии, экстракт хвоща, экстракт лопуха (инулин), экстракт сенны,витамин РР (никотиновая кислота), экстракт куркумы, хрома пиколинат

Действие:

снижение веса и мягкое очищение организма

Содержание в 2 пакетиках-саше (суточном приеме)

Кофе, 3602,4 мг

в том числе кофеин, не менее1 60 мг

Экстракт гарцинии (50% гидроксилимонной кислоты) 120 мг

Экстракт хвоща 100 мг

Инулин 80 мг

Экстракт сенны 70 мг

Ниацин (витамин PP) 20 мг

Экстракт куркумы (93% куркумина) 5,2 мг

Хром 24,2 мкг

Что главное в похудении? Очищение! Чтобы обрести и сохранить стройность, замените ваш обычный кофе на кофе Турбослим. Это один из оптимальных способов поддержания стройности.

Уникальный1 состав препарата Кофе Турбослим позволит вам наслаждаться любимым вкусом настоящего кофе и при этом обретать стройность.

Кофе Турбослим на 88% состоит из высококачественной бразильской арабики, вкус которой оценят все, кто знает толк в хорошем кофе, а также из тщательно подобранных растительных ингредиентов, способствующих активному похудению.

Благодаря сбалансированному составу и эффективности компонентов, Кофе Турбослимдействует сразу в нескольких направлениях:

-способствует очищению организма от шлаков и токсинов

-снижает аппетит

-ускоряет обменные процессы

-придает энергию

Еще одно преимущество Кофе Турбослим — удобная форма выпуска в виде отдельных пакетиков-саше, которые можно легко взять с собой и использовать в любой ситуации.

Как работают ингредиенты:

Экстракт гарцинии камбоджийской замедляет превращение избыточных углеводов в жировые отложения и способствует снижению аппетита.

Экстракт куркумыспособствует желчеобразованию и желчеотделению, поддержанию обмена веществ и пищеварения.

Экстракт хвоща обладает мягким мочегонным действием, способствует выведению метаболитов из организма, поддерживает водно-солевой обмен.

Экстракт лопухасодержит инулин, который создает условия для роста собственной полезной микрофлоры кишечника, способствует выведению из организма метаболитов.

Экстракт сенныспособствует улучшению двигательной активности толстого кишечника, оказывает мягкое послабляющее действие, способствует очищению.

Витамин PP способствует расширению периферических мелких сосудов, улучшая тем самым кровообращение.

Хрома пиколинат (органическая форма) поддерживает в норме физиологический уровень глюкозы в крови, что в свою очередь способствует уменьшению тяги к сладкому и естественному снижению веса.

Кофе Турбослим отлично работает в сочетании с чаем Турбослим. Воспользуйтесь удобной формулой стройности от компании «Эвалар»: утром — кофе Турбослим, вечером — чай Турбослим! Чай и кофе Турбослим — почувствуйте разницу с ним!

1 В ассортименте ЗАО «Эвалар».

* По данным Ежемесячного розничного аудита фармацевтического рынка России, проводимого ОА «Группа ДСМ» (DSM Group), по итогам 2020 года бренд «Турбослим» производства фармацевтической компании «Эвалар» в стоимостном и натуральном выражении занимает первое место в категории биологически активных добавок, применяемых для похудения.

Можно ли есть мёд при похудении и как это правильно делать

Натуральные продукты пчеловодства полезны для организма благодаря большому содержанию витаминов и минеральных веществ. Они используются не только в качестве лекарства от гриппа и ОРВИ, но также и как средство, помогающее сбросить вес.

Именно такого мнения придерживаются российские эксперты. В частности, Наталья Фадеева, будучи кандидатом наук в области медицины, считает эту сладость полезной и рекомендует её всем людям, следящим за своей фигурой. Чтобы диета прошла правильно, нужно определиться, как пить мёд для похудения без вреда для организма.

Кратко, ответ на вопрос «можно ли есть мёд при похудении» – положительный. Но рекомендуется соблюдать некоторые правила.

Полезные свойства

Регулярное питьё мёда улучшит состояние организма, поскольку продукт оказывает массу положительных эффектов. В первую очередь, он является полноценной заменой сахару и может употребляться людьми, страдающими от диабета на некоторых этапах.

В составе мёда около 75% занимают фруктоза и глюкоза, которые не имеют ощутимых запахов и могут добавляться в виде подсластителей. Несмотря на довольно высокую калорийность, позволяющую использовать сладость как источник энергии, при правильном приготовлении блюд вместе с ней, она помогает сжигать жиры.

В продукте содержится 11 витаминов. В наибольшем количестве представлена аскорбиновая кислота, снижающая риск возникновения инсультов и инфарктов, а также укрепляющая кости, улучшающая производительность мозга, заживляющая раны. В зависимости от сорта, количество веществ может изменяться, однако они всегда находятся внутри мёда. В сладости также содержатся витамины:

  • каротин;
  • рибофлавин;
  • токоферол;
  • никотиновая кислота;
  • биотин;
  • пиридоксин;
  • фолиевая кислота;
  • филлохинон.

Правила употребления

Требуется ответственно подойти к тому, как пить мёд для похудения, поскольку отсутствие каких-либо знаний в этом деле может не просто не дать положительных результатов, но и привести к обратному эффекту.

Несмотря на всю пользу продукта, его потребление во время диеты стоит ограничить – если обычно рекомендуется не более 150 граммов в день, то в таком случае максимальное количество снижается до 80-90 граммов.

Простое питьё мёда возможно в любое время суток, в том числе и перед сном. Он называется «природным снотворным», поскольку помогает расслабиться. От рецептов, где сладость добавляется в молоко или сливки, нужно отказаться ввиду большого количества калорий, поэтому вместо этих напитков советуется использовать тёплую воду или диетические чаи.

 

Рецепты

Одна из эффективных, но не строгих диет, предполагает полную замену всех сахаров именно этим продуктом. После и перед каждым приёмом пищи следует пить чай или воду, разбавленную со сладостью. Из рациона исключаются все крупы, а также мясо и картофель.

Максимальный акцент нужно отвести на ужин – он должен заканчиваться не позднее, чем за три часа до сна, а также быть максимально некалорийным: подойдёт фруктовый или овощной салат. Курс должен продолжаться не более трёх недель, по истечении которых даётся 7 дней на плавное восстановление списка блюд. Тем не менее, специалисты рекомендуют и в дальнейшем заменять сахар в чае мёдом.

Сбросить до полутора килограммов за один «разгрузочный» день можно благодаря следующему несложному рецепту. Для приготовления блюда требуется всего два ингредиента – 3 столовые ложки мёда и до 12 яблок. Из фруктов следует удалить сердцевины, прежде чем нарезать на равные дольки. Их нужно облить мёдом и употреблять в течение суток, запивая только водой.

Мнения экспертов

Помимо точки зрения Натальи Фадеевой, упомянутой в начале текста, схожие мнения имеют прочие врачи. Александр Кузнецов, написавший несколько десятков работ по медицине, создал собственный курс, соблюдение которого приведёт к улучшению обмена веществ. Основным ингредиентом в нём является именно мёд.

Другой специалист, Лариса Иванова, советует всем, за полчаса до завтрака, пить воду с добавлением этой сладости. Свои действия она подкрепляет фактам, доказывающими, что такая привычка позволяет улучшить выработку желудочного сока для переваривания пищи.

Если смотреть на картину в целом, то мнения многих специалистов и простых людей подкрепляют утверждения в вопросе «можно ли есть мёд при похудении». Подобная диета улучшает работу систем в организме, что способствует ускорению обмена веществ, а сытность продукта позволяет снизить употребление лишних калорий.

Никотиновая кислота при похудении | medicalarea.ru

Всем известно, что для борьбы с лишним весом рекомендуется уменьшить рацион и увеличить физические нагрузки. Но случается так, что даже при посещении тренажерного зала избыточный вес снижается очень медленно. Для ускорения процесса похудения существует немало способов, одним их которых является потребление никотиновой кислоты, о которой будет рассказано в данной статье.

Никотиновая кислота никак не связана с курением, а является одним из названий витамина В3 (другие его наименования — ниацин, витамин РР). Этот витамин очень важен для правильного функционирования человеческого организма. Например, довольно популярна никотиновая кислота renewal.

В день взрослому человеку необходимо получать 20 мг витамина В3. Получить его можно при употреблении орехов, печени, желтка, молока, сыра, мяса индейки, бобовых.

Однако бывает сложно обеспечить организм суточной нормой этого витамина, ведь не у каждого получается пристально следить за своим рационом. А это приводит к неприятным последствиям, ведь при неполучении организмом никотиновой кислоты появляется быстрая утомляемость, раздражительность, появляется непреодолимое желание съесть что-нибудь сладенькое. Соответственно, ни о каком похудении речи не идет.

Витамин В3 не является жиросжигающим веществом. Он только помогает в избавлении от лишнего веса снижением холестерина в крови, улучшением микроциркуляции крови, выведением токсинов из организма, а также участием в обмене жиров, белков.

Ниацин также влияет на выработку гормона радости, или серотонина. А в случае недостатка серотонина в организме у человека появляется желание съесть что-нибудь высококалорийное, например сдобу или шоколадный батончик. В таком случае скорее набрать вес, чем уменьшить его.

Таким образом, никотиновая кислота помогает преодолеть желание в употреблении простых углеводов и осуществить переход на здоровое питание, что, несомненно, произведет благоприятный эффект.

Витамин В3 можно приобрести в таблетках, в виде порошка, раствора для инъекций. Чтобы определить дозировку, требуется проконсультироваться с врачом. Максимальная доза составляет 1 г.

Кроме оказания помощи при похудении, ниацин рекомендуется принимать и при авитаминозах, при нарушении мозгового кровообращения, при патологии сосудов, гастритах, интоксикациях, длительно незаживающих ранах.

Однако при приеме данного лекарственного препарата всегда нужно помнить следующее:

1. Соблюдать дозировку.

2. Принимать после еды.

3. Запивать водой.

4. Увеличить потребление молочных продуктов. Это смягчит воздействие препарата на печень.

Итак, никотиновая кислота очень полезна для организма. А если прием этого витамина еще и сочетать с физическими нагрузками, то в короткие сроки можно достичь избавления от надоевших лишних килограммов.

«Биодобавки убили мою печень и едва не убили меня»

Автор фото, Jim McCants

Підпис до фото,

Джиму Маккентсу пришлось пересадить печень после приема пищевых добавок

История американца, которому пришлось пересаживать печень после приема экстракта зеленого чая в капсулах, вновь заставила заговорить о биодобавках.

Когда 50-летний Джим Маккентс начинал принимать капсулы с зеленым чаем, он надеялся, что антиоксиданты помогут ему избежать инфаркта и вести активный образ жизни до самой старости. Ежедневно он проходил (или пробегал) по несколько километров, старался худеть и питаться сбалансированно.

«Я был готов к тому, что эти капсулы окажутся бесполезными и я впустую потрачу деньги. На такой риск я был согласен. Но я никак не ожидал, что у меня откажет печень», — говорит Маккентс. В день школьного выпускного у сына он почувствовал себя плохо.

«Ты весь желтый», — сказала Джиму жена, и они срочно отправились в больницу.

Несколько дней врачи делали анализы и не могли поставить диагноз. Наконец Маккентсу сообщили, что его спасет только трансплантация печени. Без пересадки он не прожил бы и недели — печень полностью отказала.

По чудесному стечению обстоятельств, подходящий для пересадки донорский орган нашелся за один день. Сейчас, спустя четыре года после операции, Маккентс испытывает постоянную боль в животе, находится на постоянном медикаментозном лечении и с трудом ходит.

Он подал в суд на компанию Vitacost — производителя капсул. Они продаются без рецепта — поскольку добавка произведена из чая, в США она считается пищевым продуктом, а не лекарством, и не проходит сертификацию и испытания.

«Никаких предупреждений о возможном риске и побочных эффектах в инструкции нет», — говорит Маккентс.

Автор фото, Getty Images

Эксперты называют случай Маккентса крайне необычным.

Однако в мире ежегодно фиксируется около 80 случаев болезни печени у людей, принимающих гранулированный зеленый чай: например, отказ печени и почек произошел у 17-летней жительницы канадской провинции Онтарио Мадлен Папино.

Возможно, опасность таится в потенциально токсичном ингредиенте зеленого чая EGCG (эпигаллокатехин-3-галлат). Этот катехин (вещество с антиоксидантными свойствами) в изобилии содержится в напитке, а в гранулах его концентрация повышена в сотни раз.

«Если вы просто пьете зеленый чай в разумных количествах, вам ничего не грозит,» — рассказал ВВС профессор медицинского факультета Уэйк Форест в Северной Каролине Герберг Бонковски. Он изучает влияние биодобавок из зеленого чая на печень уже почти 20 лет.

«Рискуют те, кто принимает сильно концентрированные экстракты. Обычно их пьют те, кто хочет худеть, и зачастую они в этот период почти не едят твердой пищи. Мы знаем из исследований, проведенных на животных, что организм голодного, истощенного животного усваивает гораздо больше катехинов, чем организм более упитанных особей. Еще одним фактором риска может быть параллельный прием других лекарств или алкоголя», — говорит профессор.

Так вредны ли биодобавки?

В Британии биодобавки должны пройти предусмотренные Евросоюзом проверки на безопасность и влияние на здоровье человека.

Одобренные регуляторами добавки, приобретенные у надежных производителей, практически всегда безопасны и комплектуются инструкциями по применению, уверяют врачи.

При этом, как отмечает доктор Уэйн Картер из Университета Ноттингема, нельзя утверждать, что пищевые добавки не могут быть потенциально вредными.

Например, если вы примите повышенную дозу такого препарата, то может возникнуть риск для здоровья.

Автор фото, Getty Images

Хотя во многих случаях излишки вещества будут выведены из организма, это может стать угрозой для печени, которая очищает потребляемые нами вещества от токсинов.

«Мне кажется, что иногда люди думают так: «Это полезно для меня, поэтому если я приму большую дозу, то мне станет еще лучше». Однако тут возникает риск», — говорит доктор Картер.

Одновременный прием сразу многих пищевых добавок также может представлять опасность, предупреждает эксперт.

Иногда они могут взаимодействовать друг с другом: один препарат может усиливать эффект от другого. В других случаях они могут содержать один или несколько одинаковых питательных веществ, что приводит к передозировке.

Кому-то из нас сложнее эффективно перерабатывать те или иные вещества, и от этого тоже зависит их влияние на организм.

«Особенность таких препаратов в том, что они безопасны для большинства людей, но не для каждого», — добавляет Картер.

Однако если таковы потенциальные риски, то какова же польза для здоровья?

Витамины обязательные и необязательные

Некоторые биодобавки признаются большинством экспертов универсально полезными.

Национальная служба здравоохранения Британии (NHS) рекомендует женщинам, желающим забеременеть, принимать фолиевую кислоту (она же — витамин B9). Эта рекомендация актуальна и для беременных женщин сроком до 12 недель, чтобы предотвратить ряд врожденных болезней у ребенка.

Правительство Британии на этой неделе заявило, что обсудит с экспертами возможность добавления фолиевой кислоты в муку.

Есть еще два витамина, которые официальная медицина настойчиво рекомендует: D и K.

Прием витамина D также рекомендован младенцам, детям в возрасте от одного до четырех лет и людям, которым не хватает солнечного света.

Это касается тех, кто часто испытывает слабость или не выходит из дома, а также тех, кто постоянно носит закрытую одежду.

В целом же прием витамина D рекомендован практически любому человеку.

Автор фото, Getty Images

Підпис до фото,

Служба здравоохранения Британии отмечает, что все необходимые человеку витамины и минералы содержатся в здоровой пище

Недостаток витамина D, который мы в основном получаем из солнечного света, может привести к разным видам деформации костей: рахиту у детей и остеомаляции у взрослых.

«Сто лет назад большинство детей в Лондоне были больны рахитом. Однако ситуация улучшилась после того, как детям стали давать витаминные добавки», — рассказывает Бенджамин Джейкобс, сотрудник Королевского национального ортопедического госпиталя.

Помимо витамина D, практически всем маленьким детям в Британии показана инъекция витамина К — ее делают в первые 24 часа после рождения с целью предотвращения внутренних кровотечений.

Здоровое питание и добавки

Доктор Джейкобс отмечает, что биодобавки рекомендованы также людям, сидящим на строгой диете, и аллергикам.

Например, британская национальная система здравоохранения (NHS) рекомендует веганам употреблять витамин B12, который в натуральном виде содержится только в продуктах животного происхождения.

Однако что касается многих других добавок, то их универсальная польза менее очевидна.

Например, специалисты NHS утверждают, что большинство людей не нуждаются в приеме витаминных добавок, так как все необходимые витамины и минералы, кроме витамина D, уже есть в продуктах, если человек питается сбалансированно.

Польза от капсул с рыбьим жиром, которые часто принимают для улучшения работы сердца или мозга, тоже не столь очевидна.

Так, ученые пришли к выводу, что утверждение о пользе таких капсул для сердца во многом ошибочны.

Как отмечает Сэм Дженнингс, глава консалтинговой компании Berry Ottaway & Associates Ltd, диетология — это постоянно развивающаяся наука, где постоянно появляются новые данные.

«Очевидно, что пищевые добавки не могут быть одинаково полезны всем людям, так как это зависит от особенностей каждого человека, а также от того, получит ли человек пользу от какого-либо дополнительного питательного вещества», — говорит она.

Доктор Картер советует изучить выводы ученых касательно той или иной добавки, прежде чем принимать ее, а также ознакомиться с противопоказаниями.

Как выбирать пищевыедобавки

  • Покупайте добавки у проверенных поставщиков — препараты должны пройти контроль качества
  • Проверьте, были ли проведены клинические испытания на людях, для которых они предназначены
  • Изучите противопоказания — например, людям с болезнями сердца стоит обратить внимание на влияние препарата на работу этого органа
  • Будьте осторожны при приеме нескольких препаратов одновременно
  • Придерживайтесь рекомендованных доз

Источник: доктор Уэйн Картер.

Это на Новый год: морская трава поможет похудеть и спасет от похмелья | Статьи

В преддверии новогодних праздников дальневосточные ученые получили ряд патентов на производство витаминного напитка из молочной сыворотки, сока и морской травы зостеры, которая растет в море как сорняк. Особенность этого продукта в том, что в нем содержится морской пектин — зостерин, прекрасный натуральный адсорбент, который выводит из организма токсины, в том числе молекулы спирта. Связывая токсины и продукты распада алкоголя, этот пектин помогает организму избавиться от них естественным путем. Кроме того, напиток позволяет вывести тяжелые металлы и радионуклиды, а также похудеть. Правда, продукт подойдет не каждому, отмечают ученые.

Морской сорняк

Сотрудники Департамента пищевых наук и технологий Школы биомедицины Дальневосточного федерального университета (ДВФУ) разработали богатый витаминами и минералами напиток на основе молочной сыворотки, пектина из морской травы зостеры (взморника) и фруктового сока. Напитком можно утолить не только жажду, но и голод, а также восполнить силы организма после занятий спортом или болезни. Ученые предлагают выпускать продукт в трех вариантах: со вкусом абрикоса, персика или ананаса.

В напиток добавили морской пектин — зостерин, который добывают из травы зостеры. Благодаря ему продукт получил более насыщенную, густую структуру, в нем образуются гелеобразные включения, наподобие тех, что содержатся в популярном напитке из алоэ вера. Кроме того, зостерин — это прекрасный натуральный адсорбент (материал, поглощающий вещества только своей поверхностью. — «Известия»). Как рассказала «Известиям» профессор Департамента пищевых наук и технологий Школы биомедицины ДВФУ Оксана Табакаева, он выводит из организма тяжелые металлы, радионуклиды и т.д.

Многолетнее морское травянистое растение зостера (взморник морской)

Фото: Depositphotos

Если говорить о предстоящих новогодних праздниках, то адсорбирующие свойства напитка, несомненно, могут помочь справиться и с последствиями алкогольной интоксикации, — отметила разработчик продукта.

Связывая токсины и продукты распада алкоголя, этот пектин помогает организму избавляться от них естественным путем.

Сыворотка хорошего самочувствия

Напиток может также помочь похудеть и укрепить организм. Этому поспособствует молочная сыворотка — жидкость, которая остается после свертывания и процеживания молока на производстве. По сравнению с белками из цельного коровьего молока, белки из молочной сыворотки гораздо легче усваиваются и больше похожи на ферменты человеческого материнского молока, поэтому их применяют для изготовления продуктов детского питания. Благодаря высокому содержанию витаминов группы В напитки на основе молочной сыворотки помогают в целом укрепить организм.

В состав сыворотки входят и минералы: магний, кальций, фосфор, калий. Присутствуют также регулирующий белковый и жировой баланс биотин, важнейший строительный материал для мозга холин и никотиновая кислота. Если заменить таким богатым питательными веществами напитком обычные перекусы, то можно с легкостью избавиться от нескольких лишних килограммов.

Фото: Depositphotos

— Молочная сыворотка — очень ценный продукт, она богата биологически полноценными белками и минералами, которые легко усваиваются человеческим организмом, — рассказала Оксана Табакаева. — В ней содержится полезный молочный сахар — лактоза, которая также полностью усваивается. Важно, что сыворотка не содержит жиров. Однако есть проблема. Вкусовые качества чистой сыворотки оставляют желать лучшего, поэтому пить ее люди не хотят. Наша идея была в том, чтобы на ее основе сделать вкусный и полезный напиток с приятной текстурой и высокими потребительскими свойствами. Мы дополнительно усилили полезность напитка, включив в его состав морской пектин, что делает продукт уникальным.

ПОДРОБНЕЕ ПО ТЕМЕ

По словам ученого, стоимость нового напитка при его массовом производстве будет невысока. Продукт имеет достаточно продолжительный срок годности. Разлитый в герметичную асептическую упаковку, он может сохранять свои полезные свойства более месяца. Дома напиток может храниться в обычном холодильнике.

Представленная в нем комбинация естественных сорбентов, электролитов и легкодоступного белка представляет интерес, уверен заведующий кафедрой общей врачебной практики медицинского института РУДН (вуза-участника проекта «5-100») Николай Стуров.

Такое сочетание будет уместно при лечении гастритов и язвенной болезни, если напиток сохранит свои качества при согревании до 40–50 градусов, поскольку при перечисленных заболеваниях не рекомендуются к употреблению холодные жидкости. Сорбенты, витамины группы В и электролиты очень полезны при лечении похмелья. Но это будет помощью лишь в устранении его симптомов, а вред от токсического воздействия алкоголя на мозг, печень, сердце никуда не денется, — отметил ученый.

Молочная сыворотка

Фото: Depositphotos

Завкафедрой «Пищевые и биотехнологии» Высшей медико-биологической школы Южно-Уральского государственного университета (НИУ) Ирина Потороко считает, что разработка дальневосточных ученых действительно весьма перспективна с точки зрения биологической активности.

— Давно подтверждена пищевая ценность сыворотки и нет сомнений в важности компонентов, входящих в ее состав. Пектиновые вещества способны повышать эффективность детоксикации систем организма, поэтому могут выступать как регуляторы нарушений при токсичном воздействии алкогольных напитков, — сообщила эксперт.

Однако не для всех людей такой напиток может быть полезен, уверен декан факультета биологической и медицинской физики МФТИ Александр Мелерзанов.

Значительное количество людей теряет способность усваивать лактозу с возрастом, поэтому ценность смешивания пектинов с ней неочевидна, так как резко ограничивает круг потребителей напитка. Даже в преддверии праздников рекомендовать продукт для решения проблем избыточного потребления пищи и алкоголя не представляется целесообразным, учитывая достаточное количество доступных для широких масс населения различных сорбентов, производимых российской промышленностью, — считает ученый.

Ранее в 2019 году ученые из ДВФУ создали оздоравливающий напиток из медузы и цитрусов, а осенью 2018 года представили обогащенный йодом хлеб с морским гребешком.

ЧИТАЙТЕ ТАКЖЕ

Ниацин повышает уровень адипонектина и уменьшает воспаление жировой ткани у мышей, получавших диету с высоким содержанием жиров Ожирение связано с повышенным риском метаболических и сердечно-сосудистых заболеваний (ССЗ), причем ССЗ являются одной из ведущих причин заболеваемости и смертности в США [1]. Чрезмерный липолиз жировой ткани и повышение уровня неэтерифицированных жирных кислот (НЭЖК) в сыворотке крови являются характерными признаками ожирения, которые часто приводят к развитию атерогенной дислипидемии.Атерогенная дислипидемия представляет собой группу метаболических нарушений, характеризующихся умеренно повышенным уровнем холестерина липопротеинов низкой плотности (ХС ЛПНП; 130–159 мг/дл) и триглицеридов (ТГ; >150 мг/дл), небольшими частицами ЛПНП и низким содержанием липопротеинов высокой плотности. холестерина (HDL-C;

<35 мг/дл) [2]. Ниацин, клинически используемый в качестве монотерапии, является эффективным фармакологическим вмешательством для лечения атерогенной дислипидемии благодаря его способности уменьшать толщину интимы медии сонных артерий, улучшать функцию эндотелия и снижать заболеваемость и смертность от сердечно-сосудистых заболеваний, предположительно, за счет улучшения характеристик липидов и липопротеинов крови.Наряду с умеренным снижением концентраций циркулирующих липопротеинов очень низкой плотности (ЛПОНП), ХС-ЛПНП, ТГ и липопротеина (а) ниацин является эффективным фармакологическим средством для повышения концентрации ХС-ЛПВП [3]–[6].

Улучшение метаболизма липидов в крови, вызванное никотиновой кислотой, в значительной степени объясняется его хорошо задокументированным влиянием на липолиз жировой ткани и синтез триглицеридов в печени [7]. Ниацин ингибирует липолиз за счет активации ниацинового рецептора (HCA 2 ) в жировой ткани, который временно ингибирует цАМФ/PKA и снижает гидролиз триглицеридов и концентрацию NEFA в сыворотке [8].Однако недавно было продемонстрировано, что влияние ниацина на липиды не зависит от рецептора ниацина и подавления свободных жирных кислот [9].

Становится все более очевидным, что ниацин обладает плейотропными свойствами в дополнение к его известным терапевтическим эффектам на метаболизм липидов. Данные нашей и других групп показывают, что ниацин резко увеличивает концентрацию адипокина, адипонектина в сыворотке, у мужчин с ожирением и метаболическим синдромом [10], [11]. Кроме того, однократная доза ниацина, введенная перорально или посредством внутрибрюшинной инъекции, резко увеличивает концентрацию адипонектина в сыворотке крови у крыс и мышей в течение нескольких минут, и этот эффект зависит от активации рецептора ниацина [12].Другие продемонстрировали, что лечение ниацином приводит к увеличению мРНК адипонектина [13], [14]. Снижение концентрации циркулирующего адипонектина является одним из наиболее многообещающих биомаркеров метаболического синдрома и сердечно-сосудистых заболеваний. Адипонектин обладает инсулинсенсибилизирующими, антиатеросклеротическими и противовоспалительными свойствами; поэтому, по крайней мере, некоторые из преимуществ ниацина для здоровья могут быть связаны с повышением концентрации адипонектина в сыворотке.

Совсем недавно исследования показали, что никотиновая кислота оказывает противовоспалительное действие в ряде тканей, включая почки [15], легкие [16], адипоциты 3T3-L1 [14], моноциты [17], клетки пигментного эпителия сетчатки [18]. ] и эндотелиальные клетки сосудов [19], [20].Было показано, что введение ниацина снижает экспрессию MCP-1, TNF-α и IL-6 и активацию NF-κB в почках и легких на моделях грызунов [15], [16]. Кроме того, лечение ниацином снижает вызванное TNF-α увеличение экспрессии генов и секреции провоспалительных хемокинов MCP-1, фракталкина и RANTES, а также увеличивает мРНК адипонектина в адипоцитах 3T3-L1 [14]. Лечение ниацином подавляет сигнальный путь NF-κB, что приводит к снижению секреции провоспалительных цитокинов и хемокинов TNF-α, IL-6 и MCP-1 в изолированных человеческих моноцитах и ​​клетках пигментного эпителия сетчатки [18], [21].Было продемонстрировано, что ниацин ингибирует воспаление сосудов, уменьшая выработку активных форм кислорода эндотелием и выработку воспалительных цитокинов [22]. Системно ниацин снижает С-реактивный белок и ФНО-α, а также уменьшает воспаление печени за счет уменьшения содержания печеночных макрофагов [23], [24]. Ниацин также ингибирует хемотаксис моноцитов [14]. Многие из этих противовоспалительных свойств ниацина связаны с активацией ниацинового рецептора [17], [18].

Ожирение связано со снижением концентрации адипонектина в плазме и хроническим вялотекущим воспалением, характеризующимся повышенной экспрессией в жировой ткани провоспалительных хемокинов и цитокинов, таких как MCP-1 [25] и TNF-α [26], а также инфильтрацией макрофагов M1 (провоспалительных) [27], [28].Таким образом, целью настоящего исследования было определить влияние введения никотиновой кислоты на вызванное ожирением воспаление жировой ткани посредством изменений профиля цитокинов и макрофагальной инфильтрации жира с особым акцентом на роль адипонектина.

Материалы и методы

Материалы

Ниацин (никотиновая кислота) был приобретен у Sigma-Aldrich (Сент-Луис, Миссури). Кроличьи поликлональные антитела к адипонектину и GAPDH были получены от Abcam, Inc.(Кембридж, Массачусетс).

Исследования на животных

Тридцать два самца мышей C57BL/6 в возрасте 3–4 недель были приобретены в Charles River Laboratories (Уилмингтон, Массачусетс). Мышей переводили либо на контрольную диету (10% ккал в виде жира; n = 16), либо на диету с высоким содержанием жиров (HFD; 60% ккал в виде жира; n = 16), полученную от Research Diets (Нью-Брансуик, Нью-Джерси) на 11 недель. . После шести недель на контрольной диете или на диете с высоким содержанием жира половина мышей из каждой группы получала ниацин (примерно 200 мг/кг/день), растворенный в питьевой воде или растворителе (воде) в течение четырех недель.Концентрации ниацина были увеличены примерно до 360 мг/кг/день на пятой неделе лечения. После пяти недель обработки носителем или никотиновой кислотой мышей не кормили в течение ночи (12 часов) и умерщвляли обезглавливанием. Цельную кровь собирали и обрабатывали для выделения сыворотки, а ткани мгновенно замораживали в жидком азоте и хранили при -80°C до анализа.

Параллельные исследования проводились на самцах глобальных мышей HCA 2 -/- (рецептор ниацина). Тринадцать мышей HCA 2 -/- были помещены на контрольную диету (7 получали носитель, 6 получали ниацин), а девять мышей HCA 2 -/- были помещены на диету с высоким содержанием жиров (4 получали носитель). ; 5 получили никотиновую кислоту).Начальные HCA 2 -/- пар мышей для разведения были щедрым подарком доктора Стефана Офферманнса (Бад-Наухайм, Германия). Все исследования на животных были одобрены Институциональным комитетом по уходу и использованию животных Обернского университета до их начала, и были приняты максимальные меры для сведения к минимуму страданий животных.

Анализ сыворотки

Концентрации общего адипонектина и инсулина в сыворотке измеряли с использованием наборов ELISA от Millipore (Temecula, CA). Концентрации высокомолекулярного (HMW) адипонектина в сыворотке измеряли с использованием набора ELISA от Alpco Diagnostics (Salem, NH).Концентрации глюкозы и триглицеридов в сыворотке измеряли с помощью наборов от Cayman Chemicals (Анн-Арбор, Мичиган). NEFA в сыворотке измеряли с использованием набора от Wako Chemicals (Richmond, VA).

ПЦР в реальном времени

РНК выделяли из белой жировой ткани придатка яичка (EWAT) с использованием мини-набора Qiagen RNeasy Lipid Tissue Mini Kit (Валенсия, Калифорния). РНК (0,5 или 1 мкг) подвергали обратной транскрипции в кДНК с использованием набора для синтеза кДНК iScript от Bio-Rad. Праймеры для ПЦР, используемые в анализе ПЦР в реальном времени, перечислены в .Анализы проводили на термоциклере Bio-Rad iCycler iQ. Образцы анализировали в реакциях объемом 30 мкл с использованием SYBR Green PCR Master Mix (Bio-Rad). Все уровни экспрессии были нормализованы к соответствующим уровням мРНК 36B4 и проанализированы с использованием метода 2 -ΔΔCT . Уровни 36B4 не изменились в ответ на лечение HFD или ниацином.

Таблица 1

Праймеры, используемые для ОТ-ПЦР в реальном времени.

Ген Прямой праймер 5′-3′ Обратный праймер 5′-3′
Адипонектин GGAGAGCCTGGAGAAGCC АТГТГГТААГАГААГТАГТАГАГТК
ППАРγ TTATGGAGCCTAAGTTTGAGTTTG АГКАГГТТГТЦТГГАТГТС
C/EBPα GTGGAGACGCAACAGAAGG CAGCGACCCGAAACCATC
СРЭБП-1с AACCTCATCCGCCACCTG GTAGACAACAGCCGCATCC
ERp44 CAGTCCACGAGATTCAGAGTC АГАААГГААГГКАКАГТКАТК
Ero1-Lα TGGAGCCGTGGATGAGTC CCTTGTAGCCTGTGTAGCG
ДсбА-Л ATCACGGAGTATCAGAGCATTC GCAACAGTGGTGGGTAGC
ГЦН-1 GCATCTGCCCTAAGGTCTTC CACTGTCACACTGGTCACTC
CD68 АГГСТАКАГГККТГКТСАГ ГГГКТГГТАГГТТГАТТГТК
CD11c GGAGCAGGTGGCATTGTG GAGCGATGTCCTGTCTTGAG
Ил-1β GCAGCACACATCAACAAG GTTCATCTCGGAGCCTGTAG
ФНО-α CGTGGAACTGGCAGAGAG ГТАГАКАГААГАГГКГТГГТГ
Ил-6 АГЦКАГАГТЦКТТСАГАГАГ GATGGTCTTGGTCCTTAGCC
Ил-10 GCAGTGGAGCAGGTGAAG CGGAGAGAGGTACAAACGAG
Аргиназа-1 TTGGCTTGCTTCGGAACTC ГГАГГАГААГГКГТТГК
Ym1 GCCCACCAGGAAAGTACAC CTTGAGCCACTGAGCCTTC
МРЦ-1 АТТГТГГАГКАГАТГГААГГ GTCGTAGTCAGTGGTGGTTC
36B4 CACTGCTGAACATGCTGAAC CCACAGACAATGCCAGGAC

Иммуноблот-анализ

Прокладки EWAT (∼100 мг) гомогенизировали с помощью ручного гомогенизатора в буфере RIPA [NP40 (1%), дезоксихолат натрия (24.1 мМ), ДСН (0,05%), NaCl (0,81%), Трис (25 мМ, рН 6,8), ЭДТА (1 мМ), дополненный ингибиторами протеазы и фосфатазы] и белковые фракции придатка яичка. Затем на образцах проводили анализ белка DC (Bio-Rad) для определения концентрации белка в каждом образце. Белки (9 мкг) разделяли с помощью SDS-PAGE (10%) и переносили на мембраны PVDF. Мембраны блокировали в 5% обезжиренном сухом молоке в течение 1 часа и инкубировали с первичными антителами в течение 2,75 часов. Мембраны промывали TBS/0.1% Tween-20 три раза и инкубируют со вторичным антителом в течение одного часа, затем трижды промывают TBS/0,1% Tween-20. Блоты проявляли с использованием пленочного процессора Kodak XOMAT 1000A (Rochester, NY).

Статистический анализ

Данные были проанализированы с использованием факторного дисперсионного анализа 2x2x2, а регрессионный анализ был выполнен с использованием программного обеспечения JMP (SAS Institute Inc., Кэри, Северная Каролина). Значимость была установлена ​​ априори при P <0,05. Графики были построены с использованием программного обеспечения GraphPad Prism версии 4.0 (программное обеспечение GraphPad, Ла-Хойя, Калифорния).

Результаты

Влияние HFD и ниацина на метаболические параметры у мышей

HFD увеличил массу тела, вес эпидидимального жирового тела, сывороточную глюкозу и концентрацию инсулина как у диких мышей, так и у мышей HCA 2 -/- (). Ниацин не влиял на массу эпидидимального жирового тела, концентрацию глюкозы в сыворотке крови или концентрацию инсулина (12). Интересно, что ниацин имел тенденцию повышать концентрацию глюкозы в сыворотке у худых мышей WT и HCA 2 -/- , хотя это не достигало статистической значимости.Известно, что ниацин подавляет высвобождение свободных жирных кислот из адипоцитов, что приводит к временному снижению циркулирующих НЭЖК [29], [30]. В текущем исследовании ниацин снижал концентрацию NEFA в сыворотке только у мышей дикого типа, получавших контрольную диету, но неожиданно не вызывал снижения уровня триглицеридов в сыворотке (16).

Таблица 2

Влияние HFD и ниацина на метаболические параметры у мышей.

7 диеты высокого жира7

Ниацин увеличивает анти -воспалительный адипокин, адипонектин

Мы и другие ранее продемонстрировали, что лечение ниацином увеличивает концентрацию адипонектина в сыворотке [10], [31]. Адипонектин представляет собой адипокин, секретируемый преимущественно из жировой ткани, обладающий противовоспалительным, инсулинсенсибилизирующим и кардиопротекторным действием.В текущем исследовании мы обнаружили, что лечение ниацином увеличивало концентрацию адипонектина в сыворотке у мышей WT на HFD на 21%, но не оказывало никакого влияния на мышей WT на контрольной диете () или HCA 2 -/- мышей на контрольной диете или ВЧД (). Увеличение общего адипонектина было частично объяснено тенденцией лечения никотиновой кислотой к увеличению адипонектина с высокой молекулярной массой у мышей WT HFD (4,6 ± 0,4 против 6,3 ± 1,0 мкг / мл).

Затем мы исследовали локальную продукцию адипонектина в жировой ткани придатка яичка и обнаружили, что у мышей WT и HCA 2 -/- на HFD значительно снижена экспрессия гена адипонектина ().Ниацин увеличивал экспрессию гена адипонектина у мышей WT на HFD на 124%. (). Увеличение экспрессии гена адипонектина не наблюдалось у мышей HCA 2 -/- , что указывает на то, что никотиновая кислота увеличивает экспрессию гена адипонектина зависимым образом от HCA 2 -/- и что увеличение концентрации в сыворотке приводит к от увеличения экспрессии генов.

Влияние HFD и ниацина на экспрессию гена адипонектина.

Экспрессия гена адипонектина в EWAT мышей дикого типа (A) или HCA 2 -/- мышей (B).Значения адипонектина нормализовали до 36В4. *** P<0,001 по сравнению с мышами, получавшими носитель в контрольной диете; * P<0,05 по сравнению с мышами на диете с высоким содержанием жиров, получавшей носитель. Данные представлены как среднее значение ± стандартная ошибка среднего и выражены относительно контрольной группы, равной единице. AU , условные единицы.

В соответствии с данными об экспрессии гена адипонектина экспрессия белка адипонектина в эпидидимальных жировых телах была резко снижена у мышей дикого типа на HFD ().Ниацин увеличивал экспрессию белка адипонектина у мышей дикого типа на HFD (1), но не оказывал никакого эффекта на мышей на контрольной диете (3). Интересно, что мыши HCA 2 -/- , по-видимому, были защищены от HFD-индуцированного снижения экспрессии белка адипонектина EWAT (12). Кроме того, ниацин не оказывал влияния на экспрессию белка адипонектина в EWAT мышей HCA 2 -/- в контроле () или HFD ().

Влияние HFD и ниацина на экспрессию белка адипонектина.

Экспрессия белка адипонектина в EWAT мышей дикого типа (A) или HCA 2 -/- мышей (B). 9 мкг белка разделяли с помощью SDS-PAGE и анализировали с помощью иммуноблоттинга.

Опосредованное ниацином повышение уровня адипонектина происходит независимо от изменений экспрессии генов транскрипционных факторов или шаперонов ER в жировой ткани, участвующих в продукции адипонектина

Уровни клеточного и секретируемого адипонектина можно регулировать на уровне транскрипции.Промотор адипонектина содержит сайты связывания для нескольких факторов транскрипции, которые, как было показано, положительно регулируют транскрипцию гена адипонектина, включая γ-рецептор, активируемый пролифератором пероксисом (PPARγ) [32], CCAAT/энхансер-связывающий белок α (C/EBPα) [33], и белок-1c, связывающий регуляторный элемент стерола (SREBP-1c) [34], [35]. Недавние исследования показали, что ниацин увеличивает активность и экспрессию PPARγ [36] и увеличивает экспрессию C/EBPα в жировой ткани [13]. Поскольку мы продемонстрировали, что ниацин увеличивает экспрессию гена адипонектина в эпидидимальном жире мышей WT, получавших HFD, мы исследовали влияние ниацина на эти факторы транскрипции.

Экспрессия гена PPARγ была снижена в эпидидимальном жире мышей WT на HFD. Однако никотиновая кислота не влияла на экспрессию гена PPARγ у мышей дикого типа (14). Неожиданно ниацин увеличил экспрессию гена PPARγ у худых мышей HCA 2 -/- на 39% (). Экспрессия гена C/EBPα была значительно снижена в EWAT у мышей дикого типа, получавших HFD (1), однако ниацин не влиял на экспрессию гена C/EBPα ни в одной группе мышей (12). Промотор адипонектина трансактивируется SREBP-1c, при этом сверхэкспрессия SREBP-1c в адипоцитах 3T3-L1 увеличивает экспрессию гена и белка адипонектина [37].Мы обнаружили, что экспрессия гена SREBP-1c в жировой ткани не зависела от диеты или лечения никотиновой кислотой во всех группах мышей.

Влияние HFD и ниацина на экспрессию генов факторов транскрипции.

Экспрессия гена PPARγ в EWAT мышей дикого типа (A) или HCA 2 -/- мышей (B). Экспрессия гена C/EBPα в EWAT мышей дикого типа (C) или мышей HCA 2 -/- (D). Экспрессия гена SREBP-1c в EWAT мышей дикого типа (E) или мышей HCA 2 -/- (F).Все значения были нормализованы к 36B4. * P<0,05, **P<0,01 по сравнению с мышами на контрольной диете, получавшими носитель. Данные представлены как среднее значение ± стандартная ошибка среднего и выражены относительно контрольной группы, равной единице. AU , условные единицы.

Известно, что шапероны ER ERp44, Ero1-Lα и DsbA-L участвуют в продукции и секреции адипонектина [38]. Чтобы рассмотреть дополнительный механизм, с помощью которого ниацин может повышать концентрацию адипонектина в сыворотке, мы исследовали экспрессию генов ERp44, Ero1-Lα и DsbA-L в эпидидимальной жировой ткани.ERp44 и Ero1-Lα не подвергались значительному влиянию диеты или лечения ниацином у мышей WT или HCA 2 -/- (). Экспрессия DsbA-L в жировой ткани мышей дикого типа была значительно снижена с помощью HFD, а никотиновая кислота имела тенденцию к увеличению ее экспрессии в этой группе мышей, но незначительно (12).

Влияние HFD и ниацина на экспрессию генов шаперонов ER.

Экспрессия гена ERp44 в EWAT мышей дикого типа (A) или HCA 2 -/- мышей (B), экспрессия гена Ero1-Lα в EWAT мышей дикого типа (C) или HCA 2 -/- мышей (D) и экспрессия гена DsbA-L в EWAT мышей дикого типа (E) или HCA 2 -/- мышей (F).Все значения были нормализованы к 36B4. **Р<0,01. Данные представлены как среднее значение ± стандартная ошибка среднего и выражены относительно контрольной группы, равной единице. AU , условные единицы.

Ниацин ослабляет HFD-индуцированное воспаление жировой ткани рецептор-зависимым образом. [17], эндотелиальные клетки сосудов [19], [20] и клетки пигментного эпителия сетчатки [18].Однако до настоящего времени не проводилось исследований противовоспалительных свойств ниацина в жировой ткани

in vivo . Поэтому мы изучили влияние ниацина на воспаление жировой ткани, включая экспрессию цитокинов, участвующих в воспалении и инфильтрации макрофагов. Как и ожидалось, HFD значительно увеличил экспрессию гена MCP-1 в жировой ткани мышей WT и HCA 2 -/- (). Ниацин снижал экспрессию MCP-1 в жировой ткани мышей WT, получавших HFD, но не в какой-либо другой группе мышей (11), демонстрируя новые противовоспалительные эффекты ниацина в жировой ткани.Поскольку МСР-1 играет основную роль в рекрутировании моноцитов и макрофагов в жировую ткань, мы исследовали экспрессию общего маркера моноцитов и макрофагов CD68. Как и ожидалось, HFD значительно увеличивал экспрессию CD68 в жировой ткани, предполагая повышенное присутствие макрофагов в EWAT. Однако ниацин не влиял на экспрессию CD68. Эти результаты свидетельствуют о том, что вместо изменения количества макрофагов, присутствующих в жировой ткани, ниацин может способствовать смещению поляризации макрофагов от М1 (провоспалительного) фенотипа макрофагов к М2 (противовоспалительному) фенотипу.Чтобы решить эту проблему, мы исследовали экспрессию CD11c в жировой ткани, маркера дендритных клеток, который высоко экспрессируется на провоспалительных макрофагах M1, а не на противовоспалительных макрофагах M2. HFD значительно увеличивал экспрессию CD11c в жировой ткани, что указывает на присутствие воспалительных макрофагов, а лечение ниацином значительно снижало экспрессию CD11c в жире мышей дикого типа, получавших HFD.

Влияние HFD и ниацина на маркеры воспаления жировой ткани.

Экспрессия гена MCP-1 в EWAT мышей дикого типа (A) или HCA 2 -/- мышей (B), экспрессия гена CD68 в EWAT мышей дикого типа (C) или HCA 2 -/- мышей (D), И экспрессия гена CD11c в EWAT мышей дикого типа (E) или HCA 2 -/- мышей (F).Все значения были нормализованы к 36B4; *Р<0,05, **Р<0,01, ***Р<0,001. Данные представлены как среднее значение ± стандартная ошибка среднего и выражены относительно контрольной группы, равной единице. AU , условные единицы.

При дальнейшем изучении экспрессии цитокинов в жире мы продемонстрировали, что HFD увеличивает экспрессию генов провоспалительных цитокинов IL-1β и TNF-α в EWAT мышей WT и HCA 2 -/- . Ниацин значительно снижал экспрессию IL-1β в жире мышей дикого типа, получавших HFD (11).Это важно, поскольку IL-1β связан с патогенезом инсулинорезистентности [39]. IL-1β также сильно экспрессируется в воспалительных макрофагах. Снижение IL-1β может свидетельствовать о способности никотиновой кислоты уменьшать присутствие макрофагов M1 в жировой ткани. Ниацин не влиял на экспрессию TNF-α у мышей дикого типа или HCA 2 -/- (), а HFD или ниацин не влияли на экспрессию IL-6 (). ИЛ-10 представляет собой противовоспалительный цитокин, связанный с макрофагами спектра М2.Его экспрессия была значительно увеличена в EWAT у мышей дикого типа и HCA 2 -/- на HFD, и ниацин не оказывал влияния на экспрессию IL-10 ни в одной из групп мышей (12).

Влияние HFD и ниацина на маркеры воспаления жировой ткани.

Экспрессия гена IL-1β в EWAT мышей дикого типа (A) или HCA 2 -/- мышей (B), экспрессия гена TNF-α в EWAT мышей дикого типа (C) или HCA 2 -/- мышей (D) и экспрессия гена IL-6 в EWAT мышей дикого типа (E) или HCA 2 -/- мышей (F).Все значения были нормализованы к 36B4; *Р<0,05, **Р<0,01. Данные представлены как среднее значение ± стандартная ошибка среднего и выражены относительно контрольной группы, равной единице. AU , условные единицы.

Влияние HFD и ниацина на маркеры макрофагов M2.

Экспрессия гена IL-10 в EWAT мышей дикого типа (A) или HCA 2 -/- мышей (B), экспрессия гена аргиназы-1 в EWAT мышей дикого типа (C) или HCA 2 -/- мышей (D), экспрессия гена Ym1 в EWAT мышей дикого типа (E) или HCA 2 -/- мышей (F) и экспрессия гена MRC-1 в EWAT диких мышей мыши -типа (G) или мыши HCA 2 -/- (H).Все значения были нормализованы к 36B4; *Р<0,05, **Р<0,01. Данные представлены как среднее значение ± стандартная ошибка среднего и выражены относительно контрольной группы, равной единице. AU , условные единицы.

Чтобы определить, опосредованы ли противовоспалительные эффекты ниацина в жировой ткани за счет снижения присутствия M1 и увеличения присутствия макрофагов M2, мы исследовали экспрессию маркеров макрофагов M2 в жире. HFD увеличил экспрессию в жировой ткани аргиназы-1, Ym1 и MRC-1, генов, которые в высокой степени экспрессируются в макрофагах M2 (), и неожиданно лечение ниацином снизило экспрессию генов аргиназы-1 и MRC-1 в EWAT диких животных, получавших HFD. -типа мышей, но не влиял на Ym1.CD163, маркер макрофагов М2, не зависел от диеты или лечения никотиновой кислотой ни в одной группе мышей (данные не показаны).

Обсуждение

В настоящее время установлено, что ниацин обладает сосудистыми антиоксидантными и противовоспалительными свойствами, которые могут способствовать улучшению сердечно-сосудистых исходов, независимо от изменений липидного профиля крови [40]. На самом деле Ганджи и др. продемонстрировали, что ниацин напрямую снижает выработку активных форм кислорода эндотелием и последующее окисление ЛПНП в культивируемых эндотелиальных клетках аорты человека [22].Другие показали, что ниацин снижает экспрессию или высвобождение провоспалительных медиаторов, таких как CRP, TNF-α и MCP-1 [14], [17], [23]. Лукасова и др. продемонстрировали, что ниацин ингибирует прогрессирование атеросклеротического заболевания без изменения общего холестерина, холестерина ЛПВП или ТГ через 10 недель у мышей с нулевым рецептором ЛПНП [41]. Авторы также продемонстрировали, что ниацин ингибирует индуцированное MCP-1 привлечение макрофагов к атеросклеротическим бляшкам. Мы и другие продемонстрировали способность ниацина увеличивать выработку адипоцитами и циркулирующие концентрации противовоспалительного цитокина, адипонектина [10], [12], [14], [31].Эти противовоспалительные, независимые от липидов эффекты ниацина могут объяснить некоторые из преимуществ ниацина для здоровья в условиях неизменного липидного профиля крови.

Адипоциты продуцируют ряд адипокинов, которые вносят как положительный, так и отрицательный вклад в системный воспалительный процесс. В жировой ткани худощавых людей адипоциты в целом сохраняют невоспалительный цитокиновый профиль. Однако при ожирении адипоциты гипертрофируются для хранения избытка триглицеридов, и эта гипертрофия связана с нарушением регуляции секреции адипокинов [42].Гипертрофированные адипоциты продуцируют меньше противовоспалительных адипокинов, включая адипонектин, и продуцируют больше провоспалительных цитокинов, таких как TNF-α, что способствует хроническому воспалению, наблюдаемому при ожирении [43], [44]. Механизмы, лежащие в основе HFD-индуцированного снижения продукции адипонектина, включают измененную гормональную среду [42], [45], [46], окислительный стресс [47] и воспаление. Воспаление жировой ткани характеризуется повышенной экспрессией воспалительных цитокинов TNF-α и IL-6.TNF-α оказывает ингибирующее действие на экспрессию адипонектина за счет подавления его промоторной активности [48], а также было показано, что IL-6 ингибирует экспрессию адипонектина в адипоцитах [49]. Из исследований, показавших, что длительное введение никотиновой кислоты повышает уровень адипонектина в сыворотке, только одно выявило возможные механизмы, с помощью которых это происходит [13]. Линке и др. показали, что шестимесячный прием ниацина с пролонгированным высвобождением увеличивает концентрацию адипонектина в сыворотке на 35%, и это сопровождалось 4-кратным увеличением экспрессии мРНК адипонектина в подкожной жировой ткани людей с нарушенной толерантностью к глюкозе [13].Кроме того, Linke et al. продемонстрировали, что экспрессия мРНК PPARγ и C/EBPα также увеличивается в 1,6 и 1,5 раза соответственно в группе, получавшей ниацин. Мы не показали влияния ниацина на экспрессию генов PPARγ или C/EBPα в эпидидимальном жире мышей дикого типа. Однако это не исключает участия PPARγ в способности никотиновой кислоты повышать уровень адипонектина. Изучение активности PPARγ или транслокации в ядро ​​может иметь важное значение для дальнейшего изучения роли PPARγ в механизме действия никотиновой кислоты.В то время как мы показали, что повышенная концентрация мРНК адипонектина и концентрации в сыворотке не были результатом повышенной экспрессии гена PPARγ, другие показали, что in vitro ниацин увеличивает экспрессию мРНК PPARγ [50], [51], индуцирует ядерную экспрессию белка PPARγ и усиливает транскрипционную активность PPARγ [36].

В дополнение к влиянию на экспрессию гена адипонектина агонисты PPARγ могут повышать продукцию и/или секрецию адипонектина за счет изменения экспрессии шаперона ER [52]–[54].Шапероны ER, включая ERp44 и DsbA-L, важны для мультимеризации адипонектина [38], тогда как Ero-1Lα способствует высвобождению адипонектина из адипоцитов [54]. Поэтому мы исследовали, изменялась ли экспрессия шаперона ER при кратковременном введении ниацина, и обнаружили, что экспрессия генов ERp44, Ero1-Lα и DsbA-L не влияла на лечение ниацином. Следовательно, не похоже, чтобы ниацин увеличивал выработку адипонектина посредством какого-либо из механизмов, известных в настоящее время для регуляции адипонектина, которые мы исследовали.

Способность ниацина повышать уровень адипонектина может быть лишь одним из множества противовоспалительных эффектов ниацина в жировой ткани или может быть фактором, способствующим прямым противовоспалительным свойствам ниацина. Адипонектин обладает противовоспалительными свойствами, в том числе способствует поляризации макрофагов от фенотипа M1 к фенотипу M2 [55]. Лечение адипонектином увеличивает экспрессию генов и белков аргиназы-1, Mgl-1 и IL-10 и снижает экспрессию TNF-α и MCP-1 в изолированных мышиных перитонеальных макрофагах [55].Кроме того, адипонектин подавляет активность NF-κB, фактора ядерной транскрипции, участвующего в воспалении жировой ткани, вызванном ожирением [56].

В текущем исследовании мы показали, что введение никотиновой кислоты улучшило воспалительное состояние жировой ткани за счет изменения содержания цитокинов и макрофагов в жировой ткани. Ниацин ослаблял вызванное HFD увеличение MCP-1, IL-1β и CD11c, генов, связанных с воспалительными макрофагами M1. Мы предполагаем, что, поскольку экспрессия общего маркера макрофагов CD68 в жировой ткани не изменялась под действием ниацина, несмотря на снижение экспрессии CD11c, лечение ниацином способствовало смещению поляризации макрофагов от фенотипа M1 к фенотипу M2.Профиль макрофагов жировой ткани важен, поскольку повышенное присутствие макрофагов М1 в жировой ткани было связано с резистентностью к инсулину, связанной с ожирением [57].

Макрофаги М2 существуют вдоль континуума и экспрессируют различные маркеры в зависимости от воздействия микроокружения жировой ткани. В ответ на кормление HFD, несмотря на явное увеличение маркеров макрофагов M1, во многих случаях также наблюдается увеличение маркеров M2 [28], [58], как мы продемонстрировали с IL-10, аргиназой-1, MRC- 1 и Ym1.Интересно, что ниацин не увеличивал экспрессию маркеров М2, как мы предполагали. Другие показали, что HFD увеличивает экспрессию маркеров M2 arginase-1, Ym1 и IL-10 в жировой ткани и что сенсибилизирующая инсулин омега-3 жирная кислота, DHA, еще больше увеличивает эти маркеры M2 [59]. Опосредованное ДГК увеличение аргиназы-1, Ym1 и IL-10 происходило в стромально-васкулярной фракции, а не во фракции адипоцитов жировой ткани [59]. Хотя мы также показали HFD-индуцированное увеличение маркеров M2 аргиназы-1, Ym1 и IL-10, мы обнаружили, что ниацин снижает экспрессию аргиназы-1 и не влияет на экспрессию Ym1 и IL-10 в жировой ткани.Поскольку многие из исследованных нами цитокинов продуцируются как адипоцитами, так и макрофагами (MCP-1, TNF-α, IL-10, IL-1β), в будущем будет важно отделить стромально-васкулярную фракцию от фракции адипоцитов для определить эффекты ниацина в каждом из этих типов клеток. Также важно отметить, что два основных места экспрессии рецептора ниацина находятся на адипоцитах и ​​иммунных клетках, включая макрофаги, что еще раз демонстрирует важность изучения возможных дифференциальных эффектов ниацина в этих двух типах клеток, широко присутствующих в жировой ткани.Первоначально мы были удивлены тем, что ниацин снижал экспрессию маркеров, связанных как с провоспалительными M1 (CD11c, MCP-1, IL-1β), так и с противовоспалительными M2 (аргиназа-1 и MRC-1) макрофагами. Повышенная продукция адипоцитами MCP-1, свободных жирных кислот, мертвых и умирающих адипоцитов, гипоксии, окислительного стресса и стресса ER были идентифицированы как факторы, способствующие инфильтрации макрофагов в жировую ткань [60]. Известно, что свободные жирные кислоты направляют макрофаги М1 и М2 в жировую ткань.Увеличение местных и системных свободных жирных кислот в результате липолиза адипоцитов во время потери веса вызывает рекрутирование макрофагов в жировую ткань [61]. Поскольку ниацин является известным ингибитором липолиза адипоцитов, снижение уровня свободных жирных кислот в сыворотке адипоцитов может потенциально ингибировать рекрутирование макрофагов М1 и М2 в жировую ткань.

Рецептор ниацина в основном экспрессируется в адипоцитах и ​​иммунных клетках, включая макрофаги. Интересно, что экспрессия ниациновых рецепторов на макрофагах увеличивается при лечении провоспалительными стимулами, включая TNF-α, интерферон γ или LPS [62].Неизвестно, экспрессируется ли рецептор ниацина в резидентных противовоспалительных макрофагах М2, присутствующих в жировой ткани худощавых людей. В текущем исследовании мы продемонстрировали противовоспалительное действие ниацина только у мышей дикого типа, получавших HFD, которые демонстрируют повышенное присутствие провоспалительных макрофагов M1 в жировой ткани. Возможно, причина, по которой мы не наблюдали противовоспалительных эффектов ниацина у худых мышей, заключается в том, что ниацин проявляет свои противовоспалительные эффекты путем прямого связывания со своим рецептором на адипоцитах и ​​макрофагах M1, которые поляризованы до воспалительного состояния. которых нет в жировой ткани худощавых людей.

Интересно, что было продемонстрировано благотворное влияние ниацина на биологию адипоцитов [13]. Например, адипоциты, выделенные у людей, получавших ниацин, имели уменьшенный средний и максимальный диаметр и объем по сравнению с контрольными субъектами [13]. Кроме того, в этих адипоцитах также улучшилась чувствительность к инсулину. Хотя мы не исследовали чувствительность к инсулину у наших мышей, есть доказательства того, что лечение ниацином улучшает чувствительность к инсулину в адипоцитах, и наши результаты показывают, что это может быть связано с уменьшением воспаления жировой ткани.Однако клинически было продемонстрировано, что ниацин повышает уровень глюкозы в крови у пациентов с диабетом и без него [3], поэтому влияние ниацина на чувствительность адипоцитов к инсулину, вероятно, не способствует улучшению чувствительности всего организма к инсулину.

Таким образом, результаты текущего исследования показывают, что ниацин уменьшает воспаление жировой ткани за счет снижения содержания провоспалительных цитокинов, хемокинов и макрофагов, а также за счет повышения концентрации адипонектина в сыворотке и жировой ткани.Тем не менее, чтобы полностью выяснить влияние ниацина на воспаление жировой ткани, необходимы количественные исследования с использованием сортировки флуоресцентно-активированных клеток для определения количества и типа макрофагов, присутствующих в жировой ткани. Повышение уровня адипонектина происходило независимо от изменений в экспрессии ключевых факторов транскрипции и шаперонов ER, участвующих в продукции адипонектина. Эти данные подтверждают идею о плейотропных эффектах никотиновой кислоты для улучшения метаболических параметров в тканях-мишенях, а именно в жировой ткани.Кроме того, все эти противовоспалительные эффекты ниацина были потеряны у мышей с нокаутом ниацинового рецептора. Это согласуется с предыдущими сообщениями о том, что рецептор ниацина необходим для обеспечения противовоспалительных свойств ниацина [14], [17], [41]. Кроме того, важно отметить, что положительные эффекты ниацина, наблюдаемые у мышей, получавших HFD, отсутствовали у худых мышей WT. Эти данные свидетельствуют о том, что плейотропное действие ниацина наиболее выражено при метаболической дисфункции, вызванной ожирением.

Ниацин повышает уровень адипонектина и уменьшает воспаление жировой ткани у мышей, получавших диету с высоким содержанием жиров

Введение

Распространенность ожирения в США достигла масштабов эпидемии за последние 30 лет. Ожирение связано с повышенным риском метаболических и сердечно-сосудистых заболеваний (ССЗ), причем ССЗ являются одной из ведущих причин заболеваемости и смертности в США [1]. Чрезмерный липолиз жировой ткани и повышение уровня неэтерифицированных жирных кислот (НЭЖК) в сыворотке крови являются характерными признаками ожирения, которые часто приводят к развитию атерогенной дислипидемии.Атерогенная дислипидемия представляет собой группу метаболических нарушений, характеризующихся умеренно повышенным уровнем холестерина липопротеинов низкой плотности (ХС ЛПНП; 130–159 мг/дл) и триглицеридов (ТГ; >150 мг/дл), небольшими частицами ЛПНП и низким содержанием липопротеинов высокой плотности. холестерина (HDL-C; <35 мг/дл) [2]. Ниацин, клинически используемый в качестве монотерапии, является эффективным фармакологическим вмешательством для лечения атерогенной дислипидемии благодаря его способности уменьшать толщину интимы медии сонных артерий, улучшать функцию эндотелия и снижать заболеваемость и смертность от сердечно-сосудистых заболеваний, предположительно, за счет улучшения характеристик липидов и липопротеинов крови.Наряду с умеренным снижением концентраций циркулирующих липопротеинов очень низкой плотности (ЛПОНП), ХС-ЛПНП, ТГ и липопротеина (а) ниацин является эффективным фармакологическим средством для повышения концентрации ХС-ЛПВП [3]–[6].

Улучшение метаболизма липидов в крови, вызванное никотиновой кислотой, в значительной степени объясняется его хорошо задокументированным влиянием на липолиз жировой ткани и синтез триглицеридов в печени [7]. Ниацин ингибирует липолиз за счет активации ниацинового рецептора (HCA 2 ) в жировой ткани, который временно ингибирует цАМФ/PKA и снижает гидролиз триглицеридов и концентрацию NEFA в сыворотке [8].Однако недавно было продемонстрировано, что влияние ниацина на липиды не зависит от рецептора ниацина и подавления свободных жирных кислот [9].

Становится все более очевидным, что ниацин обладает плейотропными свойствами в дополнение к его известным терапевтическим эффектам на метаболизм липидов. Данные нашей и других групп показывают, что ниацин резко увеличивает концентрацию адипокина, адипонектина в сыворотке, у мужчин с ожирением и метаболическим синдромом [10], [11]. Кроме того, однократная доза ниацина, введенная перорально или посредством внутрибрюшинной инъекции, резко увеличивает концентрацию адипонектина в сыворотке крови у крыс и мышей в течение нескольких минут, и этот эффект зависит от активации рецептора ниацина [12].Другие продемонстрировали, что лечение ниацином приводит к увеличению мРНК адипонектина [13], [14]. Снижение концентрации циркулирующего адипонектина является одним из наиболее многообещающих биомаркеров метаболического синдрома и сердечно-сосудистых заболеваний. Адипонектин обладает инсулинсенсибилизирующими, антиатеросклеротическими и противовоспалительными свойствами; поэтому, по крайней мере, некоторые из преимуществ ниацина для здоровья могут быть связаны с повышением концентрации адипонектина в сыворотке.

Совсем недавно исследования показали, что никотиновая кислота оказывает противовоспалительное действие в ряде тканей, включая почки [15], легкие [16], адипоциты 3T3-L1 [14], моноциты [17], клетки пигментного эпителия сетчатки [18]. ] и эндотелиальные клетки сосудов [19], [20].Было показано, что введение ниацина снижает экспрессию MCP-1, TNF-α и IL-6 и активацию NF-κB в почках и легких на моделях грызунов [15], [16]. Кроме того, лечение ниацином снижает индуцированное TNF-α увеличение экспрессии генов и секреции провоспалительных хемокинов MCP-1, фракталкина и RANTES, а также увеличивает мРНК адипонектина в адипоцитах 3T3-L1 [14]. Лечение ниацином подавляет сигнальный путь NF-κB, что приводит к снижению секреции провоспалительных цитокинов и хемокинов TNF-α, IL-6 и MCP-1 в изолированных человеческих моноцитах и ​​клетках пигментного эпителия сетчатки [18], [21].Было продемонстрировано, что ниацин ингибирует воспаление сосудов, уменьшая выработку активных форм кислорода эндотелием и выработку воспалительных цитокинов [22]. Системно ниацин снижает С-реактивный белок и ФНО-α, а также уменьшает воспаление печени за счет уменьшения содержания печеночных макрофагов [23], [24]. Ниацин также ингибирует хемотаксис моноцитов [14]. Многие из этих противовоспалительных свойств ниацина связаны с активацией ниацинового рецептора [17], [18].

Ожирение связано со снижением концентрации адипонектина в плазме и хроническим слабовыраженным воспалением, характеризующимся повышенной экспрессией в жировой ткани провоспалительных хемокинов и цитокинов, таких как MCP-1 [25] и TNF-α [26], а также инфильтрацией М1 (провоспалительных) макрофагов [27], [28].Таким образом, целью настоящего исследования было определить влияние введения никотиновой кислоты на вызванное ожирением воспаление жировой ткани посредством изменений профиля цитокинов и макрофагальной инфильтрации жира с особым акцентом на роль адипонектина.

Материалы и методы

Материалы

Ниацин (никотиновая кислота) был приобретен у Sigma-Aldrich (Сент-Луис, Миссури). Кроличьи поликлональные антитела к адипонектину и GAPDH были получены от Abcam, Inc.(Кембридж, Массачусетс).

Исследования на животных

Тридцать два самца мышей C57BL/6 в возрасте 3–4 недель были приобретены в Charles River Laboratories (Уилмингтон, Массачусетс). Мышей переводили либо на контрольную диету (10% ккал в виде жира; n = 16), либо на диету с высоким содержанием жиров (HFD; 60% ккал в виде жира; n = 16), полученную от Research Diets (Нью-Брансуик, Нью-Джерси) на 11 недель. . После шести недель на контрольной диете или на диете с высоким содержанием жира половина мышей из каждой группы получала ниацин (примерно 200 мг/кг/день), растворенный в питьевой воде или растворителе (воде) в течение четырех недель.Концентрации ниацина были увеличены примерно до 360 мг/кг/день на пятой неделе лечения. После пяти недель обработки носителем или никотиновой кислотой мышей не кормили в течение ночи (12 часов) и умерщвляли обезглавливанием. Цельную кровь собирали и обрабатывали для выделения сыворотки, а ткани мгновенно замораживали в жидком азоте и хранили при -80°C до анализа.

Параллельные исследования проводились на самцах глобальных мышей HCA 2 -/- (рецептор ниацина). Тринадцать мышей HCA 2 -/- были помещены на контрольную диету (7 получали носитель, 6 получали ниацин), а девять мышей HCA 2 -/- были помещены на диету с высоким содержанием жиров (4 получали носитель). ; 5 получили никотиновую кислоту).Начальные HCA 2 -/- пар мышей для разведения были щедрым подарком доктора Стефана Офферманнса (Бад-Наухайм, Германия). Все исследования на животных были одобрены Институциональным комитетом по уходу и использованию животных Обернского университета до их начала, и были приняты максимальные меры для минимизации страданий животных.

Анализ сыворотки

Концентрации общего адипонектина и инсулина в сыворотке измеряли с использованием наборов ELISA от Millipore (Temecula, CA). Концентрации высокомолекулярного (HMW) адипонектина в сыворотке измеряли с использованием набора ELISA от Alpco Diagnostics (Salem, NH).Концентрации глюкозы и триглицеридов в сыворотке измеряли с помощью наборов от Cayman Chemicals (Анн-Арбор, Мичиган). NEFA в сыворотке измеряли с использованием набора от Wako Chemicals (Richmond, VA).

ПЦР в реальном времени

РНК выделяли из белой жировой ткани придатка яичка (EWAT) с использованием мини-набора Qiagen RNeasy Lipid Tissue Mini Kit (Валенсия, Калифорния). РНК (0,5 или 1 мкг) подвергали обратной транскрипции в кДНК с использованием набора для синтеза кДНК iScript от Bio-Rad. Праймеры для ПЦР, используемые в анализе ПЦР в реальном времени, перечислены в .Анализы проводили на термоциклере Bio-Rad iCycler iQ. Образцы анализировали в реакциях объемом 30 мкл с использованием SYBR Green PCR Master Mix (Bio-Rad). Все уровни экспрессии были нормализованы к соответствующим уровням мРНК 36B4 и проанализированы с использованием метода 2 -ΔΔCT . Уровни 36B4 не изменились в ответ на лечение HFD или ниацином.

Таблица 1

Праймеры, используемые для ОТ-ПЦР в реальном времени.

Управление диеты Niacin
Кузов Вес (г) 32.1 ± 1,1 33,3 ± 1,1 45,1 ± 0,8 40030 40.9 ± 1,9 29,5 ± 1,1 31,5 ± 0,9 38,7 ± 1,0 A 38,1 ± 2.5
Эпидидимальный жир Подушка Вес (г) 1.1 ± 0.1 1.2 ± 0.1 2,0 ± 0,2 A A 2,0 ± 0,2 1,0 ± 0,2 1.3 ± 0,1 2,9 ± 0,3 A 2,5 ± 0,2
Глюкоза (мг/дл) 149.5 ± 9,8 192,9 ± 16,5 249,2 ± 15,8 235,7 ± 18,4 157,4 ± 19,2 204,7 ± 8,7 247,5 ± 10,8 239,7 ± 23,4
Инсулин (нг/мл) 0,78 ± 0,3 0,81 ± 0,1 3,5 ± 0,5 2,5 ± 0,8 1,06 ± 0,4 1,57 ± 0,1 2,91 ± 0,4 2,90 ± 0,8
HOMA-IR 0.73 ± 0,29 0,94 ± 0,17 5,42 ± 0,96 3,93 ± 1,30 1,28 ± 0,68 1,98 ± 0,19 4,35 ± 0,44 4,61 ± 1,41
Триглицериды (мг/дл) 77,4 ± 5.3 77,4 ± 5,3 83,4 ± 2,6 88,4 ± 4,7 99,9 ± 664 99,9 ± 69 68,3 ± 2,4 89,2 ± 60064 89,2 ± 6.5 80,4 ± 2.0 89,4 ± 3.0
НЕФА (ммоль) 1.2 ± 0,1 0,1 0,84 ± 0,1 * 0,82 ± 0,0 0,75 ± 0,1 0,83 ± 0,07 0,85 ± 0,08 0,56 ± 0,02 0,67 ± 0,05
Адипонектин (мкг/мл) 14,4 ± 1.0 14,4 ± 1,0 14,4 ± 0,6 14,1 ± 0,7 17,1 ± 0,8 * 11,7 ± 0,5 12,2 ± 0,6 14,1 ± 0,8 15,2 ± 1,4
Высокая МВ Адипонектин (мкг/мл) 4.2 ± 0,5 3,5 ± 0,4 4,6 ± 0,4 6,3 ± 1,0 3.0 ± 0,3 3,7 ± 0,3 3,7 ± 0,3 5,2 ± 0,3 5,2 ± 0,3 A 5,7 ± 0,4
Ген Прямой праймер 5′-3′ Обратный праймер 5′-3′
Адипонектин GGAGAGCCTGGAGAAGCC АТГТГГТААГАГААГТАГТАГАГТК
ППАРγ TTATGGAGCCTAAGTTTGAGTTTG АГКАГГТТГТЦТГГАТГТС
C/EBPα GTGGAGACGCAACAGAAGG CAGCGACCCGAAACCATC
СРЭБП-1с AACCTCATCCGCCACCTG GTAGACAACAGCCGCATCC
ERp44 CAGTCCACGAGATTCAGAGTC АГАААГГААГГКАКАГТКАТК
Ero1-Lα TGGAGCCGTGGATGAGTC CCTTGTAGCCTGTGTAGCG
ДсбА-Л ATCACGGAGTATCAGAGCATTC GCAACAGTGGTGGGTAGC
ГЦН-1 GCATCTGCCCTAAGGTCTTC CACTGTCACACTGGTCACTC
CD68 АГГСТАКАГГККТГКТСАГ ГГГКТГГТАГГТТГАТТГТК
CD11c GGAGCAGGTGGCATTGTG GAGCGATGTCCTGTCTTGAG
Ил-1β GCAGCACACATCAACAAG GTTCATCTCGGAGCCTGTAG
ФНО-α CGTGGAACTGGCAGAGAG ГТАГАКАГААГАГГКГТГГТГ
Ил-6 АГЦКАГАГТЦКТТСАГАГАГ GATGGTCTTGGTCCTTAGCC
Ил-10 GCAGTGGAGCAGGTGAAG CGGAGAGAGGTACAAACGAG
Аргиназа-1 TTGGCTTGCTTCGGAACTC ГГАГГАГААГГКГТТГК
Ym1 GCCCACCAGGAAAGTACAC CTTGAGCCACTGAGCCTTC
МРЦ-1 АТТГТГГАГКАГАТГГААГГ GTCGTAGTCAGTGGTGGTTC
36B4 CACTGCTGAACATGCTGAAC CCACAGACAATGCCAGGAC

Иммуноблот-анализ

Прокладки EWAT (∼100 мг) гомогенизировали с помощью ручного гомогенизатора в буфере RIPA [NP40 (1%), дезоксихолат натрия (24.1 мМ), ДСН (0,05%), NaCl (0,81%), Трис (25 мМ, рН 6,8), ЭДТА (1 мМ), дополненный ингибиторами протеазы и фосфатазы] и белковые фракции придатка яичка. Затем на образцах проводили анализ белка DC (Bio-Rad) для определения концентрации белка в каждом образце. Белки (9 мкг) разделяли с помощью SDS-PAGE (10%) и переносили на мембраны PVDF. Мембраны блокировали в 5% обезжиренном сухом молоке в течение 1 часа и инкубировали с первичными антителами в течение 2,75 часов. Мембраны промывали TBS/0.1% Tween-20 три раза и инкубируют со вторичным антителом в течение одного часа, затем трижды промывают TBS/0,1% Tween-20. Блоты проявляли с использованием пленочного процессора Kodak XOMAT 1000A (Rochester, NY).

Статистический анализ

Данные были проанализированы с использованием факторного дисперсионного анализа 2x2x2, а регрессионный анализ был выполнен с использованием программного обеспечения JMP (SAS Institute Inc., Кэри, Северная Каролина). Значимость была установлена ​​ априори при P <0,05. Графики были построены с использованием программного обеспечения GraphPad Prism версии 4.0 (программное обеспечение GraphPad, Ла-Хойя, Калифорния).

Результаты

Влияние HFD и ниацина на метаболические параметры у мышей

HFD увеличил массу тела, вес эпидидимального жирового тела, сывороточную глюкозу и концентрацию инсулина как у диких мышей, так и у мышей HCA 2 -/- (). Ниацин не влиял на массу эпидидимального жирового тела, концентрацию глюкозы в сыворотке крови или концентрацию инсулина (12). Интересно, что ниацин имел тенденцию повышать концентрацию глюкозы в сыворотке у худых мышей WT и HCA 2 -/- , хотя это не достигало статистической значимости.Известно, что ниацин подавляет высвобождение свободных жирных кислот из адипоцитов, что приводит к временному снижению циркулирующих НЭЖК [29], [30]. В текущем исследовании ниацин снижал концентрацию NEFA в сыворотке только у мышей дикого типа, получавших контрольную диету, но неожиданно не вызывал снижения уровня триглицеридов в сыворотке (16).

Таблица 2

Влияние HFD и ниацина на метаболические параметры у мышей.

7 диеты высокого жира7

Ниацин увеличивает анти -воспалительный адипокин, адипонектин

Мы и другие ранее продемонстрировали, что лечение ниацином увеличивает концентрацию адипонектина в сыворотке [10], [31]. Адипонектин представляет собой адипокин, секретируемый преимущественно из жировой ткани, обладающий противовоспалительным, инсулинсенсибилизирующим и кардиопротекторным действием.В текущем исследовании мы обнаружили, что лечение ниацином увеличивало концентрацию адипонектина в сыворотке у мышей WT на HFD на 21%, но не оказывало никакого влияния на мышей WT на контрольной диете () или HCA 2 -/- мышей на контрольной диете или ВЧД (). Увеличение общего адипонектина было частично объяснено тенденцией лечения никотиновой кислотой к увеличению адипонектина с высокой молекулярной массой у мышей WT HFD (4,6 ± 0,4 против 6,3 ± 1,0 мкг / мл).

Затем мы исследовали локальную продукцию адипонектина в жировой ткани придатка яичка и обнаружили, что у мышей WT и HCA 2 -/- на HFD значительно снижена экспрессия гена адипонектина ().Ниацин увеличивал экспрессию гена адипонектина у мышей WT на HFD на 124%. (). Увеличение экспрессии гена адипонектина не наблюдалось у мышей HCA 2 -/- , что указывает на то, что никотиновая кислота увеличивает экспрессию гена адипонектина в зависимости от HCA 2 -/- и что увеличение концентрации в сыворотке приводит к от увеличения экспрессии генов.

Влияние HFD и ниацина на экспрессию гена адипонектина.

Экспрессия гена адипонектина в EWAT мышей дикого типа (A) или HCA 2 -/- мышей (B).Значения адипонектина нормализовали до 36В4. *** P<0,001 по сравнению с мышами, получавшими носитель в контрольной диете; * P<0,05 по сравнению с мышами на диете с высоким содержанием жиров, получавшей носитель. Данные представлены как среднее значение ± стандартная ошибка среднего и выражены относительно контрольной группы, равной единице. AU , условные единицы.

В соответствии с данными об экспрессии гена адипонектина экспрессия белка адипонектина в эпидидимальных жировых телах была резко снижена у мышей дикого типа на HFD ().Ниацин увеличивал экспрессию белка адипонектина у мышей дикого типа на HFD (1), но не оказывал никакого эффекта на мышей на контрольной диете (3). Интересно, что мыши HCA 2 -/- , по-видимому, были защищены от HFD-индуцированного снижения экспрессии белка адипонектина EWAT (12). Кроме того, ниацин не оказывал влияния на экспрессию белка адипонектина в EWAT мышей HCA 2 -/- в контроле () или HFD ().

Влияние HFD и ниацина на экспрессию белка адипонектина.

Экспрессия белка адипонектина в EWAT мышей дикого типа (A) или HCA 2 -/- мышей (B). 9 мкг белка разделяли с помощью SDS-PAGE и анализировали с помощью иммуноблоттинга.

Опосредованное ниацином повышение уровня адипонектина происходит независимо от изменений экспрессии генов транскрипционных факторов или шаперонов ER в жировой ткани, участвующих в продукции адипонектина

Уровни клеточного и секретируемого адипонектина можно регулировать на уровне транскрипции.Промотор адипонектина содержит сайты связывания для нескольких факторов транскрипции, которые, как было показано, положительно регулируют транскрипцию гена адипонектина, включая γ-рецептор, активируемый пролифератором пероксисом (PPARγ) [32], CCAAT/энхансер-связывающий белок α (C/EBPα) [33], и белок-1c, связывающий регуляторный элемент стерола (SREBP-1c) [34], [35]. Недавние исследования показали, что ниацин увеличивает активность и экспрессию PPARγ [36] и увеличивает экспрессию C/EBPα в жировой ткани [13]. Поскольку мы продемонстрировали, что ниацин увеличивает экспрессию гена адипонектина в эпидидимальном жире мышей WT, получавших HFD, мы исследовали влияние ниацина на эти факторы транскрипции.

Экспрессия гена PPARγ была снижена в эпидидимальном жире мышей WT на HFD. Однако никотиновая кислота не влияла на экспрессию гена PPARγ у мышей дикого типа (14). Неожиданно ниацин увеличил экспрессию гена PPARγ у худых мышей HCA 2 -/- на 39% (). Экспрессия гена C/EBPα была значительно снижена в EWAT у мышей дикого типа, получавших HFD (1), однако ниацин не влиял на экспрессию гена C/EBPα ни в одной группе мышей (12). Промотор адипонектина трансактивируется SREBP-1c, при этом сверхэкспрессия SREBP-1c в адипоцитах 3T3-L1 увеличивает экспрессию гена и белка адипонектина [37].Мы обнаружили, что экспрессия гена SREBP-1c в жировой ткани не зависела от диеты или лечения никотиновой кислотой во всех группах мышей.

Влияние HFD и ниацина на экспрессию генов факторов транскрипции.

Экспрессия гена PPARγ в EWAT мышей дикого типа (A) или HCA 2 -/- мышей (B). Экспрессия гена C/EBPα в EWAT мышей дикого типа (C) или мышей HCA 2 -/- (D). Экспрессия гена SREBP-1c в EWAT мышей дикого типа (E) или мышей HCA 2 -/- (F).Все значения были нормализованы к 36B4. * P<0,05, **P<0,01 по сравнению с мышами на контрольной диете, получавшими носитель. Данные представлены как среднее значение ± стандартная ошибка среднего и выражены относительно контрольной группы, равной единице. AU , условные единицы.

Известно, что шапероны ER ERp44, Ero1-Lα и DsbA-L участвуют в продукции и секреции адипонектина [38]. Чтобы рассмотреть дополнительный механизм, с помощью которого ниацин может повышать концентрацию адипонектина в сыворотке, мы исследовали экспрессию генов ERp44, Ero1-Lα и DsbA-L в эпидидимальной жировой ткани.ERp44 и Ero1-Lα не подвергались значительному влиянию диеты или лечения ниацином у мышей WT или HCA 2 -/- (). Экспрессия DsbA-L в жировой ткани мышей дикого типа была значительно снижена с помощью HFD, а никотиновая кислота имела тенденцию к увеличению ее экспрессии в этой группе мышей, но незначительно (12).

Влияние HFD и ниацина на экспрессию генов шаперонов ER.

Экспрессия гена ERp44 в EWAT мышей дикого типа (A) или HCA 2 -/- мышей (B), экспрессия гена Ero1-Lα в EWAT мышей дикого типа (C) или HCA 2 -/- мышей (D) и экспрессия гена DsbA-L в EWAT мышей дикого типа (E) или HCA 2 -/- мышей (F).Все значения были нормализованы к 36B4. **Р<0,01. Данные представлены как среднее значение ± стандартная ошибка среднего и выражены относительно контрольной группы, равной единице. AU , условные единицы.

Ниацин ослабляет HFD-индуцированное воспаление жировой ткани рецептор-зависимым образом. [17], эндотелиальные клетки сосудов [19], [20] и клетки пигментного эпителия сетчатки [18].Однако до настоящего времени не проводилось исследований противовоспалительных свойств ниацина в жировой ткани

in vivo . Поэтому мы изучили влияние ниацина на воспаление жировой ткани, включая экспрессию цитокинов, участвующих в воспалении и инфильтрации макрофагов. Как и ожидалось, HFD значительно увеличил экспрессию гена MCP-1 в жировой ткани мышей WT и HCA 2 -/- (). Ниацин снижал экспрессию MCP-1 в жировой ткани мышей WT, получавших HFD, но не в какой-либо другой группе мышей (11), демонстрируя новые противовоспалительные эффекты ниацина в жировой ткани.Поскольку МСР-1 играет основную роль в рекрутировании моноцитов и макрофагов в жировую ткань, мы исследовали экспрессию общего маркера моноцитов и макрофагов CD68. Как и ожидалось, HFD значительно увеличивал экспрессию CD68 в жировой ткани, предполагая повышенное присутствие макрофагов в EWAT. Однако ниацин не влиял на экспрессию CD68. Эти результаты свидетельствуют о том, что вместо изменения количества макрофагов, присутствующих в жировой ткани, ниацин может способствовать смещению поляризации макрофагов от М1 (провоспалительного) фенотипа макрофагов к М2 (противовоспалительному) фенотипу.Чтобы решить эту проблему, мы исследовали экспрессию CD11c в жировой ткани, маркера дендритных клеток, который высоко экспрессируется на провоспалительных макрофагах M1, а не на противовоспалительных макрофагах M2. HFD значительно увеличивал экспрессию CD11c в жировой ткани, что указывает на присутствие воспалительных макрофагов, а лечение ниацином значительно снижало экспрессию CD11c в жире мышей дикого типа, получавших HFD.

Влияние HFD и ниацина на маркеры воспаления жировой ткани.

Экспрессия гена MCP-1 в EWAT мышей дикого типа (A) или HCA 2 -/- мышей (B), экспрессия гена CD68 в EWAT мышей дикого типа (C) или HCA 2 -/- мышей (D), И экспрессия гена CD11c в EWAT мышей дикого типа (E) или HCA 2 -/- мышей (F).Все значения были нормализованы к 36B4; *Р<0,05, **Р<0,01, ***Р<0,001. Данные представлены как среднее значение ± стандартная ошибка среднего и выражены относительно контрольной группы, равной единице. AU , условные единицы.

При дальнейшем изучении экспрессии цитокинов в жире мы продемонстрировали, что HFD повышает экспрессию генов провоспалительных цитокинов IL-1β и TNF-α в EWAT мышей WT и HCA 2 -/- . Ниацин значительно снижал экспрессию IL-1β в жире мышей дикого типа, получавших HFD (11).Это важно, поскольку IL-1β связан с патогенезом инсулинорезистентности [39]. IL-1β также сильно экспрессируется в воспалительных макрофагах. Снижение IL-1β может свидетельствовать о способности никотиновой кислоты уменьшать присутствие макрофагов M1 в жировой ткани. Ниацин не влиял на экспрессию TNF-α у мышей дикого типа или HCA 2 -/- (), а HFD или ниацин не влияли на экспрессию IL-6 (). ИЛ-10 представляет собой противовоспалительный цитокин, связанный с макрофагами спектра М2.Его экспрессия была значительно увеличена в EWAT у мышей дикого типа и HCA 2 -/- на HFD, и ниацин не оказывал влияния на экспрессию IL-10 ни в одной из групп мышей (12).

Влияние HFD и ниацина на маркеры воспаления жировой ткани.

Экспрессия гена IL-1β в EWAT мышей дикого типа (A) или HCA 2 -/- мышей (B), экспрессия гена TNF-α в EWAT мышей дикого типа (C) или HCA 2 -/- мышей (D) и экспрессия гена IL-6 в EWAT мышей дикого типа (E) или HCA 2 -/- мышей (F).Все значения были нормализованы к 36B4; *Р<0,05, **Р<0,01. Данные представлены как среднее значение ± стандартная ошибка среднего и выражены относительно контрольной группы, равной единице. AU , условные единицы.

Влияние HFD и ниацина на маркеры макрофагов M2.

Экспрессия гена IL-10 в EWAT мышей дикого типа (A) или HCA 2 -/- мышей (B), экспрессия гена аргиназы-1 в EWAT мышей дикого типа (C) или HCA 2 -/- мышей (D), экспрессия гена Ym1 в EWAT мышей дикого типа (E) или HCA 2 -/- мышей (F) и экспрессия гена MRC-1 в EWAT диких мышей мыши -типа (G) или мыши HCA 2 -/- (H).Все значения были нормализованы к 36B4; *Р<0,05, **Р<0,01. Данные представлены как среднее значение ± стандартная ошибка среднего и выражены относительно контрольной группы, равной единице. AU , условные единицы.

Чтобы определить, опосредованы ли противовоспалительные эффекты ниацина в жировой ткани за счет снижения присутствия M1 и увеличения присутствия макрофагов M2, мы исследовали экспрессию маркеров макрофагов M2 в жире. HFD увеличивал экспрессию в жировой ткани аргиназы-1, Ym1 и MRC-1, генов, которые сильно экспрессируются в макрофагах M2 (), и неожиданно лечение ниацином снижало экспрессию генов аргиназы-1 и MRC-1 в EWAT диких животных, получавших HFD. -типа мышей, но не влиял на Ym1.CD163, маркер макрофагов М2, не зависел от диеты или лечения никотиновой кислотой ни в одной группе мышей (данные не показаны).

Обсуждение

В настоящее время установлено, что ниацин обладает сосудистыми антиоксидантными и противовоспалительными свойствами, которые могут способствовать улучшению сердечно-сосудистых исходов, независимо от изменений липидного профиля крови [40]. На самом деле Ганджи и др. продемонстрировали, что ниацин напрямую снижает выработку активных форм кислорода эндотелием и последующее окисление ЛПНП в культивируемых эндотелиальных клетках аорты человека [22].Другие показали, что ниацин снижает экспрессию или высвобождение провоспалительных медиаторов, таких как CRP, TNF-α и MCP-1 [14], [17], [23]. Лукасова и др. продемонстрировали, что ниацин ингибирует прогрессирование атеросклеротического заболевания без изменения общего холестерина, холестерина ЛПВП или ТГ через 10 недель у мышей с нулевым рецептором ЛПНП [41]. Авторы также продемонстрировали, что ниацин ингибирует индуцированное MCP-1 привлечение макрофагов к атеросклеротическим бляшкам. Мы и другие продемонстрировали способность ниацина увеличивать выработку адипоцитами и циркулирующие концентрации противовоспалительного цитокина, адипонектина [10], [12], [14], [31].Эти противовоспалительные, независимые от липидов эффекты ниацина могут объяснить некоторые из преимуществ ниацина для здоровья в условиях неизменного липидного профиля крови.

Адипоциты продуцируют ряд адипокинов, которые вносят как положительный, так и отрицательный вклад в системный воспалительный процесс. В жировой ткани худощавых людей адипоциты в целом сохраняют невоспалительный цитокиновый профиль. Однако при ожирении адипоциты гипертрофируются для хранения избытка триглицеридов, и эта гипертрофия связана с нарушением регуляции секреции адипокинов [42].Гипертрофированные адипоциты продуцируют меньше противовоспалительных адипокинов, включая адипонектин, и продуцируют больше провоспалительных цитокинов, таких как TNF-α, что способствует хроническому воспалению, наблюдаемому при ожирении [43], [44]. Механизмы, лежащие в основе HFD-индуцированного снижения продукции адипонектина, включают измененную гормональную среду [42], [45], [46], окислительный стресс [47] и воспаление. Воспаление жировой ткани характеризуется повышенной экспрессией воспалительных цитокинов TNF-α и IL-6.TNF-α оказывает ингибирующее действие на экспрессию адипонектина за счет подавления его промоторной активности [48], а также было показано, что IL-6 ингибирует экспрессию адипонектина в адипоцитах [49]. Из исследований, показавших, что длительное введение никотиновой кислоты повышает уровень адипонектина в сыворотке, только одно выявило возможные механизмы, с помощью которых это происходит [13]. Линке и др. показали, что шестимесячный прием ниацина с пролонгированным высвобождением увеличивает концентрацию адипонектина в сыворотке на 35%, и это сопровождалось 4-кратным увеличением экспрессии мРНК адипонектина в подкожной жировой ткани людей с нарушенной толерантностью к глюкозе [13].Кроме того, Linke et al. продемонстрировали, что экспрессия мРНК PPARγ и C/EBPα также увеличивается в 1,6 и 1,5 раза соответственно в группе, получавшей ниацин. Мы не показали влияния ниацина на экспрессию генов PPARγ или C/EBPα в эпидидимальном жире мышей дикого типа. Однако это не исключает участия PPARγ в способности ниацина повышать уровень адипонектина. Изучение активности PPARγ или транслокации в ядро ​​может иметь важное значение для дальнейшего изучения роли PPARγ в механизме действия никотиновой кислоты.В то время как мы показали, что повышенная концентрация мРНК адипонектина и концентрации в сыворотке не были результатом повышенной экспрессии гена PPARγ, другие показали, что in vitro ниацин увеличивает экспрессию мРНК PPARγ [50], [51], индуцирует ядерную экспрессию белка PPARγ и усиливает транскрипционную активность PPARγ [36].

В дополнение к влиянию на экспрессию гена адипонектина агонисты PPARγ могут повышать продукцию и/или секрецию адипонектина за счет изменения экспрессии шаперона ER [52]–[54].Шапероны ER, включая ERp44 и DsbA-L, важны для мультимеризации адипонектина [38], тогда как Ero-1Lα способствует высвобождению адипонектина из адипоцитов [54]. Поэтому мы исследовали, изменялась ли экспрессия шаперона ER при кратковременном введении ниацина, и обнаружили, что экспрессия генов ERp44, Ero1-Lα и DsbA-L не влияла на лечение ниацином. Следовательно, не похоже, чтобы ниацин увеличивал выработку адипонектина посредством какого-либо из механизмов, известных в настоящее время для регуляции адипонектина, которые мы исследовали.

Способность ниацина повышать уровень адипонектина может быть лишь одним из множества противовоспалительных эффектов ниацина в жировой ткани или может быть фактором, способствующим прямым противовоспалительным свойствам ниацина. Адипонектин обладает противовоспалительными свойствами, в том числе способствует поляризации макрофагов от фенотипа M1 к фенотипу M2 [55]. Лечение адипонектином увеличивает экспрессию генов и белков аргиназы-1, Mgl-1 и IL-10 и снижает экспрессию TNF-α и MCP-1 в изолированных мышиных перитонеальных макрофагах [55].Кроме того, адипонектин подавляет активность NF-κB, фактора ядерной транскрипции, участвующего в воспалении жировой ткани, вызванном ожирением [56].

В текущем исследовании мы показали, что введение никотиновой кислоты улучшило воспалительное состояние жировой ткани за счет изменения содержания цитокинов и макрофагов в жировой ткани. Ниацин ослаблял вызванное HFD увеличение MCP-1, IL-1β и CD11c, генов, связанных с воспалительными макрофагами M1. Мы предполагаем, что, поскольку экспрессия общего маркера макрофагов CD68 в жировой ткани не изменялась под действием ниацина, несмотря на снижение экспрессии CD11c, лечение ниацином способствовало смещению поляризации макрофагов от фенотипа M1 к фенотипу M2.Профиль макрофагов жировой ткани важен, поскольку повышенное присутствие макрофагов М1 в жировой ткани было связано с резистентностью к инсулину, связанной с ожирением [57].

Макрофаги М2 существуют вдоль континуума и экспрессируют различные маркеры в зависимости от воздействия микроокружения жировой ткани. В ответ на кормление HFD, несмотря на явное увеличение маркеров макрофагов M1, во многих случаях также наблюдается увеличение маркеров M2 [28], [58], как мы продемонстрировали с IL-10, аргиназой-1, MRC- 1 и Ym1.Интересно, что ниацин не увеличивал экспрессию маркеров М2, как мы предполагали. Другие показали, что HFD увеличивает экспрессию в жировой ткани маркеров M2 аргиназы-1, Ym1 и IL-10 и что сенсибилизирующая инсулин омега-3 жирная кислота, DHA, еще больше увеличивает эти маркеры M2 [59]. Опосредованное ДГК увеличение аргиназы-1, Ym1 и IL-10 происходило в стромально-васкулярной фракции, а не во фракции адипоцитов жировой ткани [59]. Хотя мы также показали HFD-индуцированное увеличение маркеров M2 аргиназы-1, Ym1 и IL-10, мы обнаружили, что ниацин снижает экспрессию аргиназы-1 и не влияет на экспрессию Ym1 и IL-10 в жировой ткани.Поскольку многие из исследованных нами цитокинов продуцируются как адипоцитами, так и макрофагами (MCP-1, TNF-α, IL-10, IL-1β), в будущем будет важно отделить стромально-васкулярную фракцию от фракции адипоцитов для определить эффекты ниацина в каждом из этих типов клеток. Также важно отметить, что два основных места экспрессии рецептора ниацина находятся на адипоцитах и ​​иммунных клетках, включая макрофаги, что еще раз демонстрирует важность изучения возможных дифференциальных эффектов ниацина в этих двух типах клеток, широко присутствующих в жировой ткани.Первоначально мы были удивлены тем, что ниацин снижал экспрессию маркеров, связанных как с провоспалительными M1 (CD11c, MCP-1, IL-1β), так и с противовоспалительными M2 (аргиназа-1 и MRC-1) макрофагами. Повышенная продукция адипоцитами MCP-1, свободных жирных кислот, мертвых и умирающих адипоцитов, гипоксии, окислительного стресса и стресса ER были идентифицированы как факторы, способствующие инфильтрации макрофагов в жировую ткань [60]. Известно, что свободные жирные кислоты направляют макрофаги М1 и М2 в жировую ткань.Увеличение местных и системных свободных жирных кислот в результате липолиза адипоцитов во время потери веса вызывает рекрутирование макрофагов в жировую ткань [61]. Поскольку ниацин является известным ингибитором липолиза адипоцитов, снижение уровня свободных жирных кислот в сыворотке адипоцитов может потенциально ингибировать рекрутирование макрофагов М1 и М2 в жировую ткань.

Рецептор ниацина в основном экспрессируется в адипоцитах и ​​иммунных клетках, включая макрофаги. Интересно, что экспрессия ниациновых рецепторов на макрофагах увеличивается при лечении провоспалительными стимулами, включая TNF-α, интерферон γ или LPS [62].Неизвестно, экспрессируется ли рецептор ниацина в резидентных противовоспалительных макрофагах М2, присутствующих в жировой ткани худощавых людей. В текущем исследовании мы продемонстрировали противовоспалительное действие ниацина только у мышей дикого типа, получавших HFD, которые демонстрируют повышенное присутствие провоспалительных макрофагов M1 в жировой ткани. Возможно, причина, по которой мы не наблюдали противовоспалительных эффектов ниацина у худых мышей, заключается в том, что ниацин проявляет свои противовоспалительные эффекты путем прямого связывания со своим рецептором на адипоцитах и ​​макрофагах M1, которые поляризованы до воспалительного состояния. которых нет в жировой ткани худощавых людей.

Интересно, что было продемонстрировано благотворное влияние ниацина на биологию адипоцитов [13]. Например, адипоциты, выделенные у людей, получавших ниацин, имели уменьшенный средний и максимальный диаметр и объем по сравнению с контрольными субъектами [13]. Кроме того, в этих адипоцитах также улучшилась чувствительность к инсулину. Хотя мы не исследовали чувствительность к инсулину у наших мышей, есть доказательства того, что лечение ниацином улучшает чувствительность к инсулину в адипоцитах, и наши результаты показывают, что это может быть связано с уменьшением воспаления жировой ткани.Однако клинически было продемонстрировано, что ниацин повышает уровень глюкозы в крови у пациентов с диабетом и без него [3], поэтому влияние ниацина на чувствительность адипоцитов к инсулину, вероятно, не способствует улучшению чувствительности всего организма к инсулину.

Таким образом, результаты текущего исследования показывают, что ниацин уменьшает воспаление жировой ткани за счет снижения содержания провоспалительных цитокинов, хемокинов и макрофагов, а также за счет повышения концентрации адипонектина в сыворотке и жировой ткани.Однако для полного выяснения влияния ниацина на воспаление жировой ткани необходимы количественные исследования с использованием флуоресцентно-активированной сортировки клеток для определения количества и типа макрофагов, присутствующих в жировой ткани. Повышение уровня адипонектина происходило независимо от изменений в экспрессии ключевых факторов транскрипции и шаперонов ER, участвующих в продукции адипонектина. Эти данные подтверждают идею о плейотропных эффектах никотиновой кислоты для улучшения метаболических параметров в тканях-мишенях, а именно в жировой ткани.Кроме того, все эти противовоспалительные эффекты ниацина были потеряны у мышей с нокаутом ниацинового рецептора. Это согласуется с предыдущими сообщениями о том, что рецептор ниацина необходим для обеспечения противовоспалительных свойств ниацина [14], [17], [41]. Кроме того, важно отметить, что положительные эффекты ниацина, наблюдаемые у мышей, получавших HFD, отсутствовали у худых мышей WT. Эти данные свидетельствуют о том, что плейотропное действие ниацина наиболее выражено при метаболической дисфункции, вызванной ожирением.

Ниацин повышает уровень адипонектина и уменьшает воспаление жировой ткани у мышей, получавших диету с высоким содержанием жиров

Введение

Распространенность ожирения в США достигла масштабов эпидемии за последние 30 лет. Ожирение связано с повышенным риском метаболических и сердечно-сосудистых заболеваний (ССЗ), причем ССЗ являются одной из ведущих причин заболеваемости и смертности в США [1]. Чрезмерный липолиз жировой ткани и повышение уровня неэтерифицированных жирных кислот (НЭЖК) в сыворотке крови являются характерными признаками ожирения, которые часто приводят к развитию атерогенной дислипидемии.Атерогенная дислипидемия представляет собой группу метаболических нарушений, характеризующихся умеренно повышенным уровнем холестерина липопротеинов низкой плотности (ХС ЛПНП; 130–159 мг/дл) и триглицеридов (ТГ; >150 мг/дл), небольшими частицами ЛПНП и низким содержанием липопротеинов высокой плотности. холестерина (HDL-C; <35 мг/дл) [2]. Ниацин, клинически используемый в качестве монотерапии, является эффективным фармакологическим вмешательством для лечения атерогенной дислипидемии благодаря его способности уменьшать толщину интимы медии сонных артерий, улучшать функцию эндотелия и снижать заболеваемость и смертность от сердечно-сосудистых заболеваний, предположительно, за счет улучшения характеристик липидов и липопротеинов крови.Наряду с умеренным снижением концентраций циркулирующих липопротеинов очень низкой плотности (ЛПОНП), ХС-ЛПНП, ТГ и липопротеина (а) ниацин является эффективным фармакологическим средством для повышения концентрации ХС-ЛПВП [3]–[6].

Улучшение метаболизма липидов в крови, вызванное никотиновой кислотой, в значительной степени объясняется его хорошо задокументированным влиянием на липолиз жировой ткани и синтез триглицеридов в печени [7]. Ниацин ингибирует липолиз за счет активации ниацинового рецептора (HCA 2 ) в жировой ткани, который временно ингибирует цАМФ/PKA и снижает гидролиз триглицеридов и концентрацию NEFA в сыворотке [8].Однако недавно было продемонстрировано, что влияние ниацина на липиды не зависит от рецептора ниацина и подавления свободных жирных кислот [9].

Становится все более очевидным, что ниацин обладает плейотропными свойствами в дополнение к его известным терапевтическим эффектам на метаболизм липидов. Данные нашей и других групп показывают, что ниацин резко увеличивает концентрацию адипокина, адипонектина в сыворотке, у мужчин с ожирением и метаболическим синдромом [10], [11]. Кроме того, однократная доза ниацина, введенная перорально или посредством внутрибрюшинной инъекции, резко увеличивает концентрацию адипонектина в сыворотке крови у крыс и мышей в течение нескольких минут, и этот эффект зависит от активации рецептора ниацина [12].Другие продемонстрировали, что лечение ниацином приводит к увеличению мРНК адипонектина [13], [14]. Снижение концентрации циркулирующего адипонектина является одним из наиболее многообещающих биомаркеров метаболического синдрома и сердечно-сосудистых заболеваний. Адипонектин обладает инсулинсенсибилизирующими, антиатеросклеротическими и противовоспалительными свойствами; поэтому, по крайней мере, некоторые из преимуществ ниацина для здоровья могут быть связаны с повышением концентрации адипонектина в сыворотке.

Совсем недавно исследования показали, что никотиновая кислота оказывает противовоспалительное действие в ряде тканей, включая почки [15], легкие [16], адипоциты 3T3-L1 [14], моноциты [17], клетки пигментного эпителия сетчатки [18]. ] и эндотелиальные клетки сосудов [19], [20].Было показано, что введение ниацина снижает экспрессию MCP-1, TNF-α и IL-6 и активацию NF-κB в почках и легких на моделях грызунов [15], [16]. Кроме того, лечение ниацином снижает вызванное TNF-α увеличение экспрессии генов и секреции провоспалительных хемокинов MCP-1, фракталкина и RANTES, а также увеличивает мРНК адипонектина в адипоцитах 3T3-L1 [14]. Лечение ниацином подавляет сигнальный путь NF-κB, что приводит к снижению секреции провоспалительных цитокинов и хемокинов TNF-α, IL-6 и MCP-1 в изолированных человеческих моноцитах и ​​клетках пигментного эпителия сетчатки [18], [21].Было продемонстрировано, что ниацин ингибирует воспаление сосудов, уменьшая выработку активных форм кислорода эндотелием и выработку воспалительных цитокинов [22]. Системно ниацин снижает С-реактивный белок и ФНО-α, а также уменьшает воспаление печени за счет уменьшения содержания печеночных макрофагов [23], [24]. Ниацин также ингибирует хемотаксис моноцитов [14]. Многие из этих противовоспалительных свойств ниацина связаны с активацией ниацинового рецептора [17], [18].

Ожирение связано со снижением концентрации адипонектина в плазме и хроническим вялотекущим воспалением, характеризующимся повышенной экспрессией в жировой ткани провоспалительных хемокинов и цитокинов, таких как MCP-1 [25] и TNF-α [26], а также инфильтрацией макрофагов M1 (провоспалительных) [27], [28].Таким образом, целью настоящего исследования было определить влияние введения никотиновой кислоты на вызванное ожирением воспаление жировой ткани посредством изменений профиля цитокинов и макрофагальной инфильтрации жира с особым акцентом на роль адипонектина.

Материалы и методы

Материалы

Ниацин (никотиновая кислота) был приобретен у Sigma-Aldrich (Сент-Луис, Миссури). Кроличьи поликлональные антитела к адипонектину и GAPDH были получены от Abcam, Inc.(Кембридж, Массачусетс).

Исследования на животных

Тридцать два самца мышей C57BL/6 в возрасте 3–4 недель были приобретены в Charles River Laboratories (Уилмингтон, Массачусетс). Мышей переводили либо на контрольную диету (10% ккал в виде жира; n = 16), либо на диету с высоким содержанием жиров (HFD; 60% ккал в виде жира; n = 16), полученную от Research Diets (Нью-Брансуик, Нью-Джерси) на 11 недель. . После шести недель на контрольной диете или на диете с высоким содержанием жира половина мышей из каждой группы получала ниацин (примерно 200 мг/кг/день), растворенный в питьевой воде или растворителе (воде) в течение четырех недель.Концентрации ниацина были увеличены примерно до 360 мг/кг/день на пятой неделе лечения. После пяти недель обработки носителем или никотиновой кислотой мышей не кормили в течение ночи (12 часов) и умерщвляли обезглавливанием. Цельную кровь собирали и обрабатывали для выделения сыворотки, а ткани мгновенно замораживали в жидком азоте и хранили при -80°C до анализа.

Параллельные исследования проводились на самцах глобальных мышей HCA 2 -/- (рецептор ниацина). Тринадцать мышей HCA 2 -/- были помещены на контрольную диету (7 получали носитель, 6 получали ниацин), а девять мышей HCA 2 -/- были помещены на диету с высоким содержанием жиров (4 получали носитель). ; 5 получили никотиновую кислоту).Начальные HCA 2 -/- пар мышей для разведения были щедрым подарком доктора Стефана Офферманнса (Бад-Наухайм, Германия). Все исследования на животных были одобрены Институциональным комитетом по уходу и использованию животных Обернского университета до их начала, и были приняты максимальные меры для сведения к минимуму страданий животных.

Анализ сыворотки

Концентрации общего адипонектина и инсулина в сыворотке измеряли с использованием наборов ELISA от Millipore (Temecula, CA). Концентрации высокомолекулярного (HMW) адипонектина в сыворотке измеряли с использованием набора ELISA от Alpco Diagnostics (Salem, NH).Концентрации глюкозы и триглицеридов в сыворотке измеряли с помощью наборов от Cayman Chemicals (Анн-Арбор, Мичиган). NEFA в сыворотке измеряли с использованием набора от Wako Chemicals (Richmond, VA).

ПЦР в реальном времени

РНК выделяли из белой жировой ткани придатка яичка (EWAT) с использованием мини-набора Qiagen RNeasy Lipid Tissue Mini Kit (Валенсия, Калифорния). РНК (0,5 или 1 мкг) подвергали обратной транскрипции в кДНК с использованием набора для синтеза кДНК iScript от Bio-Rad. Праймеры для ПЦР, используемые в анализе ПЦР в реальном времени, перечислены в .Анализы проводили на термоциклере Bio-Rad iCycler iQ. Образцы анализировали в реакциях объемом 30 мкл с использованием SYBR Green PCR Master Mix (Bio-Rad). Все уровни экспрессии нормализовали к соответствующим уровням мРНК 36B4 и анализировали с использованием метода 2 -ΔΔCT . Уровни 36B4 не изменились в ответ на лечение HFD или ниацином.

Таблица 1

Праймеры, используемые для ОТ-ПЦР в реальном времени.

Управление диеты Niacin
Кузов Вес (г) 32.1 ± 1,1 33,3 ± 1,1 45,1 ± 0,8 40030 40.9 ± 1,9 29,5 ± 1,1 31,5 ± 0,9 38,7 ± 1,0 A 38,1 ± 2.5
Эпидидимальный жир Подушка Вес (г) 1.1 ± 0.1 1.2 ± 0.1 2,0 ± 0,2 A A 2,0 ± 0,2 1,0 ± 0,2 1.3 ± 0,1 2,9 ± 0,3 A 2,5 ± 0,2
Глюкоза (мг/дл) 149.5 ± 9,8 192,9 ± 16,5 249,2 ± 15,8 235,7 ± 18,4 157,4 ± 19,2 204,7 ± 8,7 247,5 ± 10,8 239,7 ± 23,4
Инсулин (нг/мл) 0,78 ± 0,3 0,81 ± 0,1 3,5 ± 0,5 2,5 ± 0,8 1,06 ± 0,4 1,57 ± 0,1 2,91 ± 0,4 2,90 ± 0,8
HOMA-IR 0.73 ± 0,29 0,94 ± 0,17 5,42 ± 0,96 3,93 ± 1,30 1,28 ± 0,68 1,98 ± 0,19 4,35 ± 0,44 4,61 ± 1,41
Триглицериды (мг/дл) 77,4 ± 5.3 77,4 ± 5,3 83,4 ± 2,6 88,4 ± 4,7 99,9 ± 664 99,9 ± 69 68,3 ± 2,4 89,2 ± 60064 89,2 ± 6.5 80,4 ± 2.0 89,4 ± 3.0
НЕФА (ммоль) 1.2 ± 0,1 0,1 0,84 ± 0,1 * 0,82 ± 0,0 0,75 ± 0,1 0,83 ± 0,07 0,85 ± 0,08 0,56 ± 0,02 0,67 ± 0,05
Адипонектин (мкг/мл) 14,4 ± 1.0 14,4 ± 1,0 14,4 ± 0,6 14,1 ± 0,7 17,1 ± 0,8 * 11,7 ± 0,5 12,2 ± 0,6 14,1 ± 0,8 15,2 ± 1,4
Высокая МВ Адипонектин (мкг/мл) 4.2 ± 0,5 3,5 ± 0,4 4,6 ± 0,4 6,3 ± 1,0 3.0 ± 0,3 3,7 ± 0,3 3,7 ± 0,3 5,2 ± 0,3 5,2 ± 0,3 A 5,7 ± 0,4
Ген Прямой праймер 5′-3′ Обратный праймер 5′-3′
Адипонектин GGAGAGCCTGGAGAAGCC АТГТГГТААГАГААГТАГТАГАГТК
ППАРγ TTATGGAGCCTAAGTTTGAGTTTG АГКАГГТТГТЦТГГАТГТС
C/EBPα GTGGAGACGCAACAGAAGG CAGCGACCCGAAACCATC
СРЭБП-1с AACCTCATCCGCCACCTG GTAGACAACAGCCGCATCC
ERp44 CAGTCCACGAGATTCAGAGTC АГАААГГААГГКАКАГТКАТК
Ero1-Lα TGGAGCCGTGGATGAGTC CCTTGTAGCCTGTGTAGCG
ДсбА-Л ATCACGGAGTATCAGAGCATTC GCAACAGTGGTGGGTAGC
ГЦН-1 GCATCTGCCCTAAGGTCTTC CACTGTCACACTGGTCACTC
CD68 АГГСТАКАГГККТГКТСАГ ГГГКТГГТАГГТТГАТТГТК
CD11c GGAGCAGGTGGCATTGTG GAGCGATGTCCTGTCTTGAG
Ил-1β GCAGCACACATCAACAAG GTTCATCTCGGAGCCTGTAG
ФНО-α CGTGGAACTGGCAGAGAG ГТАГАКАГААГАГГКГТГГТГ
Ил-6 АГЦКАГАГТЦКТТСАГАГАГ GATGGTCTTGGTCCTTAGCC
Ил-10 GCAGTGGAGCAGGTGAAG CGGAGAGAGGTACAAACGAG
Аргиназа-1 TTGGCTTGCTTCGGAACTC ГГАГГАГААГГКГТТГК
Ym1 GCCCACCAGGAAAGTACAC CTTGAGCCACTGAGCCTTC
МРЦ-1 АТТГТГГАГКАГАТГГААГГ GTCGTAGTCAGTGGTGGTTC
36B4 CACTGCTGAACATGCTGAAC CCACAGACAATGCCAGGAC

Иммуноблот-анализ

Прокладки EWAT (∼100 мг) гомогенизировали с помощью ручного гомогенизатора в буфере RIPA [NP40 (1%), дезоксихолат натрия (24.1 мМ), ДСН (0,05%), NaCl (0,81%), Трис (25 мМ, рН 6,8), ЭДТА (1 мМ), дополненный ингибиторами протеазы и фосфатазы] и белковые фракции придатка яичка. Затем на образцах проводили анализ белка DC (Bio-Rad) для определения концентрации белка в каждом образце. Белки (9 мкг) разделяли с помощью SDS-PAGE (10%) и переносили на мембраны PVDF. Мембраны блокировали в 5% обезжиренном сухом молоке в течение 1 часа и инкубировали с первичными антителами в течение 2,75 часов. Мембраны промывали TBS/0.1% Tween-20 три раза и инкубируют со вторичным антителом в течение одного часа, затем трижды промывают TBS/0,1% Tween-20. Блоты проявляли с использованием пленочного процессора Kodak XOMAT 1000A (Rochester, NY).

Статистический анализ

Данные были проанализированы с использованием факторного дисперсионного анализа 2x2x2, а регрессионный анализ был выполнен с использованием программного обеспечения JMP (SAS Institute Inc., Кэри, Северная Каролина). Значимость была установлена ​​ априори при P <0,05. Графики были построены с использованием программного обеспечения GraphPad Prism версии 4.0 (программное обеспечение GraphPad, Ла-Хойя, Калифорния).

Результаты

Влияние HFD и ниацина на метаболические параметры у мышей

HFD увеличил массу тела, вес эпидидимального жирового тела, сывороточную глюкозу и концентрацию инсулина как у диких мышей, так и у мышей HCA 2 -/- (). Ниацин не влиял на массу эпидидимального жирового тела, концентрацию глюкозы в сыворотке крови или концентрацию инсулина (12). Интересно, что ниацин имел тенденцию повышать концентрацию глюкозы в сыворотке у худых мышей WT и HCA 2 -/- , хотя это не достигало статистической значимости.Известно, что ниацин подавляет высвобождение свободных жирных кислот из адипоцитов, что приводит к временному снижению циркулирующих НЭЖК [29], [30]. В текущем исследовании ниацин снижал концентрацию NEFA в сыворотке только у мышей дикого типа, получавших контрольную диету, но неожиданно не вызывал снижения уровня триглицеридов в сыворотке (16).

Таблица 2

Влияние HFD и ниацина на метаболические параметры у мышей.

7 диеты высокого жира7

Ниацин увеличивает анти -воспалительный адипокин, адипонектин

Мы и другие ранее продемонстрировали, что лечение ниацином увеличивает концентрацию адипонектина в сыворотке [10], [31]. Адипонектин представляет собой адипокин, секретируемый преимущественно из жировой ткани, обладающий противовоспалительным, инсулинсенсибилизирующим и кардиопротекторным действием.В текущем исследовании мы обнаружили, что лечение ниацином увеличивало концентрацию адипонектина в сыворотке у мышей WT на HFD на 21%, но не оказывало никакого влияния на мышей WT на контрольной диете () или HCA 2 -/- мышей на контрольной диете или ВЧД (). Увеличение общего адипонектина было частично объяснено тенденцией лечения никотиновой кислотой к увеличению адипонектина с высокой молекулярной массой у мышей WT HFD (4,6 ± 0,4 против 6,3 ± 1,0 мкг / мл).

Затем мы исследовали локальную продукцию адипонектина в жировой ткани придатка яичка и обнаружили, что у мышей WT и HCA 2 -/- на HFD значительно снижена экспрессия гена адипонектина ().Ниацин увеличивал экспрессию гена адипонектина у мышей WT на HFD на 124%. (). Увеличение экспрессии гена адипонектина не наблюдалось у мышей HCA 2 -/- , что указывает на то, что никотиновая кислота увеличивает экспрессию гена адипонектина зависимым образом от HCA 2 -/- и что увеличение концентрации в сыворотке приводит к от увеличения экспрессии генов.

Влияние HFD и ниацина на экспрессию гена адипонектина.

Экспрессия гена адипонектина в EWAT мышей дикого типа (A) или HCA 2 -/- мышей (B).Значения адипонектина нормализовали до 36В4. *** P<0,001 по сравнению с мышами, получавшими носитель в контрольной диете; * P<0,05 по сравнению с мышами на диете с высоким содержанием жиров, получавшей носитель. Данные представлены как среднее значение ± стандартная ошибка среднего и выражены относительно контрольной группы, равной единице. AU , условные единицы.

В соответствии с данными об экспрессии гена адипонектина экспрессия белка адипонектина в эпидидимальных жировых телах была резко снижена у мышей дикого типа на HFD ().Ниацин увеличивал экспрессию белка адипонектина у мышей дикого типа на HFD (1), но не оказывал никакого эффекта на мышей на контрольной диете (3). Интересно, что мыши HCA 2 -/- , по-видимому, были защищены от HFD-индуцированного снижения экспрессии белка адипонектина EWAT (12). Кроме того, ниацин не оказывал влияния на экспрессию белка адипонектина в EWAT мышей HCA 2 -/- в контроле () или HFD ().

Влияние HFD и ниацина на экспрессию белка адипонектина.

Экспрессия белка адипонектина в EWAT мышей дикого типа (A) или HCA 2 -/- мышей (B). 9 мкг белка разделяли с помощью SDS-PAGE и анализировали с помощью иммуноблоттинга.

Опосредованное ниацином повышение уровня адипонектина происходит независимо от изменений экспрессии генов транскрипционных факторов или шаперонов ER в жировой ткани, участвующих в продукции адипонектина

Уровни клеточного и секретируемого адипонектина можно регулировать на уровне транскрипции.Промотор адипонектина содержит сайты связывания для нескольких факторов транскрипции, которые, как было показано, положительно регулируют транскрипцию гена адипонектина, включая γ-рецептор, активируемый пролифератором пероксисом (PPARγ) [32], CCAAT/энхансер-связывающий белок α (C/EBPα) [33], и белок-1c, связывающий регуляторный элемент стерола (SREBP-1c) [34], [35]. Недавние исследования показали, что ниацин увеличивает активность и экспрессию PPARγ [36] и увеличивает экспрессию C/EBPα в жировой ткани [13]. Поскольку мы продемонстрировали, что ниацин увеличивает экспрессию гена адипонектина в эпидидимальном жире мышей WT, получавших HFD, мы исследовали влияние ниацина на эти факторы транскрипции.

Экспрессия гена PPARγ была снижена в эпидидимальном жире мышей WT на HFD. Однако никотиновая кислота не влияла на экспрессию гена PPARγ у мышей дикого типа (14). Неожиданно ниацин увеличил экспрессию гена PPARγ у худых мышей HCA 2 -/- на 39% (). Экспрессия гена C/EBPα была значительно снижена в EWAT у мышей дикого типа, получавших HFD (1), однако ниацин не влиял на экспрессию гена C/EBPα ни в одной группе мышей (12). Промотор адипонектина трансактивируется SREBP-1c, при этом сверхэкспрессия SREBP-1c в адипоцитах 3T3-L1 увеличивает экспрессию гена и белка адипонектина [37].Мы обнаружили, что экспрессия гена SREBP-1c в жировой ткани не зависела от диеты или лечения никотиновой кислотой во всех группах мышей.

Влияние HFD и ниацина на экспрессию генов факторов транскрипции.

Экспрессия гена PPARγ в EWAT мышей дикого типа (A) или HCA 2 -/- мышей (B). Экспрессия гена C/EBPα в EWAT мышей дикого типа (C) или мышей HCA 2 -/- (D). Экспрессия гена SREBP-1c в EWAT мышей дикого типа (E) или мышей HCA 2 -/- (F).Все значения были нормализованы к 36B4. * P<0,05, **P<0,01 по сравнению с мышами на контрольной диете, получавшими носитель. Данные представлены как среднее значение ± стандартная ошибка среднего и выражены относительно контрольной группы, равной единице. AU , условные единицы.

Известно, что шапероны ER ERp44, Ero1-Lα и DsbA-L участвуют в продукции и секреции адипонектина [38]. Чтобы рассмотреть дополнительный механизм, с помощью которого ниацин может повышать концентрацию адипонектина в сыворотке, мы исследовали экспрессию генов ERp44, Ero1-Lα и DsbA-L в эпидидимальной жировой ткани.ERp44 и Ero1-Lα не подвергались значительному влиянию диеты или лечения ниацином у мышей WT или HCA 2 -/- (). Экспрессия DsbA-L в жировой ткани мышей дикого типа была значительно снижена с помощью HFD, а никотиновая кислота имела тенденцию к увеличению ее экспрессии в этой группе мышей, но незначительно (12).

Влияние HFD и ниацина на экспрессию генов шаперонов ER.

Экспрессия гена ERp44 в EWAT мышей дикого типа (A) или HCA 2 -/- мышей (B), экспрессия гена Ero1-Lα в EWAT мышей дикого типа (C) или HCA 2 -/- мышей (D) и экспрессия гена DsbA-L в EWAT мышей дикого типа (E) или HCA 2 -/- мышей (F).Все значения были нормализованы к 36B4. **Р<0,01. Данные представлены как среднее значение ± стандартная ошибка среднего и выражены относительно контрольной группы, равной единице. AU , условные единицы.

Ниацин ослабляет HFD-индуцированное воспаление жировой ткани рецептор-зависимым образом. [17], эндотелиальные клетки сосудов [19], [20] и клетки пигментного эпителия сетчатки [18].Однако до настоящего времени не проводилось исследований противовоспалительных свойств ниацина в жировой ткани

in vivo . Поэтому мы изучили влияние ниацина на воспаление жировой ткани, включая экспрессию цитокинов, участвующих в воспалении и инфильтрации макрофагов. Как и ожидалось, HFD значительно увеличил экспрессию гена MCP-1 в жировой ткани мышей WT и HCA 2 -/- (). Ниацин снижал экспрессию MCP-1 в жировой ткани мышей WT, получавших HFD, но не в какой-либо другой группе мышей (11), демонстрируя новые противовоспалительные эффекты ниацина в жировой ткани.Поскольку МСР-1 играет основную роль в рекрутировании моноцитов и макрофагов в жировую ткань, мы исследовали экспрессию общего маркера моноцитов и макрофагов CD68. Как и ожидалось, HFD значительно увеличивал экспрессию CD68 в жировой ткани, предполагая повышенное присутствие макрофагов в EWAT. Однако ниацин не влиял на экспрессию CD68. Эти результаты свидетельствуют о том, что вместо изменения количества макрофагов, присутствующих в жировой ткани, ниацин может способствовать смещению поляризации макрофагов от М1 (провоспалительного) фенотипа макрофагов к М2 (противовоспалительному) фенотипу.Чтобы решить эту проблему, мы исследовали экспрессию CD11c в жировой ткани, маркера дендритных клеток, который высоко экспрессируется на провоспалительных макрофагах M1, а не на противовоспалительных макрофагах M2. HFD значительно увеличивал экспрессию CD11c в жировой ткани, что указывает на присутствие воспалительных макрофагов, а лечение ниацином значительно снижало экспрессию CD11c в жире мышей дикого типа, получавших HFD.

Влияние HFD и ниацина на маркеры воспаления жировой ткани.

Экспрессия гена MCP-1 в EWAT мышей дикого типа (A) или HCA 2 -/- мышей (B), экспрессия гена CD68 в EWAT мышей дикого типа (C) или HCA 2 -/- мышей (D), И экспрессия гена CD11c в EWAT мышей дикого типа (E) или HCA 2 -/- мышей (F).Все значения были нормализованы к 36B4; *Р<0,05, **Р<0,01, ***Р<0,001. Данные представлены как среднее значение ± стандартная ошибка среднего и выражены относительно контрольной группы, равной единице. AU , условные единицы.

При дальнейшем изучении экспрессии цитокинов в жире мы продемонстрировали, что HFD повышает экспрессию генов провоспалительных цитокинов IL-1β и TNF-α в EWAT мышей WT и HCA 2 -/- . Ниацин значительно снижал экспрессию IL-1β в жире мышей дикого типа, получавших HFD (11).Это важно, поскольку IL-1β связан с патогенезом инсулинорезистентности [39]. IL-1β также сильно экспрессируется в воспалительных макрофагах. Снижение IL-1β может свидетельствовать о способности никотиновой кислоты уменьшать присутствие макрофагов M1 в жировой ткани. Ниацин не влиял на экспрессию TNF-α у мышей дикого типа или HCA 2 -/- (), а HFD или ниацин не влияли на экспрессию IL-6 (). ИЛ-10 представляет собой противовоспалительный цитокин, связанный с макрофагами спектра М2.Его экспрессия была значительно увеличена в EWAT у мышей дикого типа и HCA 2 -/- на HFD, и ниацин не оказывал влияния на экспрессию IL-10 ни в одной из групп мышей (12).

Влияние HFD и ниацина на маркеры воспаления жировой ткани.

Экспрессия гена IL-1β в EWAT мышей дикого типа (A) или HCA 2 -/- мышей (B), экспрессия гена TNF-α в EWAT мышей дикого типа (C) или HCA 2 -/- мышей (D) и экспрессия гена IL-6 в EWAT мышей дикого типа (E) или HCA 2 -/- мышей (F).Все значения были нормализованы к 36B4; *Р<0,05, **Р<0,01. Данные представлены как среднее значение ± стандартная ошибка среднего и выражены относительно контрольной группы, равной единице. AU , условные единицы.

Влияние HFD и ниацина на маркеры макрофагов M2.

Экспрессия гена IL-10 в EWAT мышей дикого типа (A) или HCA 2 -/- мышей (B), экспрессия гена аргиназы-1 в EWAT мышей дикого типа (C) или HCA 2 -/- мышей (D), экспрессия гена Ym1 в EWAT мышей дикого типа (E) или HCA 2 -/- мышей (F) и экспрессия гена MRC-1 в EWAT диких мышей мыши -типа (G) или мыши HCA 2 -/- (H).Все значения были нормализованы к 36B4; *Р<0,05, **Р<0,01. Данные представлены как среднее значение ± стандартная ошибка среднего и выражены относительно контрольной группы, равной единице. AU , условные единицы.

Чтобы определить, опосредованы ли противовоспалительные эффекты ниацина в жировой ткани за счет снижения присутствия M1 и увеличения присутствия макрофагов M2, мы исследовали экспрессию маркеров макрофагов M2 в жире. HFD увеличил экспрессию в жировой ткани аргиназы-1, Ym1 и MRC-1, генов, которые в высокой степени экспрессируются в макрофагах M2 (), и неожиданно лечение ниацином снизило экспрессию генов аргиназы-1 и MRC-1 в EWAT диких животных, получавших HFD. -типа мышей, но не влиял на Ym1.CD163, маркер макрофагов М2, не зависел от диеты или лечения никотиновой кислотой ни в одной группе мышей (данные не показаны).

Обсуждение

В настоящее время установлено, что ниацин обладает сосудистыми антиоксидантными и противовоспалительными свойствами, которые могут способствовать улучшению сердечно-сосудистых исходов, независимо от изменений липидного профиля крови [40]. На самом деле Ганджи и др. продемонстрировали, что ниацин напрямую снижает выработку активных форм кислорода эндотелием и последующее окисление ЛПНП в культивируемых эндотелиальных клетках аорты человека [22].Другие показали, что ниацин снижает экспрессию или высвобождение провоспалительных медиаторов, таких как CRP, TNF-α и MCP-1 [14], [17], [23]. Лукасова и др. продемонстрировали, что ниацин ингибирует прогрессирование атеросклеротического заболевания без изменения общего холестерина, холестерина ЛПВП или ТГ через 10 недель у мышей с нулевым рецептором ЛПНП [41]. Авторы также продемонстрировали, что ниацин ингибирует индуцированное MCP-1 привлечение макрофагов к атеросклеротическим бляшкам. Мы и другие продемонстрировали способность ниацина увеличивать выработку адипоцитами и циркулирующие концентрации противовоспалительного цитокина, адипонектина [10], [12], [14], [31].Эти противовоспалительные, независимые от липидов эффекты ниацина могут объяснить некоторые из преимуществ ниацина для здоровья в условиях неизменного липидного профиля крови.

Адипоциты продуцируют ряд адипокинов, которые вносят как положительный, так и отрицательный вклад в системный воспалительный процесс. В жировой ткани худощавых людей адипоциты в целом сохраняют невоспалительный цитокиновый профиль. Однако при ожирении адипоциты гипертрофируются для хранения избытка триглицеридов, и эта гипертрофия связана с нарушением регуляции секреции адипокинов [42].Гипертрофированные адипоциты продуцируют меньше противовоспалительных адипокинов, включая адипонектин, и продуцируют больше провоспалительных цитокинов, таких как TNF-α, что способствует хроническому воспалению, наблюдаемому при ожирении [43], [44]. Механизмы, лежащие в основе HFD-индуцированного снижения продукции адипонектина, включают измененную гормональную среду [42], [45], [46], окислительный стресс [47] и воспаление. Воспаление жировой ткани характеризуется повышенной экспрессией воспалительных цитокинов TNF-α и IL-6.TNF-α оказывает ингибирующее действие на экспрессию адипонектина за счет подавления его промоторной активности [48], а также было показано, что IL-6 ингибирует экспрессию адипонектина в адипоцитах [49]. Из исследований, показавших, что длительное введение никотиновой кислоты повышает уровень адипонектина в сыворотке, только одно выявило возможные механизмы, с помощью которых это происходит [13]. Линке и др. показали, что шестимесячный прием ниацина с пролонгированным высвобождением увеличивает концентрацию адипонектина в сыворотке на 35%, и это сопровождалось 4-кратным увеличением экспрессии мРНК адипонектина в подкожной жировой ткани людей с нарушенной толерантностью к глюкозе [13].Кроме того, Linke et al. продемонстрировали, что экспрессия мРНК PPARγ и C/EBPα также увеличивается в 1,6 и 1,5 раза соответственно в группе, получавшей ниацин. Мы не показали влияния ниацина на экспрессию генов PPARγ или C/EBPα в эпидидимальном жире мышей дикого типа. Однако это не исключает участия PPARγ в способности ниацина повышать уровень адипонектина. Изучение активности PPARγ или транслокации в ядро ​​может иметь важное значение для дальнейшего изучения роли PPARγ в механизме действия никотиновой кислоты.В то время как мы показали, что повышенная концентрация мРНК адипонектина и концентрации в сыворотке не были результатом повышенной экспрессии гена PPARγ, другие показали, что in vitro ниацин увеличивает экспрессию мРНК PPARγ [50], [51], индуцирует ядерную экспрессию белка PPARγ и усиливает транскрипционную активность PPARγ [36].

В дополнение к влиянию на экспрессию гена адипонектина агонисты PPARγ могут повышать продукцию и/или секрецию адипонектина за счет изменения экспрессии шаперона ER [52]–[54].Шапероны ER, включая ERp44 и DsbA-L, важны для мультимеризации адипонектина [38], тогда как Ero-1Lα способствует высвобождению адипонектина из адипоцитов [54]. Поэтому мы исследовали, изменялась ли экспрессия шаперона ER при кратковременном введении ниацина, и обнаружили, что экспрессия генов ERp44, Ero1-Lα и DsbA-L не влияла на лечение ниацином. Следовательно, не похоже, чтобы ниацин увеличивал выработку адипонектина посредством какого-либо из механизмов, известных в настоящее время для регуляции адипонектина, которые мы исследовали.

Способность ниацина повышать уровень адипонектина может быть лишь одним из множества противовоспалительных эффектов ниацина в жировой ткани или может быть фактором, способствующим прямым противовоспалительным свойствам ниацина. Адипонектин обладает противовоспалительными свойствами, в том числе способствует поляризации макрофагов от фенотипа M1 к фенотипу M2 [55]. Лечение адипонектином увеличивает экспрессию генов и белков аргиназы-1, Mgl-1 и IL-10 и снижает экспрессию TNF-α и MCP-1 в изолированных мышиных перитонеальных макрофагах [55].Кроме того, адипонектин подавляет активность NF-κB, фактора ядерной транскрипции, участвующего в воспалении жировой ткани, вызванном ожирением [56].

В текущем исследовании мы показали, что введение никотиновой кислоты улучшило воспалительное состояние жировой ткани за счет изменения содержания цитокинов и макрофагов в жировой ткани. Ниацин ослаблял вызванное HFD увеличение MCP-1, IL-1β и CD11c, генов, связанных с воспалительными макрофагами M1. Мы предполагаем, что, поскольку экспрессия общего маркера макрофагов CD68 в жировой ткани не изменялась под действием ниацина, несмотря на снижение экспрессии CD11c, лечение ниацином способствовало смещению поляризации макрофагов от фенотипа M1 к фенотипу M2.Профиль макрофагов жировой ткани важен, поскольку повышенное присутствие макрофагов М1 в жировой ткани было связано с резистентностью к инсулину, связанной с ожирением [57].

Макрофаги М2 существуют вдоль континуума и экспрессируют различные маркеры в зависимости от воздействия микроокружения жировой ткани. В ответ на кормление HFD, несмотря на явное увеличение маркеров макрофагов M1, во многих случаях также наблюдается увеличение маркеров M2 [28], [58], как мы продемонстрировали с IL-10, аргиназой-1, MRC- 1 и Ym1.Интересно, что ниацин не увеличивал экспрессию маркеров М2, как мы предполагали. Другие показали, что HFD увеличивает экспрессию маркеров M2 arginase-1, Ym1 и IL-10 в жировой ткани и что сенсибилизирующая инсулин омега-3 жирная кислота, DHA, еще больше увеличивает эти маркеры M2 [59]. Опосредованное ДГК увеличение аргиназы-1, Ym1 и IL-10 происходило в стромально-васкулярной фракции, а не во фракции адипоцитов жировой ткани [59]. Хотя мы также показали HFD-индуцированное увеличение маркеров M2 аргиназы-1, Ym1 и IL-10, мы обнаружили, что ниацин снижает экспрессию аргиназы-1 и не влияет на экспрессию Ym1 и IL-10 в жировой ткани.Поскольку многие из исследованных нами цитокинов продуцируются как адипоцитами, так и макрофагами (MCP-1, TNF-α, IL-10, IL-1β), в будущем будет важно отделить стромально-васкулярную фракцию от фракции адипоцитов для определить эффекты ниацина в каждом из этих типов клеток. Также важно отметить, что два основных места экспрессии рецептора ниацина находятся на адипоцитах и ​​иммунных клетках, включая макрофаги, что еще раз демонстрирует важность изучения возможных дифференциальных эффектов ниацина в этих двух типах клеток, широко присутствующих в жировой ткани.Первоначально мы были удивлены тем, что ниацин снижал экспрессию маркеров, связанных как с провоспалительными M1 (CD11c, MCP-1, IL-1β), так и с противовоспалительными M2 (аргиназа-1 и MRC-1) макрофагами. Повышенная продукция адипоцитами MCP-1, свободных жирных кислот, мертвых и умирающих адипоцитов, гипоксии, окислительного стресса и стресса ER были идентифицированы как факторы, способствующие инфильтрации макрофагов в жировую ткань [60]. Известно, что свободные жирные кислоты направляют макрофаги М1 и М2 в жировую ткань.Увеличение местных и системных свободных жирных кислот в результате липолиза адипоцитов во время потери веса вызывает рекрутирование макрофагов в жировую ткань [61]. Поскольку ниацин является известным ингибитором липолиза адипоцитов, снижение уровня свободных жирных кислот в сыворотке адипоцитов может потенциально ингибировать рекрутирование макрофагов М1 и М2 в жировую ткань.

Рецептор ниацина в основном экспрессируется в адипоцитах и ​​иммунных клетках, включая макрофаги. Интересно, что экспрессия ниациновых рецепторов на макрофагах увеличивается при лечении провоспалительными стимулами, включая TNF-α, интерферон γ или LPS [62].Неизвестно, экспрессируется ли рецептор ниацина в резидентных противовоспалительных макрофагах М2, присутствующих в жировой ткани худощавых людей. В текущем исследовании мы продемонстрировали противовоспалительное действие ниацина только у мышей дикого типа, получавших HFD, которые демонстрируют повышенное присутствие провоспалительных макрофагов M1 в жировой ткани. Возможно, причина, по которой мы не наблюдали противовоспалительных эффектов ниацина у худых мышей, заключается в том, что ниацин проявляет свои противовоспалительные эффекты путем прямого связывания со своим рецептором на адипоцитах и ​​макрофагах M1, которые поляризованы до воспалительного состояния. которых нет в жировой ткани худощавых людей.

Интересно, что было продемонстрировано благотворное влияние ниацина на биологию адипоцитов [13]. Например, адипоциты, выделенные у людей, получавших ниацин, имели уменьшенный средний и максимальный диаметр и объем по сравнению с контрольными субъектами [13]. Кроме того, в этих адипоцитах также улучшилась чувствительность к инсулину. Хотя мы не исследовали чувствительность к инсулину у наших мышей, есть доказательства того, что лечение ниацином улучшает чувствительность к инсулину в адипоцитах, и наши результаты показывают, что это может быть связано с уменьшением воспаления жировой ткани.Однако клинически было продемонстрировано, что ниацин повышает уровень глюкозы в крови у пациентов с диабетом и без него [3], поэтому влияние ниацина на чувствительность адипоцитов к инсулину, вероятно, не способствует улучшению чувствительности всего организма к инсулину.

Таким образом, результаты текущего исследования показывают, что ниацин уменьшает воспаление жировой ткани за счет снижения содержания провоспалительных цитокинов, хемокинов и макрофагов, а также за счет повышения концентрации адипонектина в сыворотке и жировой ткани.Тем не менее, чтобы полностью выяснить влияние ниацина на воспаление жировой ткани, необходимы количественные исследования с использованием сортировки флуоресцентно-активированных клеток для определения количества и типа макрофагов, присутствующих в жировой ткани. Повышение уровня адипонектина происходило независимо от изменений в экспрессии ключевых факторов транскрипции и шаперонов ER, участвующих в продукции адипонектина. Эти данные подтверждают идею о плейотропных эффектах никотиновой кислоты для улучшения метаболических параметров в тканях-мишенях, а именно в жировой ткани.Кроме того, все эти противовоспалительные эффекты ниацина были потеряны у мышей с нокаутом ниацинового рецептора. Это согласуется с предыдущими сообщениями о том, что рецептор ниацина необходим для обеспечения противовоспалительных свойств ниацина [14], [17], [41]. Кроме того, важно отметить, что положительные эффекты ниацина, наблюдаемые у мышей, получавших HFD, отсутствовали у худых мышей WT. Эти данные свидетельствуют о том, что плейотропное действие ниацина наиболее выражено при метаболической дисфункции, вызванной ожирением.

Ниацин повышает уровень адипонектина и уменьшает воспаление жировой ткани у мышей, получавших диету с высоким содержанием жиров

Введение

Распространенность ожирения в США достигла масштабов эпидемии за последние 30 лет. Ожирение связано с повышенным риском метаболических и сердечно-сосудистых заболеваний (ССЗ), причем ССЗ являются одной из ведущих причин заболеваемости и смертности в США [1]. Чрезмерный липолиз жировой ткани и повышение уровня неэтерифицированных жирных кислот (НЭЖК) в сыворотке крови являются характерными признаками ожирения, которые часто приводят к развитию атерогенной дислипидемии.Атерогенная дислипидемия представляет собой группу метаболических нарушений, характеризующихся умеренно повышенным уровнем холестерина липопротеинов низкой плотности (ХС ЛПНП; 130–159 мг/дл) и триглицеридов (ТГ; >150 мг/дл), небольшими частицами ЛПНП и низким содержанием липопротеинов высокой плотности. холестерина (HDL-C; <35 мг/дл) [2]. Ниацин, клинически используемый в качестве монотерапии, является эффективным фармакологическим вмешательством для лечения атерогенной дислипидемии благодаря его способности уменьшать толщину интимы медии сонных артерий, улучшать функцию эндотелия и снижать заболеваемость и смертность от сердечно-сосудистых заболеваний, предположительно, за счет улучшения характеристик липидов и липопротеинов крови.Наряду с умеренным снижением концентраций циркулирующих липопротеинов очень низкой плотности (ЛПОНП), ХС-ЛПНП, ТГ и липопротеина (а) ниацин является эффективным фармакологическим средством для повышения концентрации ХС-ЛПВП [3]–[6].

Улучшение метаболизма липидов в крови, вызванное никотиновой кислотой, в значительной степени объясняется его хорошо задокументированным влиянием на липолиз жировой ткани и синтез триглицеридов в печени [7]. Ниацин ингибирует липолиз за счет активации ниацинового рецептора (HCA 2 ) в жировой ткани, который временно ингибирует цАМФ/PKA и снижает гидролиз триглицеридов и концентрацию NEFA в сыворотке [8].Однако недавно было продемонстрировано, что влияние ниацина на липиды не зависит от рецептора ниацина и подавления свободных жирных кислот [9].

Становится все более очевидным, что ниацин обладает плейотропными свойствами в дополнение к его известным терапевтическим эффектам на метаболизм липидов. Данные нашей и других групп показывают, что ниацин резко увеличивает концентрацию адипокина, адипонектина в сыворотке, у мужчин с ожирением и метаболическим синдромом [10], [11]. Кроме того, однократная доза ниацина, введенная перорально или посредством внутрибрюшинной инъекции, резко увеличивает концентрацию адипонектина в сыворотке крови у крыс и мышей в течение нескольких минут, и этот эффект зависит от активации рецептора ниацина [12].Другие продемонстрировали, что лечение ниацином приводит к увеличению мРНК адипонектина [13], [14]. Снижение концентрации циркулирующего адипонектина является одним из наиболее многообещающих биомаркеров метаболического синдрома и сердечно-сосудистых заболеваний. Адипонектин обладает инсулинсенсибилизирующими, антиатеросклеротическими и противовоспалительными свойствами; поэтому, по крайней мере, некоторые из преимуществ ниацина для здоровья могут быть связаны с повышением концентрации адипонектина в сыворотке.

Совсем недавно исследования показали, что никотиновая кислота оказывает противовоспалительное действие в ряде тканей, включая почки [15], легкие [16], адипоциты 3T3-L1 [14], моноциты [17], клетки пигментного эпителия сетчатки [18]. ] и эндотелиальные клетки сосудов [19], [20].Было показано, что введение ниацина снижает экспрессию MCP-1, TNF-α и IL-6 и активацию NF-κB в почках и легких на моделях грызунов [15], [16]. Кроме того, лечение ниацином снижает индуцированное TNF-α увеличение экспрессии генов и секреции провоспалительных хемокинов MCP-1, фракталкина и RANTES, а также увеличивает мРНК адипонектина в адипоцитах 3T3-L1 [14]. Лечение ниацином подавляет сигнальный путь NF-κB, что приводит к снижению секреции провоспалительных цитокинов и хемокинов TNF-α, IL-6 и MCP-1 в изолированных человеческих моноцитах и ​​клетках пигментного эпителия сетчатки [18], [21].Было продемонстрировано, что ниацин ингибирует воспаление сосудов, уменьшая выработку активных форм кислорода эндотелием и выработку воспалительных цитокинов [22]. Системно ниацин снижает С-реактивный белок и ФНО-α, а также уменьшает воспаление печени за счет уменьшения содержания печеночных макрофагов [23], [24]. Ниацин также ингибирует хемотаксис моноцитов [14]. Многие из этих противовоспалительных свойств ниацина связаны с активацией ниацинового рецептора [17], [18].

Ожирение связано со снижением концентрации адипонектина в плазме и хроническим вялотекущим воспалением, характеризующимся повышенной экспрессией в жировой ткани провоспалительных хемокинов и цитокинов, таких как MCP-1 [25] и TNF-α [26], а также инфильтрацией макрофагов M1 (провоспалительных) [27], [28].Таким образом, целью настоящего исследования было определить влияние введения никотиновой кислоты на вызванное ожирением воспаление жировой ткани посредством изменений профиля цитокинов и макрофагальной инфильтрации жира с особым акцентом на роль адипонектина.

Материалы и методы

Материалы

Ниацин (никотиновая кислота) был приобретен у Sigma-Aldrich (Сент-Луис, Миссури). Кроличьи поликлональные антитела к адипонектину и GAPDH были получены от Abcam, Inc.(Кембридж, Массачусетс).

Исследования на животных

Тридцать два самца мышей C57BL/6 в возрасте 3–4 недель были приобретены в Charles River Laboratories (Уилмингтон, Массачусетс). Мышей переводили либо на контрольную диету (10% ккал в виде жира; n = 16), либо на диету с высоким содержанием жиров (HFD; 60% ккал в виде жира; n = 16), полученную от Research Diets (Нью-Брансуик, Нью-Джерси) на 11 недель. . После шести недель на контрольной диете или на диете с высоким содержанием жира половина мышей из каждой группы получала ниацин (примерно 200 мг/кг/день), растворенный в питьевой воде или растворителе (воде) в течение четырех недель.Концентрации ниацина были увеличены примерно до 360 мг/кг/день на пятой неделе лечения. После пяти недель обработки носителем или никотиновой кислотой мышей не кормили в течение ночи (12 часов) и умерщвляли обезглавливанием. Цельную кровь собирали и обрабатывали для выделения сыворотки, а ткани мгновенно замораживали в жидком азоте и хранили при -80°C до анализа.

Параллельные исследования проводились на самцах глобальных мышей HCA 2 -/- (рецептор ниацина). Тринадцать мышей HCA 2 -/- были помещены на контрольную диету (7 получали носитель, 6 получали ниацин), а девять мышей HCA 2 -/- были помещены на диету с высоким содержанием жиров (4 получали носитель). ; 5 получили никотиновую кислоту).Начальные HCA 2 -/- пар мышей для разведения были щедрым подарком доктора Стефана Офферманнса (Бад-Наухайм, Германия). Все исследования на животных были одобрены Институциональным комитетом по уходу и использованию животных Обернского университета до их начала, и были приняты максимальные меры для сведения к минимуму страданий животных.

Анализ сыворотки

Концентрации общего адипонектина и инсулина в сыворотке измеряли с использованием наборов ELISA от Millipore (Temecula, CA). Концентрации высокомолекулярного (HMW) адипонектина в сыворотке измеряли с использованием набора ELISA от Alpco Diagnostics (Salem, NH).Концентрации глюкозы и триглицеридов в сыворотке измеряли с помощью наборов от Cayman Chemicals (Анн-Арбор, Мичиган). NEFA в сыворотке измеряли с использованием набора от Wako Chemicals (Richmond, VA).

ПЦР в реальном времени

РНК выделяли из белой жировой ткани придатка яичка (EWAT) с использованием мини-набора Qiagen RNeasy Lipid Tissue Mini Kit (Валенсия, Калифорния). РНК (0,5 или 1 мкг) подвергали обратной транскрипции в кДНК с использованием набора для синтеза кДНК iScript от Bio-Rad. Праймеры для ПЦР, используемые в анализе ПЦР в реальном времени, перечислены в .Анализы проводили на термоциклере Bio-Rad iCycler iQ. Образцы анализировали в реакциях объемом 30 мкл с использованием SYBR Green PCR Master Mix (Bio-Rad). Все уровни экспрессии нормализовали к соответствующим уровням мРНК 36B4 и анализировали с использованием метода 2 -ΔΔCT . Уровни 36B4 не изменились в ответ на лечение HFD или ниацином.

Таблица 1

Праймеры, используемые для ОТ-ПЦР в реальном времени.

Управление диеты Niacin
Кузов Вес (г) 32.1 ± 1,1 33,3 ± 1,1 45,1 ± 0,8 40030 40.9 ± 1,9 29,5 ± 1,1 31,5 ± 0,9 38,7 ± 1,0 A 38,1 ± 2.5
Эпидидимальный жир Подушка Вес (г) 1.1 ± 0.1 1.2 ± 0.1 2,0 ± 0,2 A A 2,0 ± 0,2 1,0 ± 0,2 1.3 ± 0,1 2,9 ± 0,3 A 2,5 ± 0,2
Глюкоза (мг/дл) 149.5 ± 9,8 192,9 ± 16,5 249,2 ± 15,8 235,7 ± 18,4 157,4 ± 19,2 204,7 ± 8,7 247,5 ± 10,8 239,7 ± 23,4
Инсулин (нг/мл) 0,78 ± 0,3 0,81 ± 0,1 3,5 ± 0,5 2,5 ± 0,8 1,06 ± 0,4 1,57 ± 0,1 2,91 ± 0,4 2,90 ± 0,8
HOMA-IR 0.73 ± 0,29 0,94 ± 0,17 5,42 ± 0,96 3,93 ± 1,30 1,28 ± 0,68 1,98 ± 0,19 4,35 ± 0,44 4,61 ± 1,41
Триглицериды (мг/дл) 77,4 ± 5.3 77,4 ± 5,3 83,4 ± 2,6 88,4 ± 4,7 99,9 ± 664 99,9 ± 69 68,3 ± 2,4 89,2 ± 60064 89,2 ± 6.5 80,4 ± 2.0 89,4 ± 3.0
НЕФА (ммоль) 1.2 ± 0,1 0,1 0,84 ± 0,1 * 0,82 ± 0,0 0,75 ± 0,1 0,83 ± 0,07 0,85 ± 0,08 0,56 ± 0,02 0,67 ± 0,05
Адипонектин (мкг/мл) 14,4 ± 1.0 14,4 ± 1,0 14,4 ± 0,6 14,1 ± 0,7 17,1 ± 0,8 * 11,7 ± 0,5 12,2 ± 0,6 14,1 ± 0,8 15,2 ± 1,4
Высокая МВ Адипонектин (мкг/мл) 4.2 ± 0,5 3,5 ± 0,4 4,6 ± 0,4 6,3 ± 1,0 3.0 ± 0,3 3,7 ± 0,3 3,7 ± 0,3 5,2 ± 0,3 5,2 ± 0,3 A 5,7 ± 0,4
Ген Прямой праймер 5′-3′ Обратный праймер 5′-3′
Адипонектин GGAGAGCCTGGAGAAGCC АТГТГГТААГАГААГТАГТАГАГТК
ППАРγ TTATGGAGCCTAAGTTTGAGTTTG АГКАГГТТГТЦТГГАТГТС
C/EBPα GTGGAGACGCAACAGAAGG CAGCGACCCGAAACCATC
СРЭБП-1с AACCTCATCCGCCACCTG GTAGACAACAGCCGCATCC
ERp44 CAGTCCACGAGATTCAGAGTC АГАААГГААГГКАКАГТКАТК
Ero1-Lα TGGAGCCGTGGATGAGTC CCTTGTAGCCTGTGTAGCG
ДсбА-Л ATCACGGAGTATCAGAGCATTC GCAACAGTGGTGGGTAGC
ГЦН-1 GCATCTGCCCTAAGGTCTTC CACTGTCACACTGGTCACTC
CD68 АГГСТАКАГГККТГКТСАГ ГГГКТГГТАГГТТГАТТГТК
CD11c GGAGCAGGTGGCATTGTG GAGCGATGTCCTGTCTTGAG
Ил-1β GCAGCACACATCAACAAG GTTCATCTCGGAGCCTGTAG
ФНО-α CGTGGAACTGGCAGAGAG ГТАГАКАГААГАГГКГТГГТГ
Ил-6 АГЦКАГАГТЦКТТСАГАГАГ GATGGTCTTGGTCCTTAGCC
Ил-10 GCAGTGGAGCAGGTGAAG CGGAGAGAGGTACAAACGAG
Аргиназа-1 TTGGCTTGCTTCGGAACTC ГГАГГАГААГГКГТТГК
Ym1 GCCCACCAGGAAAGTACAC CTTGAGCCACTGAGCCTTC
МРЦ-1 АТТГТГГАГКАГАТГГААГГ GTCGTAGTCAGTGGTGGTTC
36B4 CACTGCTGAACATGCTGAAC CCACAGACAATGCCAGGAC

Иммуноблот-анализ

Прокладки EWAT (∼100 мг) гомогенизировали с помощью ручного гомогенизатора в буфере RIPA [NP40 (1%), дезоксихолат натрия (24.1 мМ), ДСН (0,05%), NaCl (0,81%), Трис (25 мМ, рН 6,8), ЭДТА (1 мМ), дополненный ингибиторами протеазы и фосфатазы] и белковые фракции придатка яичка. Затем на образцах проводили анализ белка DC (Bio-Rad) для определения концентрации белка в каждом образце. Белки (9 мкг) разделяли с помощью SDS-PAGE (10%) и переносили на мембраны PVDF. Мембраны блокировали в 5% обезжиренном сухом молоке в течение 1 часа и инкубировали с первичными антителами в течение 2,75 часов. Мембраны промывали TBS/0.1% Tween-20 три раза и инкубируют со вторичным антителом в течение одного часа, затем трижды промывают TBS/0,1% Tween-20. Блоты проявляли с использованием пленочного процессора Kodak XOMAT 1000A (Rochester, NY).

Статистический анализ

Данные были проанализированы с использованием факторного дисперсионного анализа 2x2x2, а регрессионный анализ был выполнен с использованием программного обеспечения JMP (SAS Institute Inc., Кэри, Северная Каролина). Значимость была установлена ​​ априори при P <0,05. Графики были построены с использованием программного обеспечения GraphPad Prism версии 4.0 (программное обеспечение GraphPad, Ла-Хойя, Калифорния).

Результаты

Влияние HFD и ниацина на метаболические параметры у мышей

HFD увеличил массу тела, массу эпидидимального жирового тела, сывороточную глюкозу и концентрацию инсулина как у диких мышей, так и у мышей HCA 2 -/- (). Ниацин не влиял на массу эпидидимального жирового тела, концентрацию глюкозы в сыворотке крови или концентрацию инсулина (12). Интересно, что ниацин имел тенденцию повышать концентрацию глюкозы в сыворотке у худых мышей WT и HCA 2 -/- , хотя это не достигало статистической значимости.Известно, что ниацин подавляет высвобождение свободных жирных кислот из адипоцитов, что приводит к временному снижению циркулирующих НЭЖК [29], [30]. В текущем исследовании ниацин снижал концентрацию NEFA в сыворотке только у мышей дикого типа, получавших контрольную диету, но неожиданно не вызывал снижения уровня триглицеридов в сыворотке (16).

Таблица 2

Влияние HFD и ниацина на метаболические параметры у мышей.

7 диеты высокого жира7

Ниацин увеличивает анти -воспалительный адипокин, адипонектин

Мы и другие ранее продемонстрировали, что лечение ниацином увеличивает концентрацию адипонектина в сыворотке [10], [31]. Адипонектин представляет собой адипокин, секретируемый преимущественно из жировой ткани, обладающий противовоспалительным, инсулинсенсибилизирующим и кардиопротекторным действием.В текущем исследовании мы обнаружили, что лечение ниацином увеличивало концентрацию адипонектина в сыворотке у мышей WT на HFD на 21%, но не оказывало никакого влияния на мышей WT на контрольной диете () или HCA 2 -/- мышей на контрольной диете или ВЧД (). Увеличение общего адипонектина было частично объяснено тенденцией лечения никотиновой кислотой к увеличению адипонектина с высокой молекулярной массой у мышей WT HFD (4,6 ± 0,4 против 6,3 ± 1,0 мкг / мл).

Затем мы исследовали локальную продукцию адипонектина в жировой ткани придатка яичка и обнаружили, что у мышей WT и HCA 2 -/- на HFD значительно снижена экспрессия гена адипонектина ().Ниацин увеличивал экспрессию гена адипонектина у мышей WT на HFD на 124%. (). Увеличение экспрессии гена адипонектина не наблюдалось у мышей HCA 2 -/- , что указывает на то, что никотиновая кислота увеличивает экспрессию гена адипонектина зависимым образом от HCA 2 -/- и что увеличение концентрации в сыворотке приводит к от увеличения экспрессии генов.

Влияние HFD и ниацина на экспрессию гена адипонектина.

Экспрессия гена адипонектина в EWAT мышей дикого типа (A) или HCA 2 -/- мышей (B).Значения адипонектина нормализовали до 36В4. *** P<0,001 по сравнению с мышами, получавшими носитель в контрольной диете; * P<0,05 по сравнению с мышами на диете с высоким содержанием жиров, получавшей носитель. Данные представлены как среднее значение ± стандартная ошибка среднего и выражены относительно контрольной группы, равной единице. AU , условные единицы.

В соответствии с данными об экспрессии гена адипонектина экспрессия белка адипонектина в эпидидимальных жировых телах была резко снижена у мышей дикого типа на HFD ().Ниацин увеличивал экспрессию белка адипонектина у мышей дикого типа на HFD (1), но не оказывал никакого эффекта на мышей на контрольной диете (3). Интересно, что мыши HCA 2 -/- , по-видимому, были защищены от HFD-индуцированного снижения экспрессии белка адипонектина EWAT (12). Кроме того, ниацин не оказывал влияния на экспрессию белка адипонектина в EWAT мышей HCA 2 -/- в контроле () или HFD ().

Влияние HFD и ниацина на экспрессию белка адипонектина.

Экспрессия белка адипонектина в EWAT мышей дикого типа (A) или HCA 2 -/- мышей (B). 9 мкг белка разделяли с помощью SDS-PAGE и анализировали с помощью иммуноблоттинга.

Опосредованное ниацином повышение уровня адипонектина происходит независимо от изменений экспрессии генов транскрипционных факторов или шаперонов ER в жировой ткани, участвующих в продукции адипонектина

Уровни клеточного и секретируемого адипонектина можно регулировать на уровне транскрипции.Промотор адипонектина содержит сайты связывания для нескольких факторов транскрипции, которые, как было показано, положительно регулируют транскрипцию гена адипонектина, включая γ-рецептор, активируемый пролифератором пероксисом (PPARγ) [32], CCAAT/энхансер-связывающий белок α (C/EBPα) [33], и белок-1c, связывающий регуляторный элемент стерола (SREBP-1c) [34], [35]. Недавние исследования показали, что ниацин увеличивает активность и экспрессию PPARγ [36] и увеличивает экспрессию C/EBPα в жировой ткани [13]. Поскольку мы продемонстрировали, что ниацин увеличивает экспрессию гена адипонектина в эпидидимальном жире мышей WT, получавших HFD, мы исследовали влияние ниацина на эти факторы транскрипции.

Экспрессия гена PPARγ была снижена в эпидидимальном жире мышей WT на HFD. Однако никотиновая кислота не влияла на экспрессию гена PPARγ у мышей дикого типа (14). Неожиданно ниацин увеличил экспрессию гена PPARγ у худых мышей HCA 2 -/- на 39% (). Экспрессия гена C/EBPα была значительно снижена в EWAT у мышей дикого типа, получавших HFD (1), однако ниацин не влиял на экспрессию гена C/EBPα ни в одной группе мышей (12). Промотор адипонектина трансактивируется SREBP-1c, при этом сверхэкспрессия SREBP-1c в адипоцитах 3T3-L1 увеличивает экспрессию гена и белка адипонектина [37].Мы обнаружили, что экспрессия гена SREBP-1c в жировой ткани не зависела от диеты или лечения никотиновой кислотой во всех группах мышей.

Влияние HFD и ниацина на экспрессию генов факторов транскрипции.

Экспрессия гена PPARγ в EWAT мышей дикого типа (A) или HCA 2 -/- мышей (B). Экспрессия гена C/EBPα в EWAT мышей дикого типа (C) или мышей HCA 2 -/- (D). Экспрессия гена SREBP-1c в EWAT мышей дикого типа (E) или мышей HCA 2 -/- (F).Все значения были нормализованы к 36B4. * P<0,05, **P<0,01 по сравнению с мышами на контрольной диете, получавшими носитель. Данные представлены как среднее значение ± стандартная ошибка среднего и выражены относительно контрольной группы, равной единице. AU , условные единицы.

Известно, что шапероны ER ERp44, Ero1-Lα и DsbA-L участвуют в продукции и секреции адипонектина [38]. Чтобы рассмотреть дополнительный механизм, с помощью которого ниацин может повышать концентрацию адипонектина в сыворотке, мы исследовали экспрессию генов ERp44, Ero1-Lα и DsbA-L в эпидидимальной жировой ткани.ERp44 и Ero1-Lα не подвергались значительному влиянию диеты или лечения ниацином у мышей WT или HCA 2 -/- (). Экспрессия DsbA-L в жировой ткани мышей дикого типа была значительно снижена с помощью HFD, а никотиновая кислота имела тенденцию к увеличению ее экспрессии в этой группе мышей, но незначительно (12).

Влияние HFD и ниацина на экспрессию генов шаперонов ER.

Экспрессия гена ERp44 в EWAT мышей дикого типа (A) или HCA 2 -/- мышей (B), экспрессия гена Ero1-Lα в EWAT мышей дикого типа (C) или HCA 2 -/- мышей (D) и экспрессия гена DsbA-L в EWAT мышей дикого типа (E) или HCA 2 -/- мышей (F).Все значения были нормализованы к 36B4. **Р<0,01. Данные представлены как среднее значение ± стандартная ошибка среднего и выражены относительно контрольной группы, равной единице. AU , условные единицы.

Ниацин ослабляет HFD-индуцированное воспаление жировой ткани рецептор-зависимым образом. [17], эндотелиальные клетки сосудов [19], [20] и клетки пигментного эпителия сетчатки [18].Однако до настоящего времени не проводилось исследований противовоспалительных свойств ниацина в жировой ткани

in vivo . Поэтому мы изучили влияние ниацина на воспаление жировой ткани, включая экспрессию цитокинов, участвующих в воспалении и инфильтрации макрофагов. Как и ожидалось, HFD значительно увеличил экспрессию гена MCP-1 в жировой ткани мышей WT и HCA 2 -/- (). Ниацин снижал экспрессию MCP-1 в жировой ткани мышей WT, получавших HFD, но не в какой-либо другой группе мышей (11), демонстрируя новые противовоспалительные эффекты ниацина в жировой ткани.Поскольку МСР-1 играет основную роль в рекрутировании моноцитов и макрофагов в жировую ткань, мы исследовали экспрессию общего маркера моноцитов и макрофагов CD68. Как и ожидалось, HFD значительно увеличивал экспрессию CD68 в жировой ткани, предполагая повышенное присутствие макрофагов в EWAT. Однако ниацин не влиял на экспрессию CD68. Эти результаты свидетельствуют о том, что вместо изменения количества макрофагов, присутствующих в жировой ткани, ниацин может способствовать смещению поляризации макрофагов от М1 (провоспалительного) фенотипа макрофагов к М2 (противовоспалительному) фенотипу.Чтобы решить эту проблему, мы исследовали экспрессию CD11c в жировой ткани, маркера дендритных клеток, который высоко экспрессируется на провоспалительных макрофагах M1, а не на противовоспалительных макрофагах M2. HFD значительно увеличивал экспрессию CD11c в жировой ткани, что указывает на присутствие воспалительных макрофагов, а лечение ниацином значительно снижало экспрессию CD11c в жире мышей дикого типа, получавших HFD.

Влияние HFD и ниацина на маркеры воспаления жировой ткани.

Экспрессия гена MCP-1 в EWAT мышей дикого типа (A) или HCA 2 -/- мышей (B), экспрессия гена CD68 в EWAT мышей дикого типа (C) или HCA 2 -/- мышей (D), И экспрессия гена CD11c в EWAT мышей дикого типа (E) или HCA 2 -/- мышей (F).Все значения были нормализованы к 36B4; *Р<0,05, **Р<0,01, ***Р<0,001. Данные представлены как среднее значение ± стандартная ошибка среднего и выражены относительно контрольной группы, равной единице. AU , условные единицы.

При дальнейшем изучении экспрессии цитокинов в жире мы продемонстрировали, что HFD повышает экспрессию генов провоспалительных цитокинов IL-1β и TNF-α в EWAT мышей WT и HCA 2 -/- . Ниацин значительно снижал экспрессию IL-1β в жире мышей дикого типа, получавших HFD (11).Это важно, поскольку IL-1β связан с патогенезом инсулинорезистентности [39]. IL-1β также сильно экспрессируется в воспалительных макрофагах. Снижение IL-1β может свидетельствовать о способности никотиновой кислоты уменьшать присутствие макрофагов M1 в жировой ткани. Ниацин не влиял на экспрессию TNF-α у мышей дикого типа или HCA 2 -/- (), а HFD или ниацин не влияли на экспрессию IL-6 (). ИЛ-10 представляет собой противовоспалительный цитокин, связанный с макрофагами спектра М2.Его экспрессия была значительно увеличена в EWAT у мышей дикого типа и HCA 2 -/- на HFD, и ниацин не оказывал влияния на экспрессию IL-10 ни в одной из групп мышей (12).

Влияние HFD и ниацина на маркеры воспаления жировой ткани.

Экспрессия гена IL-1β в EWAT мышей дикого типа (A) или HCA 2 -/- мышей (B), экспрессия гена TNF-α в EWAT мышей дикого типа (C) или HCA 2 -/- мышей (D) и экспрессия гена IL-6 в EWAT мышей дикого типа (E) или HCA 2 -/- мышей (F).Все значения были нормализованы к 36B4; *Р<0,05, **Р<0,01. Данные представлены как среднее значение ± стандартная ошибка среднего и выражены относительно контрольной группы, равной единице. AU , условные единицы.

Влияние HFD и ниацина на маркеры макрофагов M2.

Экспрессия гена IL-10 в EWAT мышей дикого типа (A) или HCA 2 -/- мышей (B), экспрессия гена аргиназы-1 в EWAT мышей дикого типа (C) или HCA 2 -/- мышей (D), экспрессия гена Ym1 в EWAT мышей дикого типа (E) или HCA 2 -/- мышей (F) и экспрессия гена MRC-1 в EWAT диких мышей мыши -типа (G) или мыши HCA 2 -/- (H).Все значения были нормализованы к 36B4; *Р<0,05, **Р<0,01. Данные представлены как среднее значение ± стандартная ошибка среднего и выражены относительно контрольной группы, равной единице. AU , условные единицы.

Чтобы определить, опосредованы ли противовоспалительные эффекты ниацина в жировой ткани за счет снижения присутствия M1 и увеличения присутствия макрофагов M2, мы исследовали экспрессию маркеров макрофагов M2 в жире. HFD увеличил экспрессию в жировой ткани аргиназы-1, Ym1 и MRC-1, генов, которые в высокой степени экспрессируются в макрофагах M2 (), и неожиданно лечение ниацином снизило экспрессию генов аргиназы-1 и MRC-1 в EWAT диких животных, получавших HFD. -типа мышей, но не влиял на Ym1.CD163, маркер макрофагов М2, не зависел от диеты или лечения никотиновой кислотой ни в одной группе мышей (данные не показаны).

Обсуждение

В настоящее время установлено, что ниацин обладает сосудистыми антиоксидантными и противовоспалительными свойствами, которые могут способствовать улучшению сердечно-сосудистых исходов, независимо от изменений липидного профиля крови [40]. На самом деле Ганджи и др. продемонстрировали, что ниацин напрямую снижает выработку активных форм кислорода эндотелием и последующее окисление ЛПНП в культивируемых эндотелиальных клетках аорты человека [22].Другие показали, что ниацин снижает экспрессию или высвобождение провоспалительных медиаторов, таких как CRP, TNF-α и MCP-1 [14], [17], [23]. Лукасова и др. продемонстрировали, что ниацин ингибирует прогрессирование атеросклеротического заболевания без изменения общего холестерина, холестерина ЛПВП или ТГ через 10 недель у мышей с нулевым рецептором ЛПНП [41]. Авторы также продемонстрировали, что ниацин ингибирует индуцированное MCP-1 привлечение макрофагов к атеросклеротическим бляшкам. Мы и другие продемонстрировали способность ниацина увеличивать выработку адипоцитами и циркулирующие концентрации противовоспалительного цитокина, адипонектина [10], [12], [14], [31].Эти противовоспалительные, независимые от липидов эффекты ниацина могут объяснить некоторые из преимуществ ниацина для здоровья в условиях неизменного липидного профиля крови.

Адипоциты продуцируют ряд адипокинов, которые вносят как положительный, так и отрицательный вклад в системный воспалительный процесс. В жировой ткани худощавых людей адипоциты в целом сохраняют невоспалительный цитокиновый профиль. Однако при ожирении адипоциты гипертрофируются для хранения избытка триглицеридов, и эта гипертрофия связана с нарушением регуляции секреции адипокинов [42].Гипертрофированные адипоциты продуцируют меньше противовоспалительных адипокинов, включая адипонектин, и продуцируют больше провоспалительных цитокинов, таких как TNF-α, что способствует хроническому воспалению, наблюдаемому при ожирении [43], [44]. Механизмы, лежащие в основе HFD-индуцированного снижения продукции адипонектина, включают измененную гормональную среду [42], [45], [46], окислительный стресс [47] и воспаление. Воспаление жировой ткани характеризуется повышенной экспрессией воспалительных цитокинов TNF-α и IL-6.TNF-α оказывает ингибирующее действие на экспрессию адипонектина за счет подавления его промоторной активности [48], а также было показано, что IL-6 ингибирует экспрессию адипонектина в адипоцитах [49]. Из исследований, показавших, что длительное введение никотиновой кислоты повышает уровень адипонектина в сыворотке, только одно выявило возможные механизмы, с помощью которых это происходит [13]. Линке и др. показали, что шестимесячный прием ниацина с пролонгированным высвобождением увеличивает концентрацию адипонектина в сыворотке на 35%, и это сопровождалось 4-кратным увеличением экспрессии мРНК адипонектина в подкожной жировой ткани людей с нарушенной толерантностью к глюкозе [13].Кроме того, Linke et al. продемонстрировали, что экспрессия мРНК PPARγ и C/EBPα также увеличивается в 1,6 и 1,5 раза соответственно в группе, получавшей ниацин. Мы не показали влияния ниацина на экспрессию генов PPARγ или C/EBPα в эпидидимальном жире мышей дикого типа. Однако это не исключает участия PPARγ в способности ниацина повышать уровень адипонектина. Изучение активности PPARγ или транслокации в ядро ​​может иметь важное значение для дальнейшего изучения роли PPARγ в механизме действия никотиновой кислоты.В то время как мы показали, что повышенная концентрация мРНК адипонектина и концентрации в сыворотке не были результатом повышенной экспрессии гена PPARγ, другие показали, что in vitro ниацин увеличивает экспрессию мРНК PPARγ [50], [51], индуцирует ядерную экспрессию белка PPARγ и усиливает транскрипционную активность PPARγ [36].

В дополнение к влиянию на экспрессию гена адипонектина агонисты PPARγ могут повышать продукцию и/или секрецию адипонектина за счет изменения экспрессии шаперона ER [52]–[54].Шапероны ER, включая ERp44 и DsbA-L, важны для мультимеризации адипонектина [38], тогда как Ero-1Lα способствует высвобождению адипонектина из адипоцитов [54]. Поэтому мы исследовали, изменялась ли экспрессия шаперона ER при кратковременном введении ниацина, и обнаружили, что экспрессия генов ERp44, Ero1-Lα и DsbA-L не влияла на лечение ниацином. Следовательно, не похоже, чтобы ниацин увеличивал выработку адипонектина посредством какого-либо из механизмов, известных в настоящее время для регуляции адипонектина, которые мы исследовали.

Способность ниацина повышать уровень адипонектина может быть лишь одним из множества противовоспалительных эффектов ниацина в жировой ткани или может быть фактором, способствующим прямым противовоспалительным свойствам ниацина. Адипонектин обладает противовоспалительными свойствами, в том числе способствует поляризации макрофагов от фенотипа M1 к фенотипу M2 [55]. Лечение адипонектином увеличивает экспрессию генов и белков аргиназы-1, Mgl-1 и IL-10 и снижает экспрессию TNF-α и MCP-1 в изолированных мышиных перитонеальных макрофагах [55].Кроме того, адипонектин подавляет активность NF-κB, фактора ядерной транскрипции, участвующего в воспалении жировой ткани, вызванном ожирением [56].

В текущем исследовании мы показали, что введение никотиновой кислоты улучшило воспалительное состояние жировой ткани за счет изменения содержания цитокинов и макрофагов в жировой ткани. Ниацин ослаблял вызванное HFD увеличение MCP-1, IL-1β и CD11c, генов, связанных с воспалительными макрофагами M1. Мы предполагаем, что, поскольку экспрессия общего маркера макрофагов CD68 в жировой ткани не изменялась под действием ниацина, несмотря на снижение экспрессии CD11c, лечение ниацином способствовало смещению поляризации макрофагов от фенотипа M1 к фенотипу M2.Профиль макрофагов жировой ткани важен, поскольку повышенное присутствие макрофагов М1 в жировой ткани было связано с резистентностью к инсулину, связанной с ожирением [57].

Макрофаги М2 существуют вдоль континуума и экспрессируют различные маркеры в зависимости от воздействия микроокружения жировой ткани. В ответ на кормление HFD, несмотря на явное увеличение маркеров макрофагов M1, во многих случаях также наблюдается увеличение маркеров M2 [28], [58], как мы продемонстрировали с IL-10, аргиназой-1, MRC- 1 и Ym1.Интересно, что ниацин не увеличивал экспрессию маркеров М2, как мы предполагали. Другие показали, что HFD увеличивает экспрессию маркеров M2 arginase-1, Ym1 и IL-10 в жировой ткани и что сенсибилизирующая инсулин омега-3 жирная кислота, DHA, еще больше увеличивает эти маркеры M2 [59]. Опосредованное ДГК увеличение аргиназы-1, Ym1 и IL-10 происходило в стромально-васкулярной фракции, а не во фракции адипоцитов жировой ткани [59]. Хотя мы также показали HFD-индуцированное увеличение маркеров M2 аргиназы-1, Ym1 и IL-10, мы обнаружили, что ниацин снижает экспрессию аргиназы-1 и не влияет на экспрессию Ym1 и IL-10 в жировой ткани.Поскольку многие из исследованных нами цитокинов продуцируются как адипоцитами, так и макрофагами (MCP-1, TNF-α, IL-10, IL-1β), в будущем будет важно отделить стромально-васкулярную фракцию от фракции адипоцитов для определить эффекты ниацина в каждом из этих типов клеток. Также важно отметить, что два основных места экспрессии рецептора ниацина находятся на адипоцитах и ​​иммунных клетках, включая макрофаги, что еще раз демонстрирует важность изучения возможных дифференциальных эффектов ниацина в этих двух типах клеток, широко присутствующих в жировой ткани.Первоначально мы были удивлены тем, что ниацин снижал экспрессию маркеров, связанных как с провоспалительными M1 (CD11c, MCP-1, IL-1β), так и с противовоспалительными M2 (аргиназа-1 и MRC-1) макрофагами. Повышенная продукция адипоцитами MCP-1, свободных жирных кислот, мертвых и умирающих адипоцитов, гипоксии, окислительного стресса и стресса ER были идентифицированы как факторы, способствующие инфильтрации макрофагов в жировую ткань [60]. Известно, что свободные жирные кислоты направляют макрофаги М1 и М2 в жировую ткань.Увеличение местных и системных свободных жирных кислот в результате липолиза адипоцитов во время потери веса вызывает рекрутирование макрофагов в жировую ткань [61]. Поскольку ниацин является известным ингибитором липолиза адипоцитов, снижение уровня свободных жирных кислот в сыворотке адипоцитов может потенциально ингибировать рекрутирование макрофагов М1 и М2 в жировую ткань.

Рецептор ниацина в основном экспрессируется в адипоцитах и ​​иммунных клетках, включая макрофаги. Интересно, что экспрессия ниациновых рецепторов на макрофагах увеличивается при лечении провоспалительными стимулами, включая TNF-α, интерферон γ или LPS [62].Неизвестно, экспрессируется ли рецептор ниацина в резидентных противовоспалительных макрофагах М2, присутствующих в жировой ткани худощавых людей. В текущем исследовании мы продемонстрировали противовоспалительное действие ниацина только у мышей дикого типа, получавших HFD, которые демонстрируют повышенное присутствие провоспалительных макрофагов M1 в жировой ткани. Возможно, причина, по которой мы не наблюдали противовоспалительных эффектов ниацина у худых мышей, заключается в том, что ниацин проявляет свои противовоспалительные эффекты путем прямого связывания со своим рецептором на адипоцитах и ​​макрофагах M1, которые поляризованы до воспалительного состояния. которых нет в жировой ткани худощавых людей.

Интересно, что было продемонстрировано благотворное влияние ниацина на биологию адипоцитов [13]. Например, адипоциты, выделенные у людей, получавших ниацин, имели уменьшенный средний и максимальный диаметр и объем по сравнению с контрольными субъектами [13]. Кроме того, в этих адипоцитах также улучшилась чувствительность к инсулину. Хотя мы не исследовали чувствительность к инсулину у наших мышей, есть доказательства того, что лечение ниацином улучшает чувствительность к инсулину в адипоцитах, и наши результаты показывают, что это может быть связано с уменьшением воспаления жировой ткани.Однако клинически было продемонстрировано, что ниацин повышает уровень глюкозы в крови у пациентов с диабетом и без него [3], поэтому влияние ниацина на чувствительность адипоцитов к инсулину, вероятно, не способствует улучшению чувствительности всего организма к инсулину.

Таким образом, результаты текущего исследования показывают, что ниацин уменьшает воспаление жировой ткани за счет снижения содержания провоспалительных цитокинов, хемокинов и макрофагов, а также за счет повышения концентрации адипонектина в сыворотке и жировой ткани.Тем не менее, чтобы полностью выяснить влияние ниацина на воспаление жировой ткани, необходимы количественные исследования с использованием сортировки флуоресцентно-активированных клеток для определения количества и типа макрофагов, присутствующих в жировой ткани. Повышение уровня адипонектина происходило независимо от изменений в экспрессии ключевых факторов транскрипции и шаперонов ER, участвующих в продукции адипонектина. Эти данные подтверждают идею о плейотропных эффектах никотиновой кислоты для улучшения метаболических параметров в тканях-мишенях, а именно в жировой ткани.Кроме того, все эти противовоспалительные эффекты ниацина были потеряны у мышей с нокаутом ниацинового рецептора. Это согласуется с предыдущими сообщениями о том, что рецептор ниацина необходим для обеспечения противовоспалительных свойств ниацина [14], [17], [41]. Кроме того, важно отметить, что положительные эффекты ниацина, наблюдаемые у мышей, получавших HFD, отсутствовали у худых мышей WT. Эти данные свидетельствуют о том, что плейотропное действие ниацина наиболее выражено при метаболической дисфункции, вызванной ожирением.

Ниацин повышает уровень адипонектина и уменьшает воспаление жировой ткани у мышей, получавших диету с высоким содержанием жиров

Введение

Распространенность ожирения в США достигла масштабов эпидемии за последние 30 лет. Ожирение связано с повышенным риском метаболических и сердечно-сосудистых заболеваний (ССЗ), причем ССЗ являются одной из ведущих причин заболеваемости и смертности в США [1]. Чрезмерный липолиз жировой ткани и повышение уровня неэтерифицированных жирных кислот (НЭЖК) в сыворотке крови являются характерными признаками ожирения, которые часто приводят к развитию атерогенной дислипидемии.Атерогенная дислипидемия представляет собой группу метаболических нарушений, характеризующихся умеренно повышенным уровнем холестерина липопротеинов низкой плотности (ХС ЛПНП; 130–159 мг/дл) и триглицеридов (ТГ; >150 мг/дл), небольшими частицами ЛПНП и низким содержанием липопротеинов высокой плотности. холестерина (HDL-C; <35 мг/дл) [2]. Ниацин, клинически используемый в качестве монотерапии, является эффективным фармакологическим вмешательством для лечения атерогенной дислипидемии благодаря его способности уменьшать толщину интимы медии сонных артерий, улучшать функцию эндотелия и снижать заболеваемость и смертность от сердечно-сосудистых заболеваний, предположительно, за счет улучшения характеристик липидов и липопротеинов крови.Наряду с умеренным снижением концентраций циркулирующих липопротеинов очень низкой плотности (ЛПОНП), ХС-ЛПНП, ТГ и липопротеина (а) ниацин является эффективным фармакологическим средством для повышения концентрации ХС-ЛПВП [3]–[6].

Улучшение метаболизма липидов в крови, вызванное никотиновой кислотой, в значительной степени объясняется его хорошо задокументированным влиянием на липолиз жировой ткани и синтез триглицеридов в печени [7]. Ниацин ингибирует липолиз за счет активации ниацинового рецептора (HCA 2 ) в жировой ткани, который временно ингибирует цАМФ/PKA и снижает гидролиз триглицеридов и концентрацию NEFA в сыворотке [8].Однако недавно было продемонстрировано, что влияние ниацина на липиды не зависит от рецептора ниацина и подавления свободных жирных кислот [9].

Становится все более очевидным, что ниацин обладает плейотропными свойствами в дополнение к его известным терапевтическим эффектам на метаболизм липидов. Данные нашей и других групп показывают, что ниацин резко увеличивает концентрацию адипокина, адипонектина в сыворотке, у мужчин с ожирением и метаболическим синдромом [10], [11]. Кроме того, однократная доза ниацина, введенная перорально или посредством внутрибрюшинной инъекции, резко увеличивает концентрацию адипонектина в сыворотке крови у крыс и мышей в течение нескольких минут, и этот эффект зависит от активации рецептора ниацина [12].Другие продемонстрировали, что лечение ниацином приводит к увеличению мРНК адипонектина [13], [14]. Снижение концентрации циркулирующего адипонектина является одним из наиболее многообещающих биомаркеров метаболического синдрома и сердечно-сосудистых заболеваний. Адипонектин обладает инсулинсенсибилизирующими, антиатеросклеротическими и противовоспалительными свойствами; поэтому, по крайней мере, некоторые из преимуществ ниацина для здоровья могут быть связаны с повышением концентрации адипонектина в сыворотке.

Совсем недавно исследования показали, что никотиновая кислота оказывает противовоспалительное действие в ряде тканей, включая почки [15], легкие [16], адипоциты 3T3-L1 [14], моноциты [17], клетки пигментного эпителия сетчатки [18]. ] и эндотелиальные клетки сосудов [19], [20].Было показано, что введение ниацина снижает экспрессию MCP-1, TNF-α и IL-6 и активацию NF-κB в почках и легких на моделях грызунов [15], [16]. Кроме того, лечение ниацином снижает индуцированное TNF-α увеличение экспрессии генов и секреции провоспалительных хемокинов MCP-1, фракталкина и RANTES, а также увеличивает мРНК адипонектина в адипоцитах 3T3-L1 [14]. Лечение ниацином подавляет сигнальный путь NF-κB, что приводит к снижению секреции провоспалительных цитокинов и хемокинов TNF-α, IL-6 и MCP-1 в изолированных человеческих моноцитах и ​​клетках пигментного эпителия сетчатки [18], [21].Было продемонстрировано, что ниацин ингибирует воспаление сосудов, уменьшая выработку активных форм кислорода эндотелием и выработку воспалительных цитокинов [22]. Системно ниацин снижает С-реактивный белок и ФНО-α, а также уменьшает воспаление печени за счет уменьшения содержания печеночных макрофагов [23], [24]. Ниацин также ингибирует хемотаксис моноцитов [14]. Многие из этих противовоспалительных свойств ниацина связаны с активацией ниацинового рецептора [17], [18].

Ожирение связано со снижением концентрации адипонектина в плазме и хроническим вялотекущим воспалением, характеризующимся повышенной экспрессией в жировой ткани провоспалительных хемокинов и цитокинов, таких как MCP-1 [25] и TNF-α [26], а также инфильтрацией макрофагов M1 (провоспалительных) [27], [28].Таким образом, целью настоящего исследования было определить влияние введения никотиновой кислоты на вызванное ожирением воспаление жировой ткани посредством изменений профиля цитокинов и макрофагальной инфильтрации жира с особым акцентом на роль адипонектина.

Материалы и методы

Материалы

Ниацин (никотиновая кислота) был приобретен у Sigma-Aldrich (Сент-Луис, Миссури). Кроличьи поликлональные антитела к адипонектину и GAPDH были получены от Abcam, Inc.(Кембридж, Массачусетс).

Исследования на животных

Тридцать два самца мышей C57BL/6 в возрасте 3–4 недель были приобретены в Charles River Laboratories (Уилмингтон, Массачусетс). Мышей переводили либо на контрольную диету (10% ккал в виде жира; n = 16), либо на диету с высоким содержанием жиров (HFD; 60% ккал в виде жира; n = 16), полученную от Research Diets (Нью-Брансуик, Нью-Джерси) на 11 недель. . После шести недель на контрольной диете или на диете с высоким содержанием жира половина мышей из каждой группы получала ниацин (примерно 200 мг/кг/день), растворенный в питьевой воде или растворителе (воде) в течение четырех недель.Концентрации ниацина были увеличены примерно до 360 мг/кг/день на пятой неделе лечения. После пяти недель обработки носителем или никотиновой кислотой мышей не кормили в течение ночи (12 часов) и умерщвляли обезглавливанием. Цельную кровь собирали и обрабатывали для выделения сыворотки, а ткани мгновенно замораживали в жидком азоте и хранили при -80°C до анализа.

Параллельные исследования проводились на самцах глобальных мышей HCA 2 -/- (рецептор ниацина). Тринадцать мышей HCA 2 -/- были помещены на контрольную диету (7 получали носитель, 6 получали ниацин), а девять мышей HCA 2 -/- были помещены на диету с высоким содержанием жиров (4 получали носитель). ; 5 получили никотиновую кислоту).Начальные HCA 2 -/- пар мышей для разведения были щедрым подарком доктора Стефана Офферманнса (Бад-Наухайм, Германия). Все исследования на животных были одобрены Институциональным комитетом по уходу и использованию животных Обернского университета до их начала, и были приняты максимальные меры для минимизации страданий животных.

Анализ сыворотки

Концентрации общего адипонектина и инсулина в сыворотке измеряли с использованием наборов ELISA от Millipore (Temecula, CA). Концентрации высокомолекулярного (HMW) адипонектина в сыворотке измеряли с использованием набора ELISA от Alpco Diagnostics (Salem, NH).Концентрации глюкозы и триглицеридов в сыворотке измеряли с помощью наборов от Cayman Chemicals (Анн-Арбор, Мичиган). NEFA в сыворотке измеряли с использованием набора от Wako Chemicals (Richmond, VA).

ПЦР в реальном времени

РНК выделяли из белой жировой ткани придатка яичка (EWAT) с использованием мини-набора Qiagen RNeasy Lipid Tissue Mini Kit (Валенсия, Калифорния). РНК (0,5 или 1 мкг) подвергали обратной транскрипции в кДНК с использованием набора для синтеза кДНК iScript от Bio-Rad. Праймеры для ПЦР, используемые в анализе ПЦР в реальном времени, перечислены в .Анализы проводили на термоциклере Bio-Rad iCycler iQ. Образцы анализировали в реакциях объемом 30 мкл с использованием SYBR Green PCR Master Mix (Bio-Rad). Все уровни экспрессии были нормализованы к соответствующим уровням мРНК 36B4 и проанализированы с использованием метода 2 -ΔΔCT . Уровни 36B4 не изменились в ответ на лечение HFD или ниацином.

Таблица 1

Праймеры, используемые для ОТ-ПЦР в реальном времени.

Управление диеты Niacin
Кузов Вес (г) 32.1 ± 1,1 33,3 ± 1,1 45,1 ± 0,8 40030 40.9 ± 1,9 29,5 ± 1,1 31,5 ± 0,9 38,7 ± 1,0 A 38,1 ± 2.5
Эпидидимальный жир Подушка Вес (г) 1.1 ± 0.1 1.2 ± 0.1 2,0 ± 0,2 A A 2,0 ± 0,2 1,0 ± 0,2 1.3 ± 0,1 2,9 ± 0,3 A 2,5 ± 0,2
Глюкоза (мг/дл) 149.5 ± 9,8 192,9 ± 16,5 249,2 ± 15,8 235,7 ± 18,4 157,4 ± 19,2 204,7 ± 8,7 247,5 ± 10,8 239,7 ± 23,4
Инсулин (нг/мл) 0,78 ± 0,3 0,81 ± 0,1 3,5 ± 0,5 2,5 ± 0,8 1,06 ± 0,4 1,57 ± 0,1 2,91 ± 0,4 2,90 ± 0,8
HOMA-IR 0.73 ± 0,29 0,94 ± 0,17 5,42 ± 0,96 3,93 ± 1,30 1,28 ± 0,68 1,98 ± 0,19 4,35 ± 0,44 4,61 ± 1,41
Триглицериды (мг/дл) 77,4 ± 5.3 77,4 ± 5,3 83,4 ± 2,6 88,4 ± 4,7 99,9 ± 664 99,9 ± 69 68,3 ± 2,4 89,2 ± 60064 89,2 ± 6.5 80,4 ± 2.0 89,4 ± 3.0
НЕФА (ммоль) 1.2 ± 0,1 0,1 0,84 ± 0,1 * 0,82 ± 0,0 0,75 ± 0,1 0,83 ± 0,07 0,85 ± 0,08 0,56 ± 0,02 0,67 ± 0,05
Адипонектин (мкг/мл) 14,4 ± 1.0 14,4 ± 1,0 14,4 ± 0,6 14,1 ± 0,7 17,1 ± 0,8 * 11,7 ± 0,5 12,2 ± 0,6 14,1 ± 0,8 15,2 ± 1,4
Высокая МВ Адипонектин (мкг/мл) 4.2 ± 0,5 3,5 ± 0,4 4,6 ± 0,4 6,3 ± 1,0 3.0 ± 0,3 3,7 ± 0,3 3,7 ± 0,3 5,2 ± 0,3 5,2 ± 0,3 A 5,7 ± 0,4
Ген Прямой праймер 5′-3′ Обратный праймер 5′-3′
Адипонектин GGAGAGCCTGGAGAAGCC АТГТГГТААГАГААГТАГТАГАГТК
ППАРγ TTATGGAGCCTAAGTTTGAGTTTG АГКАГГТТГТЦТГГАТГТС
C/EBPα GTGGAGACGCAACAGAAGG CAGCGACCCGAAACCATC
СРЭБП-1с AACCTCATCCGCCACCTG GTAGACAACAGCCGCATCC
ERp44 CAGTCCACGAGATTCAGAGTC АГАААГГААГГКАКАГТКАТК
Ero1-Lα TGGAGCCGTGGATGAGTC CCTTGTAGCCTGTGTAGCG
ДсбА-Л ATCACGGAGTATCAGAGCATTC GCAACAGTGGTGGGTAGC
ГЦН-1 GCATCTGCCCTAAGGTCTTC CACTGTCACACTGGTCACTC
CD68 АГГСТАКАГГККТГКТСАГ ГГГКТГГТАГГТТГАТТГТК
CD11c GGAGCAGGTGGCATTGTG GAGCGATGTCCTGTCTTGAG
Ил-1β GCAGCACACATCAACAAG GTTCATCTCGGAGCCTGTAG
ФНО-α CGTGGAACTGGCAGAGAG ГТАГАКАГААГАГГКГТГГТГ
Ил-6 АГЦКАГАГТЦКТТСАГАГАГ GATGGTCTTGGTCCTTAGCC
Ил-10 GCAGTGGAGCAGGTGAAG CGGAGAGAGGTACAAACGAG
Аргиназа-1 TTGGCTTGCTTCGGAACTC ГГАГГАГААГГКГТТГК
Ym1 GCCCACCAGGAAAGTACAC CTTGAGCCACTGAGCCTTC
МРЦ-1 АТТГТГГАГКАГАТГГААГГ GTCGTAGTCAGTGGTGGTTC
36B4 CACTGCTGAACATGCTGAAC CCACAGACAATGCCAGGAC

Иммуноблот-анализ

Прокладки EWAT (∼100 мг) гомогенизировали с помощью ручного гомогенизатора в буфере RIPA [NP40 (1%), дезоксихолат натрия (24.1 мМ), ДСН (0,05%), NaCl (0,81%), Трис (25 мМ, рН 6,8), ЭДТА (1 мМ), дополненный ингибиторами протеазы и фосфатазы] и белковые фракции придатка яичка. Затем на образцах проводили анализ белка DC (Bio-Rad) для определения концентрации белка в каждом образце. Белки (9 мкг) разделяли с помощью SDS-PAGE (10%) и переносили на мембраны PVDF. Мембраны блокировали в 5% обезжиренном сухом молоке в течение 1 часа и инкубировали с первичными антителами в течение 2,75 часов. Мембраны промывали TBS/0.1% Tween-20 три раза и инкубируют со вторичным антителом в течение одного часа, затем трижды промывают TBS/0,1% Tween-20. Блоты проявляли с использованием пленочного процессора Kodak XOMAT 1000A (Rochester, NY).

Статистический анализ

Данные были проанализированы с использованием факторного дисперсионного анализа 2x2x2, а регрессионный анализ был выполнен с использованием программного обеспечения JMP (SAS Institute Inc., Кэри, Северная Каролина). Значимость была установлена ​​ априори при P <0,05. Графики были построены с использованием программного обеспечения GraphPad Prism версии 4.0 (программное обеспечение GraphPad, Ла-Хойя, Калифорния).

Результаты

Влияние HFD и ниацина на метаболические параметры у мышей

HFD увеличил массу тела, вес эпидидимального жирового тела, сывороточную глюкозу и концентрацию инсулина как у диких мышей, так и у мышей HCA 2 -/- (). Ниацин не влиял на массу эпидидимального жирового тела, концентрацию глюкозы в сыворотке крови или концентрацию инсулина (12). Интересно, что ниацин имел тенденцию повышать концентрацию глюкозы в сыворотке у худых мышей WT и HCA 2 -/- , хотя это не достигало статистической значимости.Известно, что ниацин подавляет высвобождение свободных жирных кислот из адипоцитов, что приводит к временному снижению циркулирующих НЭЖК [29], [30]. В текущем исследовании ниацин снижал концентрацию NEFA в сыворотке только у мышей дикого типа, получавших контрольную диету, но неожиданно не вызывал снижения уровня триглицеридов в сыворотке.

Таблица 2

Влияние HFD и ниацина на метаболические параметры у мышей.

7 диеты высокого жира7

Ниацин увеличивает анти -воспалительный адипокин, адипонектин

Мы и другие ранее продемонстрировали, что лечение ниацином увеличивает концентрацию адипонектина в сыворотке [10], [31]. Адипонектин представляет собой адипокин, секретируемый преимущественно из жировой ткани, обладающий противовоспалительным, инсулинсенсибилизирующим и кардиопротекторным действием.В текущем исследовании мы обнаружили, что лечение ниацином увеличивало концентрацию адипонектина в сыворотке у мышей WT на HFD на 21%, но не оказывало никакого влияния на мышей WT на контрольной диете () или HCA 2 -/- мышей на контрольной диете или ВЧД (). Увеличение общего адипонектина было частично объяснено тенденцией лечения никотиновой кислотой к увеличению адипонектина с высокой молекулярной массой у мышей WT HFD (4,6 ± 0,4 против 6,3 ± 1,0 мкг / мл).

Затем мы исследовали локальную продукцию адипонектина в жировой ткани придатка яичка и обнаружили, что у мышей WT и HCA 2 -/- на HFD значительно снижена экспрессия гена адипонектина ().Ниацин увеличивал экспрессию гена адипонектина у мышей WT на HFD на 124%. (). Увеличение экспрессии гена адипонектина не наблюдалось у мышей HCA 2 -/- , что указывает на то, что никотиновая кислота увеличивает экспрессию гена адипонектина зависимым образом от HCA 2 -/- и что увеличение концентрации в сыворотке приводит к от увеличения экспрессии генов.

Влияние HFD и ниацина на экспрессию гена адипонектина.

Экспрессия гена адипонектина в EWAT мышей дикого типа (A) или HCA 2 -/- мышей (B).Значения адипонектина нормализовали до 36В4. *** P<0,001 по сравнению с мышами, получавшими носитель в контрольной диете; * P<0,05 по сравнению с мышами на диете с высоким содержанием жиров, получавшей носитель. Данные представлены как среднее значение ± стандартная ошибка среднего и выражены относительно контрольной группы, равной единице. AU , условные единицы.

В соответствии с данными об экспрессии гена адипонектина экспрессия белка адипонектина в эпидидимальных жировых телах была резко снижена у мышей дикого типа на HFD ().Ниацин увеличивал экспрессию белка адипонектина у мышей дикого типа на HFD (1), но не оказывал никакого эффекта на мышей на контрольной диете (3). Интересно, что мыши HCA 2 -/- , по-видимому, были защищены от HFD-индуцированного снижения экспрессии белка адипонектина EWAT (12). Кроме того, ниацин не оказывал влияния на экспрессию белка адипонектина в EWAT мышей HCA 2 -/- в контроле () или HFD ().

Влияние HFD и ниацина на экспрессию белка адипонектина.

Экспрессия белка адипонектина в EWAT мышей дикого типа (A) или HCA 2 -/- мышей (B). 9 мкг белка разделяли с помощью SDS-PAGE и анализировали с помощью иммуноблоттинга.

Опосредованное ниацином повышение уровня адипонектина происходит независимо от изменений экспрессии генов транскрипционных факторов или шаперонов ER в жировой ткани, участвующих в продукции адипонектина

Уровни клеточного и секретируемого адипонектина можно регулировать на уровне транскрипции.Промотор адипонектина содержит сайты связывания для нескольких факторов транскрипции, которые, как было показано, положительно регулируют транскрипцию гена адипонектина, включая γ-рецептор, активируемый пролифератором пероксисом (PPARγ) [32], CCAAT/энхансер-связывающий белок α (C/EBPα) [33], и белок-1c, связывающий регуляторный элемент стерола (SREBP-1c) [34], [35]. Недавние исследования показали, что ниацин увеличивает активность и экспрессию PPARγ [36] и увеличивает экспрессию C/EBPα в жировой ткани [13]. Поскольку мы продемонстрировали, что ниацин увеличивает экспрессию гена адипонектина в эпидидимальном жире мышей WT, получавших HFD, мы исследовали влияние ниацина на эти факторы транскрипции.

Экспрессия гена PPARγ была снижена в эпидидимальном жире мышей WT на HFD. Однако никотиновая кислота не влияла на экспрессию гена PPARγ у мышей дикого типа (14). Неожиданно ниацин увеличил экспрессию гена PPARγ у худых мышей HCA 2 -/- на 39% (). Экспрессия гена C/EBPα была значительно снижена в EWAT у мышей дикого типа, получавших HFD (1), однако ниацин не влиял на экспрессию гена C/EBPα ни в одной группе мышей (12). Промотор адипонектина трансактивируется SREBP-1c, при этом сверхэкспрессия SREBP-1c в адипоцитах 3T3-L1 увеличивает экспрессию гена и белка адипонектина [37].Мы обнаружили, что экспрессия гена SREBP-1c в жировой ткани не зависела от диеты или лечения никотиновой кислотой во всех группах мышей.

Влияние HFD и ниацина на экспрессию генов факторов транскрипции.

Экспрессия гена PPARγ в EWAT мышей дикого типа (A) или HCA 2 -/- мышей (B). Экспрессия гена C/EBPα в EWAT мышей дикого типа (C) или мышей HCA 2 -/- (D). Экспрессия гена SREBP-1c в EWAT мышей дикого типа (E) или мышей HCA 2 -/- (F).Все значения были нормализованы к 36B4. * P<0,05, **P<0,01 по сравнению с мышами на контрольной диете, получавшими носитель. Данные представлены как среднее значение ± стандартная ошибка среднего и выражены относительно контрольной группы, равной единице. AU , условные единицы.

Известно, что шапероны ER ERp44, Ero1-Lα и DsbA-L участвуют в продукции и секреции адипонектина [38]. Чтобы рассмотреть дополнительный механизм, с помощью которого ниацин может повышать концентрацию адипонектина в сыворотке, мы исследовали экспрессию генов ERp44, Ero1-Lα и DsbA-L в эпидидимальной жировой ткани.ERp44 и Ero1-Lα не подвергались значительному влиянию диеты или лечения ниацином у мышей WT или HCA 2 -/- (). Экспрессия DsbA-L в жировой ткани мышей дикого типа была значительно снижена с помощью HFD, а никотиновая кислота имела тенденцию к увеличению ее экспрессии в этой группе мышей, но незначительно (12).

Влияние HFD и ниацина на экспрессию генов шаперонов ER.

Экспрессия гена ERp44 в EWAT мышей дикого типа (A) или HCA 2 -/- мышей (B), экспрессия гена Ero1-Lα в EWAT мышей дикого типа (C) или HCA 2 -/- мышей (D) и экспрессия гена DsbA-L в EWAT мышей дикого типа (E) или HCA 2 -/- мышей (F).Все значения были нормализованы к 36B4. **Р<0,01. Данные представлены как среднее значение ± стандартная ошибка среднего и выражены относительно контрольной группы, равной единице. AU , условные единицы.

Ниацин ослабляет HFD-индуцированное воспаление жировой ткани рецептор-зависимым образом

Противовоспалительное действие ниацина было продемонстрировано во многих тканях, включая почки [15], легкие [16], линии культур клеток адипоцитов [14], моноциты [17], эндотелиальные клетки сосудов [19], [20] и клетки пигментного эпителия сетчатки [18].Однако до настоящего времени не проводилось исследований противовоспалительных свойств ниацина в жировой ткани in vivo . Поэтому мы изучили влияние ниацина на воспаление жировой ткани, включая экспрессию цитокинов, участвующих в воспалении и инфильтрации макрофагов. Как и ожидалось, HFD значительно увеличил экспрессию гена MCP-1 в жировой ткани мышей WT и HCA 2 -/- (). Ниацин снижал экспрессию MCP-1 в жировой ткани мышей WT, получавших HFD, но не в какой-либо другой группе мышей (11), демонстрируя новые противовоспалительные эффекты ниацина в жировой ткани.Поскольку МСР-1 играет основную роль в рекрутировании моноцитов и макрофагов в жировую ткань, мы исследовали экспрессию общего маркера моноцитов и макрофагов CD68. Как и ожидалось, HFD значительно увеличивал экспрессию CD68 в жировой ткани, предполагая повышенное присутствие макрофагов в EWAT. Однако ниацин не влиял на экспрессию CD68. Эти результаты свидетельствуют о том, что вместо изменения количества макрофагов, присутствующих в жировой ткани, ниацин может способствовать смещению поляризации макрофагов от М1 (провоспалительного) фенотипа макрофагов к М2 (противовоспалительному) фенотипу.Чтобы решить эту проблему, мы исследовали экспрессию CD11c в жировой ткани, маркера дендритных клеток, который высоко экспрессируется на провоспалительных макрофагах M1, а не на противовоспалительных макрофагах M2. HFD значительно увеличивал экспрессию CD11c в жировой ткани, что указывает на присутствие воспалительных макрофагов, а лечение ниацином значительно снижало экспрессию CD11c в жире мышей дикого типа, получавших HFD.

Влияние HFD и ниацина на маркеры воспаления жировой ткани.

Экспрессия гена MCP-1 в EWAT мышей дикого типа (A) или HCA 2 -/- мышей (B), экспрессия гена CD68 в EWAT мышей дикого типа (C) или HCA 2 -/- мышей (D), И экспрессия гена CD11c в EWAT мышей дикого типа (E) или HCA 2 -/- мышей (F).Все значения были нормализованы к 36B4; *Р<0,05, **Р<0,01, ***Р<0,001. Данные представлены как среднее значение ± стандартная ошибка среднего и выражены относительно контрольной группы, равной единице. AU , условные единицы.

При дальнейшем изучении экспрессии цитокинов в жире мы продемонстрировали, что HFD повышает экспрессию генов провоспалительных цитокинов IL-1β и TNF-α в EWAT мышей WT и HCA 2 -/- . Ниацин значительно снижал экспрессию IL-1β в жире мышей дикого типа, получавших HFD (11).Это важно, поскольку IL-1β связан с патогенезом инсулинорезистентности [39]. IL-1β также сильно экспрессируется в воспалительных макрофагах. Снижение IL-1β может свидетельствовать о способности никотиновой кислоты уменьшать присутствие макрофагов M1 в жировой ткани. Ниацин не влиял на экспрессию TNF-α у мышей дикого типа или HCA 2 -/- (), а HFD или ниацин не влияли на экспрессию IL-6 (). ИЛ-10 представляет собой противовоспалительный цитокин, связанный с макрофагами спектра М2.Его экспрессия была значительно увеличена в EWAT у мышей дикого типа и HCA 2 -/- на HFD, и ниацин не оказывал влияния на экспрессию IL-10 ни в одной из групп мышей (12).

Влияние HFD и ниацина на маркеры воспаления жировой ткани.

Экспрессия гена IL-1β в EWAT мышей дикого типа (A) или HCA 2 -/- мышей (B), экспрессия гена TNF-α в EWAT мышей дикого типа (C) или HCA 2 -/- мышей (D) и экспрессия гена IL-6 в EWAT мышей дикого типа (E) или HCA 2 -/- мышей (F).Все значения были нормализованы к 36B4; *Р<0,05, **Р<0,01. Данные представлены как среднее значение ± стандартная ошибка среднего и выражены относительно контрольной группы, равной единице. AU , условные единицы.

Влияние HFD и ниацина на маркеры макрофагов M2.

Экспрессия гена IL-10 в EWAT мышей дикого типа (A) или HCA 2 -/- мышей (B), экспрессия гена аргиназы-1 в EWAT мышей дикого типа (C) или HCA 2 -/- мышей (D), экспрессия гена Ym1 в EWAT мышей дикого типа (E) или HCA 2 -/- мышей (F) и экспрессия гена MRC-1 в EWAT диких мышей мыши -типа (G) или мыши HCA 2 -/- (H).Все значения были нормализованы к 36B4; *Р<0,05, **Р<0,01. Данные представлены как среднее значение ± стандартная ошибка среднего и выражены относительно контрольной группы, равной единице. AU , условные единицы.

Чтобы определить, опосредованы ли противовоспалительные эффекты ниацина в жировой ткани за счет снижения присутствия M1 и увеличения присутствия макрофагов M2, мы исследовали экспрессию маркеров макрофагов M2 в жире. HFD увеличил экспрессию в жировой ткани аргиназы-1, Ym1 и MRC-1, генов, которые в высокой степени экспрессируются в макрофагах M2 (), и неожиданно лечение ниацином снизило экспрессию генов аргиназы-1 и MRC-1 в EWAT диких животных, получавших HFD. -типа мышей, но не влиял на Ym1.CD163, маркер макрофагов М2, не зависел от диеты или лечения никотиновой кислотой ни в одной группе мышей (данные не показаны).

Обсуждение

В настоящее время установлено, что ниацин обладает сосудистыми антиоксидантными и противовоспалительными свойствами, которые могут способствовать улучшению сердечно-сосудистых исходов, независимо от изменений липидного профиля крови [40]. На самом деле Ганджи и др. продемонстрировали, что ниацин напрямую снижает выработку активных форм кислорода эндотелием и последующее окисление ЛПНП в культивируемых эндотелиальных клетках аорты человека [22].Другие показали, что ниацин снижает экспрессию или высвобождение провоспалительных медиаторов, таких как CRP, TNF-α и MCP-1 [14], [17], [23]. Лукасова и др. продемонстрировали, что ниацин ингибирует прогрессирование атеросклеротического заболевания без изменения общего холестерина, холестерина ЛПВП или ТГ через 10 недель у мышей с нулевым рецептором ЛПНП [41]. Авторы также продемонстрировали, что ниацин ингибирует индуцированное MCP-1 привлечение макрофагов к атеросклеротическим бляшкам. Мы и другие продемонстрировали способность ниацина увеличивать выработку адипоцитами и циркулирующие концентрации противовоспалительного цитокина, адипонектина [10], [12], [14], [31].Эти противовоспалительные, независимые от липидов эффекты ниацина могут объяснить некоторые из преимуществ ниацина для здоровья в условиях неизменного липидного профиля крови.

Адипоциты продуцируют ряд адипокинов, которые вносят как положительный, так и отрицательный вклад в системный воспалительный процесс. В жировой ткани худощавых людей адипоциты в целом сохраняют невоспалительный цитокиновый профиль. Однако при ожирении адипоциты гипертрофируются для хранения избытка триглицеридов, и эта гипертрофия связана с нарушением регуляции секреции адипокинов [42].Гипертрофированные адипоциты продуцируют меньше противовоспалительных адипокинов, включая адипонектин, и продуцируют больше провоспалительных цитокинов, таких как TNF-α, что способствует хроническому воспалению, наблюдаемому при ожирении [43], [44]. Механизмы, лежащие в основе HFD-индуцированного снижения продукции адипонектина, включают измененную гормональную среду [42], [45], [46], окислительный стресс [47] и воспаление. Воспаление жировой ткани характеризуется повышенной экспрессией воспалительных цитокинов TNF-α и IL-6.TNF-α оказывает ингибирующее действие на экспрессию адипонектина за счет подавления его промоторной активности [48], а также было показано, что IL-6 ингибирует экспрессию адипонектина в адипоцитах [49]. Из исследований, показавших, что длительное введение никотиновой кислоты повышает уровень адипонектина в сыворотке, только одно выявило возможные механизмы, с помощью которых это происходит [13]. Линке и др. показали, что шестимесячный прием ниацина с пролонгированным высвобождением увеличивает концентрацию адипонектина в сыворотке на 35%, и это сопровождалось 4-кратным увеличением экспрессии мРНК адипонектина в подкожной жировой ткани людей с нарушенной толерантностью к глюкозе [13].Кроме того, Linke et al. продемонстрировали, что экспрессия мРНК PPARγ и C/EBPα также увеличивается в 1,6 и 1,5 раза соответственно в группе, получавшей ниацин. Мы не показали влияния ниацина на экспрессию генов PPARγ или C/EBPα в эпидидимальном жире мышей дикого типа. Однако это не исключает участия PPARγ в способности никотиновой кислоты повышать уровень адипонектина. Изучение активности PPARγ или транслокации в ядро ​​может иметь важное значение для дальнейшего изучения роли PPARγ в механизме действия никотиновой кислоты.В то время как мы показали, что повышенная концентрация мРНК адипонектина и концентрации в сыворотке не были результатом повышенной экспрессии гена PPARγ, другие показали, что in vitro ниацин увеличивает экспрессию мРНК PPARγ [50], [51], индуцирует ядерную экспрессию белка PPARγ и усиливает транскрипционную активность PPARγ [36].

В дополнение к влиянию на экспрессию гена адипонектина агонисты PPARγ могут повышать продукцию и/или секрецию адипонектина за счет изменения экспрессии шаперона ER [52]–[54].Шапероны ER, включая ERp44 и DsbA-L, важны для мультимеризации адипонектина [38], тогда как Ero-1Lα способствует высвобождению адипонектина из адипоцитов [54]. Поэтому мы исследовали, изменялась ли экспрессия шаперона ER при кратковременном введении ниацина, и обнаружили, что экспрессия генов ERp44, Ero1-Lα и DsbA-L не влияла на лечение ниацином. Следовательно, не похоже, чтобы ниацин увеличивал выработку адипонектина посредством какого-либо из механизмов, известных в настоящее время для регуляции адипонектина, которые мы исследовали.

Способность ниацина повышать уровень адипонектина может быть лишь одним из множества противовоспалительных эффектов ниацина в жировой ткани или может быть фактором, способствующим прямым противовоспалительным свойствам ниацина. Адипонектин обладает противовоспалительными свойствами, в том числе способствует поляризации макрофагов от фенотипа M1 к фенотипу M2 [55]. Лечение адипонектином увеличивает экспрессию генов и белков аргиназы-1, Mgl-1 и IL-10 и снижает экспрессию TNF-α и MCP-1 в изолированных мышиных перитонеальных макрофагах [55].Кроме того, адипонектин подавляет активность NF-κB, фактора ядерной транскрипции, участвующего в воспалении жировой ткани, вызванном ожирением [56].

В текущем исследовании мы показали, что введение никотиновой кислоты улучшило воспалительное состояние жировой ткани за счет изменения содержания цитокинов и макрофагов в жировой ткани. Ниацин ослаблял вызванное HFD увеличение MCP-1, IL-1β и CD11c, генов, связанных с воспалительными макрофагами M1. Мы предполагаем, что, поскольку экспрессия общего маркера макрофагов CD68 в жировой ткани не изменялась под действием ниацина, несмотря на снижение экспрессии CD11c, лечение ниацином способствовало смещению поляризации макрофагов от фенотипа M1 к фенотипу M2.Профиль макрофагов жировой ткани важен, поскольку повышенное присутствие макрофагов М1 в жировой ткани было связано с резистентностью к инсулину, связанной с ожирением [57].

Макрофаги М2 существуют вдоль континуума и экспрессируют различные маркеры в зависимости от воздействия микроокружения жировой ткани. В ответ на кормление HFD, несмотря на явное увеличение маркеров макрофагов M1, во многих случаях также наблюдается увеличение маркеров M2 [28], [58], как мы продемонстрировали с IL-10, аргиназой-1, MRC- 1 и Ym1.Интересно, что ниацин не увеличивал экспрессию маркеров М2, как мы предполагали. Другие показали, что HFD увеличивает экспрессию в жировой ткани маркеров M2 аргиназы-1, Ym1 и IL-10 и что сенсибилизирующая инсулин омега-3 жирная кислота, DHA, еще больше увеличивает эти маркеры M2 [59]. Опосредованное ДГК увеличение аргиназы-1, Ym1 и IL-10 происходило в стромально-васкулярной фракции, а не во фракции адипоцитов жировой ткани [59]. Хотя мы также показали HFD-индуцированное увеличение маркеров M2 аргиназы-1, Ym1 и IL-10, мы обнаружили, что ниацин снижает экспрессию аргиназы-1 и не влияет на экспрессию Ym1 и IL-10 в жировой ткани.Поскольку многие из исследованных нами цитокинов продуцируются как адипоцитами, так и макрофагами (MCP-1, TNF-α, IL-10, IL-1β), в будущем будет важно отделить стромально-васкулярную фракцию от фракции адипоцитов для определить эффекты ниацина в каждом из этих типов клеток. Также важно отметить, что два основных места экспрессии рецептора ниацина находятся на адипоцитах и ​​иммунных клетках, включая макрофаги, что еще раз демонстрирует важность изучения возможных дифференциальных эффектов ниацина в этих двух типах клеток, широко присутствующих в жировой ткани.Первоначально мы были удивлены тем, что ниацин снижал экспрессию маркеров, связанных как с провоспалительными M1 (CD11c, MCP-1, IL-1β), так и с противовоспалительными M2 (аргиназа-1 и MRC-1) макрофагами. Повышенная продукция адипоцитами MCP-1, свободных жирных кислот, мертвых и умирающих адипоцитов, гипоксии, окислительного стресса и стресса ER были идентифицированы как факторы, способствующие инфильтрации макрофагов в жировую ткань [60]. Известно, что свободные жирные кислоты направляют макрофаги М1 и М2 в жировую ткань.Увеличение местных и системных свободных жирных кислот в результате липолиза адипоцитов во время потери веса вызывает рекрутирование макрофагов в жировую ткань [61]. Поскольку ниацин является известным ингибитором липолиза адипоцитов, снижение уровня свободных жирных кислот в сыворотке адипоцитов может потенциально ингибировать рекрутирование макрофагов М1 и М2 в жировую ткань.

Рецептор ниацина в основном экспрессируется в адипоцитах и ​​иммунных клетках, включая макрофаги. Интересно, что экспрессия ниациновых рецепторов на макрофагах увеличивается при лечении провоспалительными стимулами, включая TNF-α, интерферон γ или LPS [62].Неизвестно, экспрессируется ли рецептор ниацина в резидентных противовоспалительных макрофагах М2, присутствующих в жировой ткани худощавых людей. В текущем исследовании мы продемонстрировали противовоспалительное действие ниацина только у мышей дикого типа, получавших HFD, которые демонстрируют повышенное присутствие провоспалительных макрофагов M1 в жировой ткани. Возможно, причина, по которой мы не наблюдали противовоспалительных эффектов ниацина у худых мышей, заключается в том, что ниацин проявляет свои противовоспалительные эффекты путем прямого связывания со своим рецептором на адипоцитах и ​​макрофагах M1, которые поляризованы до воспалительного состояния. которых нет в жировой ткани худощавых людей.

Интересно, что было продемонстрировано благотворное влияние ниацина на биологию адипоцитов [13]. Например, адипоциты, выделенные у людей, получавших ниацин, имели уменьшенный средний и максимальный диаметр и объем по сравнению с контрольными субъектами [13]. Кроме того, в этих адипоцитах также улучшилась чувствительность к инсулину. Хотя мы не исследовали чувствительность к инсулину у наших мышей, есть доказательства того, что лечение ниацином улучшает чувствительность к инсулину в адипоцитах, и наши результаты показывают, что это может быть связано с уменьшением воспаления жировой ткани.Однако клинически было продемонстрировано, что ниацин повышает уровень глюкозы в крови у пациентов с диабетом и без него [3], поэтому влияние ниацина на чувствительность адипоцитов к инсулину, вероятно, не способствует улучшению чувствительности всего организма к инсулину.

Таким образом, результаты текущего исследования показывают, что ниацин уменьшает воспаление жировой ткани за счет снижения содержания провоспалительных цитокинов, хемокинов и макрофагов, а также за счет повышения концентрации адипонектина в сыворотке и жировой ткани.Тем не менее, чтобы полностью выяснить влияние ниацина на воспаление жировой ткани, необходимы количественные исследования с использованием сортировки флуоресцентно-активированных клеток для определения количества и типа макрофагов, присутствующих в жировой ткани. Повышение уровня адипонектина происходило независимо от изменений в экспрессии ключевых факторов транскрипции и шаперонов ER, участвующих в продукции адипонектина. Эти данные подтверждают идею о плейотропных эффектах никотиновой кислоты для улучшения метаболических параметров в тканях-мишенях, а именно в жировой ткани.Кроме того, все эти противовоспалительные эффекты ниацина были потеряны у мышей с нокаутом ниацинового рецептора. Это согласуется с предыдущими сообщениями о том, что рецептор ниацина необходим для обеспечения противовоспалительных свойств ниацина [14], [17], [41]. Кроме того, важно отметить, что положительные эффекты ниацина, наблюдаемые у мышей, получавших HFD, отсутствовали у худых мышей WT. Эти данные свидетельствуют о том, что плейотропное действие ниацина наиболее выражено при метаболической дисфункции, вызванной ожирением.

Потребление ниацина с пищей предсказывает снижение содержания жира в печени во время изменения образа жизни

Изменение образа жизни привело к среднему снижению веса на 2,6 кг (p < 0,0001). Общая масса тела, подкожного и висцерального жира и гликемия также снизились, в то время как чувствительность к инсулину, показатель HPA, представляющий оценку средней ежедневной физической активности, и VO 2peak увеличились. Общее потребление энергии и потребление калорий из жира уменьшились.С другой стороны, увеличилось потребление клетчатки и калорий из углеводов, особенно из белков. Потребление ниацина также имело тенденцию к увеличению, однако изменение потребления ниацина было относительно небольшим. Наибольший эффект вмешательства в образ жизни был обнаружен в отношении содержания жира в печени (-32%, таблица 1). Тем не менее, для этого изменения наблюдалась большая индивидуальная вариабельность.

Таблица 1. Характеристики субъектов до и после 9 месяцев вмешательства в образ жизни , соответственно 22 ).Потребление ниацина положительно коррелировало с общим потреблением энергии, долей белков и отрицательно с долей углеводов (см. Дополнительную таблицу 1).

Модели линейной регрессии продемонстрировали, что более высокое ежедневное потребление ниацина на исходном уровне связано с более значительным снижением содержания жира в печени (β = -0,19, p = 0,004) с поправкой на содержание жира в печени на исходном уровне. Связь потребления ниацина с изменением содержания жира в печени оставалась статистически значимой (β = −0.21, p = 0,008) также после дополнительной корректировки на пол, возраст, общую жировую массу тела на исходном уровне и при последующем наблюдении и общее суточное потребление энергии на исходном уровне (таблица 2, модель 1). Потребление ниацина существенно не изменилось во время изменения образа жизни (таблица 1). Кроме того, потребление ниацина в конце вмешательства в образ жизни не было значимо связано со снижением жира в печени в приведенной выше модели (p = 0,26).

Таблица 2 Детерминанты изменения содержания жира в печени в многомерных регрессионных моделях.

Затем мы определили, зависит ли изменение содержания жира в печени от потребления других питательных веществ или от количества физической активности. Для этого мы провели прямой пошаговый регрессионный анализ, изучая влияние общего потребления энергии, потребления калорий из углеводов, жиров и белков, потребления клетчатки, никотиновой кислоты и физической активности на исходном уровне, чтобы предсказать изменение содержания жира в печени. В этой модели потребление ниацина сильно предсказывало изменение содержания жира в печени, и только потребление калорий из углеводов было введено в качестве еще одного значительно более слабого предиктора в модель ступенчатой ​​регрессии (таблица 3).Кроме того, в многопараметрической модели изменение содержания жира в печени после поправки на общее ежедневное потребление энергии, потребление калорий из углеводов и физическую активность, все исходное и последующее наблюдение, потребление никотиновой кислоты в исходном состоянии было прогностическим фактором изменение содержания жира в печени (таблица 4).

Таблица 3. Исходное потребление питательных веществ и физическая активность как предполагаемые предикторы изменения содержания жира в печени в прямой ступенчатой ​​многомерной регрессионной модели. Таблица 4 Независимое влияние потребления ниацина от потребления других питательных веществ и от физической активности на изменение содержания жира в печени в многомерной регрессионной модели.

Наконец, используя нашу первоначальную модель, мы проверили, предсказывает ли потребление ниацина изменение содержания жира в печени также после поправки на установленный предиктор содержания жира в печени, аэробную выносливость 10 . Потребление ниацина на исходном уровне оставалось в значительной степени связанным с изменением содержания жира в печени, с поправкой на исходное содержание жира в печени, пол, возраст, общую жировую массу тела на исходном уровне и при последующем наблюдении, а также общее ежедневное потребление энергии и VO 2peak на исходном уровне (n = 190, β = −0.20, p = 0,02).

Потребление ниацина

Чтобы лучше отобразить взаимосвязь потребления ниацина с изменениями общей массы жира в организме, распределением жира в организме и содержанием жира в печени, мы разделили субъектов на квартили в соответствии с потреблением ниацина на исходном уровне. Значительная связь квартилей потребления ниацина наблюдалась с изменением содержания жира в печени, в то время как общая масса тела, подкожного и висцерального жира не ассоциировалась с потреблением ниацина (рис. 1).

Рисунок 1

Взаимосвязь между исходным потреблением ниацина и изменениями в жировых отложениях.Изменение общей массы тела, подкожного и висцерального жира ( A–C ) и содержания жира в печени ( D ) во время вмешательства в образ жизни, стратифицированного по квартилям потребления ниацина. Квартиль 1 представляет собой страту с самым низким потреблением никотиновой кислоты (медиана 7,7 мг/день), а квартиль 4 представляет страту с самым высоким потреблением ниацина (медиана 19,5 мг/день). Столбцы указывают средние геометрические, индикаторы ошибок показывают 95% доверительные интервалы для средних геометрических. P-значения даны как p для тренда.

Из 202 исследованных субъектов 58 человек имели НАЖБП в начале исследования со средним содержанием жира в печени 12,6% (межквартальный интервал 7,9–17,6). НАЖБП разрешилась у 23 пациентов во время вмешательства в образ жизни. Для увеличения потребления ниацина на одно стандартное отклонение отношение шансов разрешения НАЖБП составило 1,77 (95% ДИ, 1,00–3,43). Чтобы отобразить эти отношения у 58 субъектов с НАЖБП, их затем стратифицировали по среднему потреблению никотиновой кислоты. В то время как исходное содержание жира в печени было одинаковым в обеих группах, у большего числа субъектов наблюдалось разрешение НАЖБП в группе с более высоким, чем в группе с более низким потреблением ниацина (рис.2). В подгруппе участников с НАЖБП на исходном уровне наблюдалась значительная обратная связь потребления ниацина с кратностью изменения содержания жира в печени (с использованием тех же ковариатных моделей, что и в таблице 2, модель 1, b = −0,76 + −0,32, p = 0,02 для логарифмически преобразованного исходного уровня потребления ниацина). Следует отметить, что величина абсолютного эффекта от приема ниацина увеличилась в подгруппе с ожирением печени, что указывает на более высокое снижение содержания жира в печени при данном количестве потребления ниацина у этих субъектов по сравнению со всем набором данных.

Рисунок 2

Взаимосвязь между исходным потреблением никотиновой кислоты и разрешением НАЖБП. У субъектов с неалкогольной жировой болезнью печени (НАЖБП) до изменения образа жизни содержание жира в печени до (черные столбцы) и после (серые столбцы) изменения образа жизни показано в группах с более низким (ниже среднего) и более высоким (выше среднего) потреблением ниацина. . Пунктирная линия представляет процентное содержание жира в печени выше, чем присутствует НАЖБП (5,56%). У большего числа участников НАЖБП разрешилась во время вмешательства в образ жизни в группе с более высоким потреблением ниацина, чем в группе с более низким потреблением ниацина (p = 0.03, круговые диаграммы с серыми срезами, представляющими долю субъектов, у которых наблюдается разрешение НАЖБП.

Мы наблюдали взаимосвязь исходного потребления ниацина с изменением ИМТ во время вмешательства в образ жизни по уменьшению жира в печени (p = 0,04, см. Дополнительный рисунок 1A, B), предполагая, что исходное снижение содержания жира в печени, зависящее от ниацина, было выше у участников, теряющих больше веса.

Поскольку ранее мы обнаружили, что у носителей минорного аллеля T SNP rs1

13,9 ± 0,6 A
Управление диеты Niacin
Кузов Вес (г) 32.1 ± 1,1 33,3 ± 1,1 45,1 ± 0,8 40030 40.9 ± 1,9 29,5 ± 1,1 31,5 ± 0,9 38,7 ± 1,0 A 38,1 ± 2.5
Эпидидимальный жир Подушка Вес (г) 1.1 ± 0.1 1.2 ± 0.1 2,0 ± 0,2 A A 2,0 ± 0,2 1,0 ± 0,2 1.3 ± 0,1 2,9 ± 0,3 A 2,5 ± 0,2
Глюкоза (мг/дл) 149.5 ± 9,8 192,9 ± 16,5 249,2 ± 15,8 235,7 ± 18,4 157,4 ± 19,2 204,7 ± 8,7 247,5 ± 10,8 239,7 ± 23,4
Инсулин (нг/мл) 0,78 ± 0,3 0,81 ± 0,1 3,5 ± 0,5 2,5 ± 0,8 1,06 ± 0,4 1,57 ± 0,1 2,91 ± 0,4 2,90 ± 0,8
HOMA-IR 0.73 ± 0,29 0,94 ± 0,17 5,42 ± 0,96 3,93 ± 1,30 1,28 ± 0,68 1,98 ± 0,19 4,35 ± 0,44 4,61 ± 1,41
Триглицериды (мг/дл) 77,4 ± 5.3 77,4 ± 5,3 83,4 ± 2,6 88,4 ± 4,7 99,9 ± 664 99,9 ± 69 68,3 ± 2,4 89,2 ± 60064 89,2 ± 6.5 80,4 ± 2.0 89,4 ± 3.0
НЕФА (ммоль) 1.2 ± 0,1 0,1 0,84 ± 0,1 * 0,82 ± 0,0 0,75 ± 0,1 0,83 ± 0,07 0,85 ± 0,08 0,56 ± 0,02 0,67 ± 0,05
Адипонектин (мкг/мл) 14,4 ± 1.0 14,4 ± 1,0 14,4 ± 0,6 14,1 ± 0,7 17,1 ± 0,8 * 11,7 ± 0,5 12,2 ± 0,6 14,1 ± 0,8 15,2 ± 1,4
Высокая МВ Адипонектин (мкг/мл) 4.2 ± 0,5 3,5 ± 0,4 4,6 ± 0,4 6,3 ± 1,0 3.0 ± 0,3 3,7 ± 0,3 3,7 ± 0,3 5,2 ± 0,3 5,2 ± 0,3 A 5,7 ± 0,4
8 в DGAT2 содержание жира в печени во время нашего вмешательства в образ жизни снижалось меньше, чем у гомозиготных носителей основного аллеля C 8 , а ниацин, как известно, ингибируют активность DGAT2 в гепатоцитах 12 , мы исследовали, взаимодействует ли этот SNP с потреблением ниацина на изменение содержания жира в печени.Фактически, взаимосвязь ниацин*SNP была значимой (p = 0,035) (таблица 2, модель 2), и ниацин более точно предсказывал снижение содержания жира в печени у гомозиготных носителей основного аллеля C (n = 68; β = - 0,90, p = 0,0008), чем у носителей аллеля Т (n = 125; β = −0,22, p = 0,24).

Поскольку потребление ниацина также может влиять на чувствительность к инсулину, мы также проверили, оказывает ли потребление ниацина независимое влияние на изменение чувствительности к инсулину во время вмешательства в образ жизни.Потребление ниацина на исходном уровне не было связано с изменением чувствительности к инсулину после поправки на исходную чувствительность к инсулину, пол, возраст, потребление энергии и общую жировую массу тела на исходном уровне и при последующем наблюдении (β = 0,14, p = 0,13). Также не наблюдалось связи потребления ниацина с изменением индекса резистентности к инсулину жировой ткани, скорректированного с учетом исходного индекса резистентности к инсулину жировой ткани, пола, возраста, потребления энергии и общей жировой массы тела в исходном состоянии и при последующем наблюдении (β = −0.002, p = 0,99).

Витамин B-6 нормализует измененный статус аминокислот серы у крыс, получавших рацион, содержащий фармакологические уровни ниацина, без снижения гиполипидемических эффектов ниацина | Журнал питания

Реферат

Ниацин (никотиновая кислота) в больших дозах (> 2 г) все чаще выбирают клиницисты в качестве гиполипидемического средства. Однако потенциальные риски применения высоких доз витамина не рассматривались критически, как и при использовании других гиполипидемических препаратов.Настоящее исследование предоставляет доказательства того, что фармакологические уровни ниацина влияют на метаболизм метионина, что приводит к гипергомоцистеинемии и гипоцистеинемии. Самцов крыс Sprague-Dawley кормили полусинтетической диетой с добавлением 400 или 4000 мг ниацина/кг (по сравнению с диетой 47 мг/кг в контрольной диете). В эксперименте 1 кормление этими кормами в течение 3 недель приводило к дозозависимому увеличению концентрации метионина в плазме и моче, в то время как уровни цистеина снижались. Этот измененный метаболизм метионина сопровождался более низкой концентрацией витамина B-6 в плазме у крыс, получавших ниацин, по сравнению с контрольной группой.В эксперименте 2 уровни метионина и цистеина в плазме и моче нормализовались при добавлении витамина B-6 (10 мг/кг рациона) к рациону, содержащему 4000 мг ниацина/кг, и скармливании в течение 6 недель. Этот эксперимент также показал, что концентрация гомоцистеина в плазме и моче повышалась при приеме ниацина и нормализовалась при приеме витамина B-6. На гиполипидемическое действие ниацина не влияло присутствие витамина B-6. Эти результаты показывают, что ниацин в больших дозах влияет на метаболизм метионина, влияя на статус витамина B-6.Лечение дислипидемии одновременным введением никотиновой кислоты и витамина B-6 может быть более эффективным, чем применение только никотиновой кислоты.

Ниацин (никотиновая кислота) является важным питательным веществом, но при приеме в больших количествах оказывает гиполипидемическое действие (DiPalma and Thayer 1991, Drood et al. 1991, Grundy et al. 1981, Perry 1986). Хотя физиологическая потребность составляет 17 мг/МДж, доза, необходимая для достижения фармакологического эффекта ниацина, обычно находится в диапазоне 2–4 г/сутки.Гиполипидемическое действие ниацина также было клинически проверено в сочетании с такими препаратами, как холестирамин, колестипол, клофибрат и ловастатин (Blankenhorn et al., 1987, Coronary Drug Project Research Group, 1975, Kane et al., 1981, Kuo et al. 1987). В этих исследованиях наблюдался заметный синергетический эффект.

Потенциальный риск длительного применения больших доз никотиновой кислоты не подвергался критическому анализу так же, как и при применении других гиполипидемических препаратов. Единственным стойким вредным эффектом ниацина в высоких дозах является покраснение кожи и/или зуд, которые, как полагают, вызваны опосредованной простагландинами вазодилатацией (Morrow et al.1989). В отдельных сообщениях было обнаружено, что применение ниацина в больших дозах сопровождается холестатической желтухой с замедленным клиренсом бромсульфаталеина, что указывает на потенциальную гепатотоксичность (Sugerman and Clark 1974, Winter and Boyer 1973).

Ниацин выводится из организма в виде метилированных пиридонов (Shibata and Matsuo 1989). Метилирование осуществляется простой реакцией переноса метила, в которой донором метила является S -аденозилметионин. Ниацин растворим в воде; таким образом, он не сохраняется в организме сверх уровня насыщения тканей.Поскольку экскреция ниацина зависит от метионина (Shibata and Matsuo, 1989), потребление ниацина в 200–400 раз выше физиологической потребности может повлиять на метаболизм этой незаменимой аминокислоты. Синтез метионина требует 5-метилтетрагидрофолата в качестве донора метила и витамина B-12 в качестве кофактора, а его расщепление до цистеина катализируется цистатионин-β-синтазой, для которой витамин B-6 является кофактором (Stipanuk 1986).

Настоящее исследование было предпринято для изучения влияния мегадоз никотиновой кислоты на метаболизм метионина и на биохимический статус вовлеченных витаминов, с особым упором на витамин B-6.

МАТЕРИАЛЫ И МЕТОДЫ

Животные и диеты.

Использовали

самцов крыс Sprague-Dawley (Charles River Canada, Montreal, QC, Canada) весом 120–150 г. Их по отдельности содержали в метаболических клетках из нержавеющей стали в хорошо проветриваемом помещении с температурой 21 ± 2°C и 12-часовым циклом свет/темнота. Все крысы получали гранулированную диету (Purina Lab Rodent Diet, #5001, Purina, Richmond, IN) в течение 1 недели, а затем экспериментальную полусинтетическую диету (таблица 1).Протоколы исследования животных были одобрены Комитетом по защите животных Университета Альберты.

Таблица 1.

Состав полусинтетического рациона 1

2
Состав . .
г / кг
Казеин (витамин свободный) 200
Крахмал (кукуруза) 648
витамин АИН смесь 2 10
АИН минеральную смесь 3 30
Целлюлоза 50
DL-метионин
кукурузное масло 60
Ингредиент . .
г / кг
Казеин (витамин свободный) 200
Крахмал (кукуруза) 648
витамин АИН смесь 2 10
Ain минеральная смесь 3 30
50
2
60064 60
Таблица 1.

Состав полусинтетического рациона 1

2
Ингредиент . .
г / кг
Казеин (витамин свободный) 200
Крахмал (кукуруза) 648
витамин АИН смесь 2 10
АИН минеральную смесь 3 30
Целлюлоза 50
DL-метионин
кукурузное масло 60
2
Ингредиент . .
г / кг
Казеин (витамин свободный) 200
Крахмал (кукуруза) 648
витамин АИН смесь 2 10
АИН минеральную смесь 3 30
Целлюлоза 50
DL-метионин
кукурузное масло 60

Эксперимент 1. Крыс случайным образом разделили на три группы по шесть особей. Группы получали рационы, содержащие 47, 400 или 4000 мг ниацина/кг рациона. Все крысы имели свободный доступ к воде и соответствующим диетам в течение 3 недель.

Эксперимент 2. Три группы по шесть крыс получали рацион, содержащий: 47 или 4000 мг ниацина/кг рациона или 4000 мг/кг плюс витамин B-6 (10 мг пиридоксина-HCl/кг) в течение периода 6 нед.

Коллекции образцов.

Массу тела и суточное потребление пищи всех крыс регистрировали один раз в неделю на протяжении всего периода исследования.Образцы мочи (24 часа) собирали дважды у каждой крысы ближе к концу каждого эксперимента. Крыс умерщвляли в камере СО 2 после лишения пищи в течение ночи. Кровь собирали путем пункции сердца в пробирки с гепарином, плазму отделяли центрифугированием (2800 х g в течение 10 мин при -4°С) в течение получаса после забора. Печень быстро извлекали, вырезали, взвешивали и замораживали в жидком азоте. Отделенные образцы плазмы, печени и аликвоты мочи хранили при температуре -40°С до проведения анализов.

Анализ липидов.

Используя процедуры набора Sigma Diagnostic (Сент-Луис, Миссури), определяли концентрации общего холестерина в плазме (№ 352–3) и триглицеридов (ТГ) (№ 336–10). Фосфорновольфрамовая кислота в сочетании с MgCl 2 использовалась для осаждения фракций ЛПНП и ЛПОНП в плазме, оставляя фракцию ЛПВП в растворе. Затем измеряли концентрацию холестерина во фракции ЛПВП с использованием процедуры набора Sigma Diagnostic (№ 352–20). Концентрацию холестерина ЛПНП определяли косвенным методом, описанным Frildwald et al.(1972). Этот метод требует измерения концентрации общего холестерина в плазме, ТГ и ЛПВП-холестерина. Следующая формула была использована для расчета концентрации холестерина ЛПНП в плазме в ммоль/л:

ЛПНП=Тхол-ТГ2,2-ЛПВПхол

Эта формула основана на предположении, что ЛПОНП-холестерин приближается к ТГ в плазме, деленному на 2,2.

Аминокислотный анализ.

Концентрации свободного (т.е. несвязанного с белками) метионина, цистеина и гомоцистеина в плазме и моче анализировали по методу, описанному Jones and Gilligan (1983).Биологические образцы сначала депротеинизировали добавлением равного объема охлажденной льдом 0,61 моль/л трихлоруксусной кислоты, содержащей 1 ммоль Na 2 ЭДТА. Прозрачные супернатанты смешивали 1:1 с фторальдегидным реагентом, состоящим из o -фталдиальдегида, 2-меркаптоэтанола, 0,04 моль/л буфера бората натрия (pH 9,4) и бриджа 35, растворенного в метаноле. Разделение и количественное определение аминокислот осуществляли с использованием ВЭЖХ Varian 5000 с флуорохромным детектором (Columbia, MD) при возбуждении 340 нм и эмиссии 450 нм.Образец смешанной плазмы или мочи вводили на колонку с обращенной фазой Supelcosil 3 мкм LC-18, 4,6 × 150 мм, снабженную защитной колонкой (4,6 × 50 мм), заполненную насадкой с обращенной фазой Supelco LC-18, 20–40 мкм (Оквилл, Онтарио, Канада). Градиенты образовывались между двумя дегазированными растворителями. Растворителем А был тетрагидрофуран:метанол:0,1 моль/л ацетата натрия (рН 7,2), а растворителем В был метанол. Скорость потока поддерживали на уровне 1,1 мл/мин. Пики идентифицировали по времени удерживания стандартных аминокислот, введенных отдельно.Площади пиков известных концентраций аминокислот регистрировали и интегрировали с использованием системы хроматографических данных Shimdzu Ezchrom (Shimdzu, Киота, Япония). Точность измерения проверяли путем добавления известных количеств аминокислот в плазму и расчета процента восстановления. Все образцы анализировали в двух повторностях. Концентрацию аминокислот в моче выражали на единицу экскреции креатинина, которую измеряли по методике, описанной Блейлером и Шедлом (1962).

Анализ витаминов.

Содержание витамина B-12 и фолиевой кислоты в плазме определяли с использованием имеющегося в продаже набора для двойного радиоанализа DPC (Diagnostic Product, Los Angeles, CA). Гамма-счетчик 1612 (Nuclear Enterprises, Эдинбург, Великобритания) использовали для количественной оценки результатов. Пиридоксаль-5′-фосфат (PLP) плазмы определяли с использованием набора для радиоанализа (Buhlmann Laboratories AG, Швейцария) в качестве модификации метода, описанного Shin-Buckring et al. (1981).

Статистический анализ.

Были определены средние значения для всех групп животных. Статистические сравнения были выполнены с помощью ANOVA. Когда тест F указывал на значительный эффект, различия между средними значениями анализировали с помощью защищенного теста наименьших значимых различий (LSD) (Steel and Torrie 1980). Различия считались значимыми при P < 0,05.

РЕЗУЛЬТАТЫ

В эксперименте 1 кормление с добавлением 400 или 4000 мг ниацина/кг рациона в течение 3 недель приводило к значительно более низкому приросту массы тела по сравнению с крысами без добавок (таблица 2).Более низкая прибавка массы тела была дозозависимой и была значимой при самом высоком уровне дозы. Это происходило параллельно с сокращением потребления пищи. Вес печени также был значительно ниже у крыс, получавших 4000 мг ниацина/кг рациона.

Таблица 2.

Влияние кормления с добавлением ниацина в течение 3 недель на потребление пищи и темпы роста крыс (Эксперимент 1) 1

. 47 . 400 . 4000 .
Диетический ниацин, мг / кг
Массовое увеличение веса тела, г 75,1 ± 3,3 A 66,8 ± 3,0 ab 59,9 ± 2.1 B
Допуск продуктов питания, г / д 17,2 ± 0,4 A 15.9 ± 0,4 B 15,0 ± 0.3 B
Вес печени, г 14 .1 ± 0,2 а 13,9 ± 0,6 а 12,2 ± 0,4 б
.
47 . 400 . 4000 .
Диетический ниацин, мг / кг
Усиление веса тела, г 75,1 ± 3,3 A 66.8 ± 3.0 ab 59.9 ± 2.1 59,9 ± 2.1 B
Допуск продуктов питания, г / д 17,2 ± 0,4 A A 15,9 ± 0,4 B 15,0 ± 0,3 B
Вес печени, г 14,1 ± 0,2 A 12,2 ± 0,4 12,2 ± 0,4 12,2 ± 0,4 12,2 ± 0,4
Таблица 2.

Влияние кормления диетологических диет 3 недели на потребление пищи и темпы роста крыс (Опыт 1) 1

. 47 . 400 . 4000 .
Диетический ниацин, мг / кг
Массовое увеличение веса тела, г 75,1 ± 3,3 A 66,8 ± 3,0 ab 59,9 ± 2.1 B  
Потребление пищи, г/сут   17,2 ± 0,4 a   15.9 ± 0,4 B 15,0 ± 0,3 B
Вес печени, г 14,1 ± 0,2 A 13,9 ± 0,6 A 12,2 ± 0,4 B
59,9 ± 2.18
. 47 . 400 . 4000 .
  Ниацин с пищей, мг/кг  
Увеличение массы тела, г   7,411 ± 3.3 A 66,8 ± 3.0 AB 59.9 ± 2.1 B
Допуск продуктов питания, г / д 17,2 ± 0,4 A 15,9 ± 0,4 B 15,0 ± 0.3 B
Вес печени, г 14.1 ± 0.2 A 13,9 ± 0,6 13,9 ± 0,6 A 12,2 ± 0,4 12,2 ± 0,4

Rats Fed Niacin диеты с добавками (400 мг/кг) имели значительно более низкие концентрации в плазме ТГ и холестерина ЛПНП, тогда как концентрации холестерина ЛПВП были выше, чем у контрольных крыс (таблица 3).Концентрация общего холестерина в плазме также была ниже у крыс, получавших диету с добавлением ниацина, чем у контрольной группы, но это было значимо только у крыс, получавших самую высокую дозу ниацина.

Таблица 3.

Влияние кормления с добавками ниацина в течение 3 недель на концентрацию липидов в плазме крови крыс (Эксперимент 1) 1

Ниацин . Общий холестерин . ТГ 2 . ЛПВП-холестерин . ЛПНП-холестерин .
мг / кг ммоль / л
47 2,4 ± 0,03 1,8 ± 0,02 1,1 ± 0,01 б 0,5 ± 0,05 а
400 2,2 ± 0,02 аб 1,6 ± 0,03 б 1

26

3 ± 0,02 A
0,2 ± 0,04 B
4000 4000 4000 4000 4000 1,9 ± 0,05 B B 1,3 ± 0,02 C 1,2 ± 0,03 A 0,1 ± 0,04 B  
A A 8
Ниацин пищевой . Общий холестерин . ТГ 2 . ЛПВП-холестерин . ЛПНП-холестерин .
мг / кг ммоль / л
47 2,4 ± 0,03 1,8 ± 0,02 1,1 ± 0,01 б 0,5 ± 0,05
400 2,2 ± 0,02 А.Б. 1,6 ± 0,03 б 1,3 ± 0,02 0,2 ± 0,04 б
4000 1 .9 ± 0,05 B 1.3 ± 0,02 C 1,2 ± 0,03 A 0,1 ± 0,04
Таблица 3.

Влияние кормления Niacin-добавленных диетов для 3 недель на плазме концентрации липидов у крыс (Эксперимент 1) 1

Пищевой ниацин . Общий холестерин . ТГ 2 . ЛПВП-холестерин . ЛПНП-холестерин . 94 118
мг / кг ммоль / л
47 2,4 ± 0,03 1,8 ± 0,02 1,1 ± 0,01 б 0,5 ± 0,05 A
4009 4009 200 22 ± 0,02 ab 1,6 ± 0,03 млн. Руб. 1,3 ± 0,02 A 0.2 ± 0.04 б
4000 1,9 ± 0,05 б 1,3 ± 0,02 с 1,2 ± 0,03 0,1 ± 0,04 б
Пищевой ниацин . Общий холестерин . ТГ 2 . ЛПВП-холестерин . ЛПНП-холестерин .
мг / кг ммоль / л
47 2,4 ± 0,03 1,8 ± 0,02 1,1 ± 0,01 б 0,5 ± 0,05
400 2,2 ± 0,02 А.Б. 1,6 ± 0,03 б 1,3 ± 0,02 0,2 ± 0,04 б
4000 1 .9 ± 0,05 б 1,3 ± 0,02 с 1,2 ± 0,03 а 0,1 ± 0,04 б

плазме и моче уровень метионина значительно выше, были в ниацин-дополненной крыс в то время как цистеин уровни были ниже (таблица 4). Эти различия были значительными и дозозависимыми.

Таблица 4.

Влияние кормления с добавлением ниацина в течение 3 недель на уровни свободного метионина и цистеина в плазме и моче крыс (Эксперимент 1) 4-1

. Метионин . Цистеин .
Ниацин пищевой . Плазма . Моча . Плазма . Моча .
мг / кг мкмоль / л мкмоль / мг креатинина мкмоль / л мкмоль / мг креатинина
47 48.6 ± 2.7 C 14.0 ± 1,8 C 15,8 ± 2.6 A A 24,8 ± 1,6 A
40099
400 56,8 ± 3.0 B 19,8 ± 1,7 B 11,1 ± 0,8 B 19,6 ± 0,8
4000 4000 4000 68,0 68,0 68,0 A 24,6 ± 2,0 A 8,0 ± 0,2 C 14.0 ± 1,2 в  
. Метионин . Цистеин .
Ниацин пищевой . Плазма . Моча . Плазма . Моча .
мг / кг мкмоль / л мкмоль / мг креатинина мкмоль / л мкмоль / мг креатинина
47 48.6 ± 2.7 C 14.0 ± 1,8 C 15,8 ± 2.6 A A 24,8 ± 1,6 A
40099
400 56,8 ± 3.0 B 19,8 ± 1,7 B 11,1 ± 0,8 B 19,6 ± 0,8
4000 4000 4000 68,0 68,0 68,0 A 24,6 ± 2,0 A 8,0 ± 0,2 C 14.0 ± 1,2 c  
Таблица 4.

Влияние кормления с добавлением ниацина в течение 3 недель на уровни свободного метионина и цистеина в плазме и моче крыс (Эксперимент 1) 6 4-1

45 5 . Метионин . Цистеин . Ниацин пищевой . Плазма . Моча . Плазма . Моча . + мг / кг мкмоль / л мкмоль / мг креатинина мкмоль / л мкмоль / мг креатинина 47 48,6 ± 2.7 C 14.0 ± 1,8 C 15,8 ± 2,6 A 24,8 ± 1,6 A 400 56.8 ± 3.0 B 19,8 ± 1,7 B 11,1 ± 0,8 11.1 ± 0.8 11.1 ± 0,8 4 19,6 ± 0,8 4000 68,0 ± 4,6 A 24,6 ± 2.0 A 8,0 ± 0,2 в 14,0 ± 1,2 в

2 .

B

C C 8 9

Концентрации плазмы витамина B-12 и фолиевой кислоты были одинаковыми во всех группах (табл. 5).Однако уровни PLP в плазме были значительно ниже у крыс, получавших самую высокую дозу никотиновой кислоты, по сравнению с крысами в двух других группах.

Таблица 5.

Влияние кормления рационами с добавками ниацина в течение 3 недель на уровни витаминов в плазме крови крыс (Эксперимент 1) .

Метионин . Цистеин .
Ниацин пищевой . Плазма . Моча . Плазма . Моча .
мг / кг мкмоль / л мкмоль / мг креатинина мкмоль / л мкмоль / мг креатинина
47 48,6 ± 2,7 в   14,0 ± 1,8 в   15.8 ± 2.6 A 24,8 ± 1,6 24,8 ± 1,6
4009 4009 56,8 ± 3.0 5630 19,8 ± 1,7 B B 11,1 ± 0,8 B 19,6 ± 0,8 B
4000
4000 68.0 ± 4.6 A 24,6 ± 2.0 A 8.0 ± 0,2 C 14.0 ± 1,2 C
Витамин B-12 . Фолиевая кислота . ПЛП 5-2 .94 118
мг / кг пмоль / л нмоль / л
47 707,9 ± 9,5 72,0 ± 4,7 3193 ± 37
400 705,7 ± 6,9 66,8 ± 5,6 3034 ± 76
4000 707,2 ± 7,5 69,8 ± 7,7 2385 ± 48 б
6 9004 4004Таблица 5

Ниацин пищевой . Витамин B-12 . Фолиевая кислота . ПЛП 5-2 .
мг / кг пмоль / л нмоль / л
47 707,9 ± 9,5 72,0 ± 4,7 3193 ± 37
400 705,7 ± 6,9 66,8 ± 5,6 3034 ± 76 а  
Ниацин пищевой . Витамин B-12 . Фолиевая кислота . ПЛП 5-2 .
мг / кг PMOL / L NMOL / L
47 707.9 ± 9,5 72,0 ± 4,7 3193 ± 37
400 705,7 ± 6,9 66,8 ± 5,6 3034 ± 76
4000 707,2 ± 7,5 69,8 ± 7,7 2385 ± 48 b
Ниацин пищевой . Витамин B-12 . Фолиевая кислота . ПЛП 5-2 .+
мг / кг пмоль / л нмоль / л
47 707,9 ± 9,5 72,0 ± 4,7 3193 ± 37
400 705,7 ± 6,9 66,8 ± 5,6 3034 ± 76
4000 707,2 ± 7,5 69,8 ± 7,7 2385 ± 48 б

В Эксперимент 2, крысы, получавшие ниацин (4000 мг/кг в течение 6 недель), имели более высокие уровни не только метионина, но и гомоцистеина в плазме и моче, чем контрольные (таблица 6).Как и прежде, уровни цистеина были ниже в плазме и моче. Однако, когда витамин B-6 вводили вместе с никотиновой кислотой, концентрации этих трех веществ больше не отличались от таковых у крыс, не получавших добавки.

Таблица 6.

Влияние кормления крыс рационом с добавлением ниацина (4000 мг/кг) отдельно или в комбинации с витамином B-6 (10 мг/кг) в течение 6 недель на уровни метионина и его метаболитов в плазме и моче в их организме. свободные формы (Опыт 2) 6-1

22
. Управление . Ниацин . Ниацин + витамин B-6 . 94 118
Метионин
Плазма, мкмоль / л 55,2 ± 2,5 б 68,6 ± 2,8 53,6 ± 2,4 б
Моча, нмоль/мг креатинина   14,6 ± 1.2 б 26,4 ± 2,2 15,0 ± 1,8 б
гомоцистеина
Плазма, мкмоль / л 11,0 ± 3,8 б 23,6 ± 4,0 13.4 ± 2.9 B
мочи, NMOL / MG Creatininine 2,8 ± 1,2 2,8 ± 1,2 B 5,9 ± 1,8 A 2,6 ± 1,4 B
Цистеин
Плазма, мкмоль/л 17.1 ± 2.0 A 9.0 ± 1,1 B 16.5 ± 2.3 A
моча, NMOL / MG Creatininine 25,6 ± 1,9 A 16.7 ± 2.0 B 27,1 ± 1,0 a  
53,6 ± 2.4 B B
. Управление . Ниацин . Ниацин + витамин B-6 .
Метионин
Плазма, 5 1079 мкмоль/л 4,9072 ± 2.5 B 68.6 ± 2.8 A
моча, NMOL / MG Creatininine 14,6 ± 1,2 B 26.4 ± 2.2 A 15,0 ± 1,8 б
гомоцистеина
Плазма, мкмоль / л 11,0 ± 3,8 б 23,6 ± 4.0 13,4 ± 2,9 б
Моча, нмоль/мг креатинина   2.8 ± 1,2 B 5,9 ± 1,8 A 2,6 ± 1,4 2,6 ± 1,4
Cysteine ​​
Plasma, μMol / L 17,1 ± 2,0 A 9,0 ± 1.1 B 16.5 ± 2.3 A
моча, NMOL / MG Creatininine 25,6 ± 1,9 A 16.7 ± 2.0 B 27,1 ± 1,0 A
Таблица 6.

Влияние кормления крыс рационом с добавлением ниацина (4000 мг/кг) отдельно или в сочетании с витамином B-6 (10 мг/кг) в течение 6 недель на уровни метионина и его метаболитов в плазме и моче в их свободных формах ( Эксперимент 2) 6-1

± 2.5 B 53,6 ± 2.4 B B
. Управление . Ниацин . Ниацин + витамин B-6 .
Метионин
Плазма, мкмоль/л
68.6 ± 2.8 A
моча, NMOL / MG Creatininine 14,6 ± 1,2 B 26.4 ± 2.2 A 15,0 ± 1,8 б
гомоцистеина
Плазма, мкмоль / л 11,0 ± 3,8 б 23,6 ± 4.0 13,4 ± 2,9 б
Моча, нмоль/мг креатинина   2.8 ± 1,2 B 5,9 ± 1,8 A 2,6 ± 1,4 2,6 ± 1,4
Cysteine ​​
Plasma, μMol / L 17,1 ± 2,0 A 9,0 ± 1.1 B 16.5 ± 2.3 A
моча, NMOL / MG Creatininine 25,6 ± 1,9 A 16.7 ± 2.0 B 27,1 ± 1,0 A
22
. Управление . Ниацин . Ниацин + витамин B-6 . 94 118
Метионин
Плазма, мкмоль / л 55,2 ± 2,5 б 68,6 ± 2,8 53,6 ± 2,4 б
Моча, нмоль/мг креатинина   14,6 ± 1.2 б 26,4 ± 2,2 15,0 ± 1,8 б
гомоцистеина
Плазма, мкмоль / л 11,0 ± 3,8 б 23,6 ± 4,0 13.4 ± 2.9 B
мочи, NMOL / MG Creatininine 2,8 ± 1,2 2,8 ± 1,2 B 5,9 ± 1,8 A 2,6 ± 1,4 B
Цистеин
Плазма, мкмоль/л 17.1 ± 2.0 A 9.0 ± 1,1 B 16.5 ± 2.3 A
моча, NMOL / MG Creatininine 25,6 ± 1,9 A 16.7 ± 2.0 B 27,1 ± 1,0 a

Аналогичная картина наблюдалась с увеличением массы тела и приемом пищи (табл. 7). Таким образом, более низкий прирост массы тела и потребление пищи, наблюдаемые у крыс, получавших никотиновую кислоту, не наблюдались, когда им также давали витамин B-6.

Таблица 7.

Влияние кормления крыс рационом с добавлением ниацина (4000 мг/кг) отдельно или в комбинации с витамином B-6 (10 мг/кг) в течение 6 недель на потребление пищи, рост и концентрацию липидов в плазме (Эксперимент 2) 7-1

B
Диета . Увеличение массы тела . Прием пищи . ТС 7-2 . ТГ . HDL-Х . Х-ЛПНП . +
г г / д ммоль / л
управления 164 ± 3.5 19,4 ± 1,0 с 2.38 ± 0,02 A 1.80 ± 0,03 A 1,15 ± 0,07 A 0,41 ± 0,05 A
Niacin 147 ± 5.9 B 16.3 ± 0.5 B 1.94 ± 0,03 B B 1.30 ± 0,02 B B 1,25 ± 0,02 B 0.11 ± 0,01 B
Niacin + Витамин B-6 160 ± 3.9 160 ± 3.9 A 19,0 ± 0,6 A 1.95 ± 0,02 B 1,33 ± 0,02 B 1.21 ± 0,04 B 0,12 ± 0,02 b  
A B 8 9 Таблица 7

Влияние кормления крыс рационом с добавлением ниацина (4000 мг/кг) отдельно или в комбинации с витамином B-6 (10 мг/кг) в течение 6 недель на потребление пищи, рост и концентрацию липидов в плазме (Эксперимент 2) 7 -1

Диета . Увеличение массы тела . Прием пищи . ТС 7-2 . ТГ . HDL-Х . Х-ЛПНП .
г MMOL / L MMOL / L
Контроль 164 ± 3,5 A 19,4 ± 1.0 A 2.38 ± 0,02 A 1,80 ± 0,03 A 1.15 ± 0,07 A 0,41 ± 0,05 A
Niacin 147 ± 5,9 B 16,3 ± 0,5 B 1.94 ± 0,03 B 1.30 ± 0,02 B 1,25 ± 0,02 B 0.11 ± 0,01 B
Niacin + Vitamin B-6 160 ± 3.9 A 19.0 ± 0,6 A 1.95 ± 0,02 B 1,33 ± 0,02 B B 1.21 ± 0,04 B 0.12 ± 0,02 B
A B
Диета . Увеличение массы тела . Прием пищи . ТС 7-2 . ТГ . HDL-Х . Х-ЛПНП .
г MMOL / L MMOL / L
Контроль 164 ± 3,5 A 19,4 ± 1.0 A 2.38 ± 0,02 A 1,80 ± 0,03 A 1.15 ± 0,07 A 0,41 ± 0,05 A
Niacin 147 ± 5,9 B 16,3 ± 0,5 B 1.94 ± 0,03 B 1.30 ± 0,02 B 1,25 ± 0,02 B 0.11 ± 0,01 B
Niacin + Vitamin B-6 160 ± 3.9 19,0 ± 0,6 1,95 ± 0,02 б 1.33 ± 0.02 б 1,21 ± 0,04 б 0,12 ± 0,02 б
B
Диета . Увеличение массы тела . Прием пищи . ТС 7-2 . ТГ . HDL-Х . Х-ЛПНП . +
г г / д ммоль / л
управления 164 ± 3.5 19,4 ± 1,0 с 2.38 ± 0,02 A 1.80 ± 0,03 A 1,15 ± 0,07 A 0,41 ± 0,05 A
Niacin 147 ± 5.9 B 16.3 ± 0.5 B 1.94 ± 0,03 B B 1.30 ± 0,02 B B 1,25 ± 0,02 B 0.11 ± 0,01 B
Niacin + Витамин B-6 160 ± 3.9 160 ± 3.9 A 19,0 ± 0,6 A 1.95 ± 0,02 B 1,33 ± 0,02 B 1.21 ± 0,04 B 0,12 ± 0,02 b  

Как и в первом эксперименте, крысы, получавшие никотиновую кислоту, имели более низкую концентрацию в плазме общего холестерина, ТГ и холестерина ЛПНП, но более высокий уровень холестерина ЛПВП (таблица 7).Добавление витамина B-6 к диете, содержащей ниацин, приводило к концентрации липидов в плазме, по существу, такой же, как у крыс, получавших ниацин, но без витамина B-6.

ОБСУЖДЕНИЕ

Хорошо задокументировано гиполипидемическое действие больших доз ниацина (Drood et al., 1991; Grundy et al., 1981). Результаты нашего экспериментального исследования, демонстрирующего гиполипидемическое действие мегадоз ниацина у крыс, согласуются с этими клиническими исследованиями. Примечательно, что добавление ниацина в дозе 400 мг/кг рациона привело к снижению концентрации холестерина ЛПНП в плазме, тогда как концентрация холестерина ЛПВП увеличилась.Эти эффекты были сопоставимы, когда дополнительный уровень ниацина был увеличен в 10 раз.

Разностороннее действие ниацина на метаболизм липопротеинов, а также его низкая стоимость должны сделать его препаратом выбора у пациентов с дислипидемией и/или ишемической болезнью сердца. Однако, к сожалению, эти положительные эффекты сопровождаются некоторыми побочными реакциями. Наиболее заметным из них является интенсивный прилив крови к лицу (Исследовательская группа Coronary Drug Project, 1975, Knopp et al., 1985), который возникает у большинства людей при пероральном употреблении всего лишь 100 мг.Однако этот неприятный побочный эффект часто ослабевает, если никотиновую кислоту принимают с пищей или аспирином (Kaijser et al., 1979).

Настоящее исследование является первым, в котором представлены данные, свидетельствующие о том, что мегадозы никотиновой кислоты вызывают гипергомоцистеинемию, возможный фактор риска окклюзионных заболеваний артерий. Таким образом, легкая гипергомоцистеинемия связана с ишемической болезнью сердца (Ubbink et al., 1996), инсультом (Coull et al., 1990) и заболеванием периферических сосудов (Taylor et al, 1991). Возможные механизмы, с помощью которых гомоцистеин может вызывать эти нарушения, включают окислительную модификацию холестерина ЛПНП (Olszewski and McCully, 1993), повреждение эндотелия сосудов и усиленное связывание липопротеина (а) с фибрином в атеросклеротической бляшке (Harpel et al.1996).

В нормальной плазме большая часть гомоцистеина (~70%) связана с белками, и хранение в плазме может вызвать перераспределение тиолов, приводящее к увеличению фракции, связанной с белками, за счет свободной формы (Ueland and Refsum 1989) . Поскольку в настоящем исследовании измерялись только свободные тиолы, которые составляют лишь небольшой процент от общего гомоцистеина плазмы, результаты следует интерпретировать с осторожностью.

Гомоцистеин получают из метионина, который может быть преобразован в цистеин через цистатионин в процессе транссульфурации двумя PLP-зависимыми ферментами, цистатионин-β-синтазой и цистатионазой (Ubbink et al.1993). Впоследствии он может реметилироваться в метионин в реакциях, требующих витамина B-12 и фолиевой кислоты. У крыс, получавших диету с добавлением ниацина, наблюдалось повышение не только уровня свободного гомоцистеина, но и уровня свободного метионина как в плазме, так и в моче, тогда как уровень свободного цистеина был снижен. Представляло дополнительный интерес тот факт, что уровни PLP в плазме у этих крыс были заметно снижены. Однако концентрации витамина B-12 и фолиевой кислоты в плазме не изменились. Эти результаты позволяют предположить, что повышенный уровень свободного гомоцистеина у животных, получавших ниацин, может быть следствием дефицита витамина B-6.Эта гипотеза согласуется с важным наблюдением, согласно которому одновременное введение крысам витамина B-6 (10 мг/кг рациона) и ниацина (4000 мг/кг рациона) нормализовало эффекты ниацина как на экскреторные уровни свободных форм в плазме, так и в моче. метионина, гомоцистеина и цистеина. Эти результаты согласуются с другими, которые продемонстрировали, что гипергомоцистеинемию можно успешно лечить с помощью умеренного ежедневного приема витамина B-6 (Brattstrom 1996).

Неблагоприятные эффекты применения ниацина в больших дозах, такие как гипергомоцистеинемия и гипоцистеинемия, по-видимому, являются возможными факторами, ограничивающими использование ниацина в качестве гиполипидемического средства.Это важное наблюдение требует дальнейших исследований, которые должны включать измерение общего (свободного + связанного с белками) уровня гомоцистеина и цистеина в плазме крови. Ниацин в больших дозах влияет на PLP. Механизм взаимодействия между высоким содержанием никотиновой кислоты и PLP в настоящее время не может быть определен. Возможно, ниацин вызывает катаболическую потерю витамина B-6 или ухудшает его превращение в действующий кофермент.

Возможно, самое важное наблюдение, сделанное в настоящем исследовании, заключается в том, что концентрации всех сернистых аминокислот в плазме и моче возвращались к их уровням у контрольных крыс, когда ниацин и витамин B-6 давали вместе.Следует также отметить, что одновременное введение двух витаминов не изменяет гиполипидемического действия никотиновой кислоты. Эти результаты ясно показывают, что комбинация этих двух витаминов может быть лучшим выбором терапии для снижения липидного статуса, чем только ниацин. Необходимы клинические испытания, чтобы определить, можно ли экстраполировать эти экспериментальные результаты на человека.

ПОДТВЕРЖДЕНИЕ

Мы благодарим Брайана Тернера за его ценную техническую помощь.

ЦИТИРОВАННАЯ ЛИТЕРАТУРА

1

Blankenhorn

D. H.

Nessim

S. A.

Johnson

R. L.

Sanmarco

V. E.

AZEN

S. P.

Cashin- Hemphill

L.

Благотворное влияние комбинированной терапии кофибратом и никотиновой кислотой на коронарный атеросклероз и коронарное венозное шунтирование

.

Дж. Ам. Мед. доц.

275

1987

3233

3240

2

Блейлер

Р.E.

Schedl

H. P.

Экскреция креатинина: изменчивость и зависимость от диеты и размера тела

.

Дж. Лаб. клин. Мед.

59

1962

945

955

3

Brattsrom

L. E.

Дж. Нутр.

126

1986

1276S

1280S

4

Исследовательская группа проекта по лечению коронарных препаратов

Клофибрат и ниацин при ишемической болезни сердца

.

Дж. Ам. Мед. доц.

231

1975

1975

360

381

5

Coull

Coull

B. M.

Malinow

M. R.

Beamer

N.

Sexton

G.

Nordt

F.

De Garmo

P.

Повышенная концентрация гомоцистеина в плазме как возможный независимый фактор риска инсульта

.

Ход

21

1990

572

576

6

DiPalma

J.R.

Thayer

W. S.

Использование никотиновой кислоты в качестве наркотика

.

год. Преподобный Нутр.

11

11

1991

169

187

70005

1874

7

Drow

J. M.

Zimetbaum

P. J.

Фришман

W. H.

Никотиновая кислота для лечения гиперлипопротеинемия

.

Дж. Клин. Фармакол.

31

1991

641

650

8

Фрильдвальд

В.T.

Levy

R. I.

Fredrickson

D. S.

Определение концентрации холестерина липопротеидов низкой плотности в плазме без применения препаративной ультрацентрифуги

.

клин. хим.

18

1972

499

501

9

Grundy

S. M.

Zech

L.

Berman

M.

Влияние никотиновой кислоты на метаболизм холестерина и триглицеридов у человека

.

J. Lipid Res.

22

22

1

22

, 1981

240

26

10

Harpel

RARPEL

P. C.

Чжан

x.

BORT

W.

Homocysteine ​​и гемостаз: Патогенетические механизмы предрасполагают к тромбозу

.

Дж. Нутр.

126

1996

1285S

1289S

11

Джонс

Б. П.

O — Предколоночная дериватизация фталдиальдегида и высокоэффективная жидкостная хроматография с обращенной фазой полипептидных гидролизатов и физиологических жидкостей

.

Ж. Хроматогр.

266

266

1983

471

472

12

Kaijser

Kaijser

L.

Eklund

OLSON

A. G.

CARLSON

L. A.

Dissociation влияния никотиновой кислоты на вазодилатацию и липолиз с помощью ингибитора синтеза простагландинов индометацина у человека

.

Мед. биол.

57

1979

1979

114

117

13

117

13

Kane

J. P.

Malloy

M. J.

TUN

P.

Phillips

N. R.

Freedman

D. D.

Williams

M. L.

ROWE

J. S.

HAVEL

R. J.

R. J.

Нормализация уровня липопротеина низкой плотности в гетерозиготной семейной гиперхолестеринемемии с комбинированная схема лечения

.

Н. англ. Дж. Мед.

304

1981

251

258

140005

258

14

KNOPP

R. H.

R. H.

GINSBERG

J.

ALBERS

J. J.

HOFF

C.

Ogilvie

J. T.

WARNICK

G. R.

Burrows

E.

RETZLAFF

B.

PROLE

PROLE

M.

Контрастные воздействия немодифицированных и срочных форм ниацина на липопротеины у субъектов с гиперлипидемией: ключи к механизму действия никотиновой кислоты

.

метаболизма

34

34

1985

642

650

15

KUO

KUO

P. T.

THOLE

J. F.

SCHAAF

J. A.

JONES

A.

Wilson

A. C.

A. C.

KOSTIS

J. B.

j. B.

RearaRa

A. E.

A. E.

Extracranial Carotive Artery Болезнь у пациентов с семейной гиперхолестериной и коронарной артерией, леченным корестиполом и никотиновой кислотой

.

ход

18

70009

716

70004 716

721

16

MOROW

J. D.

J. D.

PARSON

W. G. III

ROBERTS

Л. Дж. II.

Высвобождение значительно повышенного количества простагландина D 2 in vivo у людей после введения никотиновой кислоты

.

Простагландины

38

1989

263

274

17

Ольшевский

А.J.

McCully

K. S.

Метаболизм гомоцистеина и окислительная модификация белков и липидов

.

Свободнорадикальный биол. и мед.

14

1993

683

693

18

Perry

R.

Современные рекомендации по оценке и лечению гиперемии.

клин. фарм.

5

1986

113

127

19

Шибата

К.

Matsuo

H.

Корреляция между потреблением эквивалента ниацина и выведением с мочой его метаболитов, N ‘-метилникотинамид, N ‘-метил-2-пиридон-5-карбоксамид и N’ метил-4-пиридон-3-карбоксамид у людей, потребляющих самостоятельно выбранную пищу

.

утра. Дж. Клин. Нутр.

50

1989

114

119

20

Шина-Buckring

Y.

Рассхофер

5 R.

Endres

W.

Новый ферментативный метод определения пиридоксаль-5′-фосфата

.

J. Унаследованный метаб. Дис.

4

1981

123

124

21

Сталь

,

R.G.D.

и

Torrie

,

J. H.

(

1980

)

Принципы и процедуры статистики: биометрический подход,

2-е изд., стр.

67 05005 04.

McGraw-Hill

,

Нью-Йорк, NY

.22

Стипанюк

М. Х.

Метаболизм серосодержащих аминокислот

.

год. Преподобный Нутр.

6

6

1986

179

209

23

209

23

SUGERMANN

A.

CLARK

C. G.

желтуха после приема Niacin

.

Дж. Ам. Мед. доц.

228

1974

202

203

24

Тейлор

Л.M.

Defrang

R. D.

HARRIS

E. J.

Porter

J. M.

Ассоциация повышенного плазменного гомоцистеина с прогрессированием симптоматического периферического артериального заболевания

.

Дж. Васк. Surg.

13

13

1991

128

136

25

136

25

UBBBink

J. B.

Delport

R

VERMAAK

W.J.H.

Концентрация гомоцистеина в плазме у населения с низкой распространенностью ишемической болезни сердца

.

Дж. Нутр.

126

1996

1254S

1257S

26

Уббинк

J. B.

Van der Merwe

A.

Becker

P. J.

Состояние питания мужчин с гипергомоцистеинемией витамином B-12, витамином B-6 и фолиевой кислотой

.

утра. Дж. Клин. Нутр.

57

1993

47

53

27

Уэланд

П.M.

Refsum

H.

Гомоцистеин в плазме, фактор риска сосудистых заболеваний: уровни в плазме в норме, болезни и лекарственной терапии

.

Дж. Лаб. Клин Мед.

114

1989

4899

473

501

28 20004 501

28

Winter

Boyer

J. L.

Печеночная токсичность из больших доз витамин B 3

.

Н. англ. Дж. Мед.

289

1973

1180

1182

© 1997 Американское общество наук о питании

.

Добавить комментарий

Ваш адрес email не будет опубликован.