Почки человека: почки и печень. Анатомия почек

Содержание

почки и печень. Анатомия почек

Цистит — воспаление мочевого пузыря😔

👩🏻‍🦰 Больше это заболевание знакомо женщинам в силу анатомических особенностей: у женщин мочеиспускательный канал короче, из-за чего патогенам нужно проделать меньший путь для того, чтобы добраться до мочевого пузыря. Но мужчины тоже могут заболеть.

🦠 В большинстве случаев цистит и другие инфекции мочевыводящих путей вызваны бактериями. Это довольно болезненное заболевание. Основная опасность цистита — болезнь может распространиться на почки, поэтому важно остановить ее распространение. Гораздо реже цистит возникает как реакция на лекарства или смену гигиенических средств. Соответственно, как правило, лечение цистита проводится антибиотиками.

🌡 Симптомы:
— Сильное, непреодолимое желание помочиться;
— Маленькое количество мочи при каждом мочеиспускании;
— Жжение при мочеиспускании;
— Кровь в моче;
— Мутная и/или неприятно пахнущая моча;

— Дискомфорт в области таза, ощущение давления;
— Температура.

👶 У маленьких детей симптомы могут проявиться как дневное недержание мочи. Ночное недержание мочи имеет другие причины и не связано с циститом. Если появляется озноб, сильная лихорадка, тошнота и рвота, сильные боли в спине и боку, нужно срочно обратиться к врачу.

🔴 Факторы риска:
— Женский пол;
— Незащищенные половые контакты;
— Беременность и менопауза: гормональные изменения увеличивают риск развития инфекции мочевыводящих путей;
— Нарушения оттока мочи;
— Нарушения в работе иммунной системы;
— Длительное использование катетеров мочевого пузыря.

👍 Профилактика:
— Обильное питье чистой воды;
— Мочеиспускание по потребности;
— После дефекации необходимо подтираться и мыться спереди назад, а не наоборот: это затруднит бактериям попадание из кишечника в мочевыводящие пути;
— Прием душа, а не ванны. Если вы хотите принять ванну, лучше сначала ополоснуться в душе и смыть с себя первую грязь;

— Мочеиспускание после полового акта.

Почки болят когда уже поздно, или Почему нужно сдавать анализ мочи раз в год

С какими болезнями почек чаще всего сталкиваются белорусы и почему в лечении дело так часто доходит до диализа? Что сделать, чтобы защитить свои почки и какие анализы в зависимости от возраста стоит сдавать, чтобы избежать проблем в будущем? Об этом, а также о тех мифах, которыми овеяны почечные заболевания в народе, мы поговорили с доцентом кафедры урологии и нефрологии БелМАПО, врачом-нефрологом   Центра урологии и андрологии   Виктором Громыко.


— Виктор Николаевич, по статистике в Европе около 5-12% населения страдает от хронических заболеваний почек. В Беларуси ситуация отличается? 


— В Республике Беларусь распространенность и заболеваемость хронической болезнью почек не сильно отличается от европейской. Однако, количество наших пациентов растет, особенно тех, кто нуждается в проведении заместительной почечной терапии. И здесь, свой вклад вносят не только первичные почечные заболевания, например, гломерулонефрит, но и другие заболевания, которые сопровождаются поражением почек – артериальная гипертензия, сахарный диабет и некоторые другие.

К тому же, у нас отмечается низкая обращаемость к врачам-нефрологам на начальных стадиях заболеваний. Ведь сами по себе почки не болят. А раз человека ничего не беспокоит, то и к врачу он не идет. К сожалению, когда человек понимает, что у него есть проблема с почками, то мы часто можем говорить уже о хронической почечной недостаточности и необходимости проведения диализа.

Вот вам наглядный пример: 45-летний мужчина, совершенно случайно сделал УЗИ почек. Был Всемирный день борьбы с раковыми заболеваниями, и он просто решил обследоваться. Его ничего не беспокоило, а на УЗИ выявили опухоль. К счастью, это была ранняя стадия, отсутствовали метастазы и все закончилось удалением почки.

— А что делать, если действительно ничего не болит? Просто так ходить на обследования?

— Для начала запомните простое правило: раз в год нужно сдать общий анализ мочи. Если есть какие-то отклонения – в любом бланке с результатами анализов они будут выделены – стоит проконсультироваться со специалистом. О возможных проблемах с почками в первую очередь может говорить повышение в моче белка и эритроцитов.

Кстати, иногда, если результат анализа не очень хороший, можно просто попробовать пересдать его через пару дней. Может, дело в том, что вы накануне вечером ели много мясного и поэтому появился белок в моче. Но если и во второй раз анализ будет плохой, без визита к врачу не обойтись.

Нужно понимать, что наш организм – это тоже своего рода машина. Вы проехали на автомобиле 15 тысяч километров и машине необходимо пройти техобслуживание – заменить масло, фильтры и так далее. Вот и здесь: прошел год – сходите и сдайте анализ мочи.

— А УЗИ почек, когда стоит делать?

— Здесь все зависит от возраста. Если вам нет 35 лет, то сделайте один раз и при отсутствии патологий и хороших анализах можете повторить через 2 – 3 года. Если ребенку-дошкольнику сделали УЗИ, и опять же отсутствует патология, то до подросткового возраста УЗИ почек можно не повторять при отсутствии жалоб. А вот если вам больше 40 лет, то я бы советовал делать УЗИ почек раз в год.

— Говорят, что если в пояснице закололо, то это – почки. Стоит ли при таких симптомах обращаться к нефрологу?

— Дело в том, что почки начинают болеть, когда есть какие-то препятствия для оттока мочи. Например, когда почка блокирована камнем и начинает расширяться. Это сопровождается очень выраженным болевым синдромом, забыть эту боль нельзя. Если же болит поясница, то, скорее всего, это будут боли позвоночного характера – слишком много поднимали тяжестей, неудачно повернулись и так далее. В любом случае, если по данным УЗИ патология почек не выявляется, то болевой синдром в пояснице не связан с почками.

— Одно из самых распространенных заболеваний почек – гломерулонефрит. В чем его опасность и как вылечиться?

— Это диффузное заболевание почек, которое со временем приводит к снижению почечной функции. При гломерулонефрите поражаются обе почки одновременно, и в последующем они сморщиваются, то есть уменьшаются в размерах. И если часть пациентов имеет выраженные клинические симптомы заболевания – отеки ног, лица, то у другой части заболевание протекает бессимптомно и проявляется на поздних стадиях, когда уже есть почечная недостаточность.

— Общего анализа мочи и УЗИ хватит, чтобы обнаружить эту болезнь?

— Хватит, чтобы обратить внимание на наличие проблемы. В современной нефрологии, не только в Республике Беларусь, но и во всем мире, есть золотой стандарт диагностики диффузных заболеваний почек, в частности гломерулонефрита — пункционная нефробиопсия. Если говорить очень упрощенно, то со стороны спины под ультразвуковым контролем специальной иглой берется столбик почечной ткани для дальнейшего морфологического исследования под микроскопом. Без этого никто диагноз не поставит и лечение не назначит.

Потому что одна и та же клиническая картина – отеки, белок в моче, эритроциты – может проявляться при различных морфологических изменениях со стороны почечной ткани и требовать различных вариантов лечения. По большому счету, вариантов два: лечение симптоматическое, позволяет уменьшить артериальное давление, уменьшить нагрузку на почку и т.д. Второй – агрессивная иммуносупрессивная терапия, которая может длиться достаточно долго (от нескольких месяцев – до нескольких лет) и которая может назначаться только по результатам нефробиопсии. И вот чтобы знать, как почка ответит на это лечение и ответит ли, нужно проводить нефробиопсию.

Если обнаружили гломерулонефрит, то за редким исключением это будет хроническое заболевание. И здесь цель любого лечения – добиться ремиссии, то есть снижения или исчезновения изменений со стороны анализа мочи, нормализации почечной функции. Если не получается достичь ремиссии, то развивается почечная недостаточность и пациент будет нуждаться в проведении диализа.

— Получается, полностью вылечить почки уже нельзя?

— Если почки заболели, то это навсегда. Человек должен понимать, что это его слабое место. Может быть такое, что после лечения 5-6 лет и более все хорошо, то есть отсутствуют изменения со стороны общего анализа мочи, а потом вы где-то переохладились, подхватили инфекцию и болезнь вернулась обратно, значит, случился рецидив, который потребует лечения, включая, возможно, и иммуносупресивную терапию.

— В чем причина почечных заболеваний и можно ли как-то их предотвратить?

— Основная причина заболеваний, которые дают осложнения на почки, это все-таки образ жизни. Например, избыточное потребление соли приводит к артериальной гипертензии, не корригируемый уровень сахара при сахарном диабете – страдают почки, так же, как и избыточная масса тела. Если мы говорим про первичные заболевания почек, в частности гломерулонефриты, то здесь спусковым механизмом будут сбои в иммунной системе, обусловленные инфекционным началом, например, те же недолеченные ангины, а также другие состояния.

— А правда ли, что проблемы с почками – это чаще всего женские болезни?

— Нет, это стереотип. Есть формы заболеваний, которые поражают чаще мужчин, а есть формы – которые поражают чаще женщин. Но в целом – гендерных различий здесь нет.

— С одной стороны, все говорят, что нужно пить как можно больше жидкости, мол, это полезно и для почек. С другой стороны, все спорят: что именно пить. Говорят, что газировка плохо влияет на почки. Ну, а с третьей стороны, при почечной недостаточности советуют пить поменьше. Так как помочь почкам?

— Давайте по порядку. Пить воду нужно всем! Если говорить о нормах, то это в среднем 30-35 мл на килограмм массы тела в сутки. Никого не удивлю, если скажу, что лучший выбор – это чистая питьевая вода. Что касается газировки, то она для почек не так опасна, как минеральная вода. Вот здесь избыточное потребление может провоцировать камнеобразование.

Если же мы говорим, что у человека есть диагноз хроническая почечная недостаточность, то здесь все зависит от конкретной ситуации. Если у пациента нет отеков, то можно пить воду без ограничений в количестве, указанном выше.

— Говорят, что почки особенно не любят холод, мясо и алкоголь…

— Да, белорусы склонны к перееданию мясных продуктов, много белка в рационе – в итоге почка начинает усиленно работать. Чем больше работает почка, тем быстрее она «изнашивается». В среднем, при отсутствии нарушения почечной функции, нужно потреблять 1 грамм белка на килограмм массы тела в сутки.  Если мы возьмем 100 граммов мяса, то там будет в среднем 20-25 граммов белка, в зависимости от его типа (говядина, свинина, кролик и т.д.). Так что безопасное количество – не такое уж и маленькое. А вот жареное или тушеное мясо вы едите, для почки не принципиально.

С алкоголем тоже все верно: это токсин, который проходит через почки. Так что это не только удар по печени, как все привыкли считать.

Ну и с холодом все понятно: организм переохлаждается и, на фоне этого, запускаются инфекционные процессы, которые плохо влияют на почки. Тут, кстати, есть и еще одна проблема. При повышенной температуре пациенты часто принимают в больших дозировках жаропонижающие препараты, как по отдельности, так и в комбинации между собой. Но все эти препараты могут вызывать поражение почек с нарушением их функции вплоть до необходимости проведения диализа. Поэтому любой препарат должен применяться по показаниям и строго по инструкции, но их часто вообще не читают.

— Можно ли при болезнях почек ходить в баню или сауну?

— Если отсутствует артериальная гипертензия, то никаких ограничений здесь нет. Не зря же в советские времена ездили на курорт в туркменский Байрам-Али, чтобы помочь почкам.

— Сейчас мода на здоровый образ жизни: все бегают, ходят в тренажерные залы. Как не навредить почкам при занятиях спортом?

— Любая физическая нагрузка подразумевает возможность распада мышц и появление белка, которого в норме быть не может. Это миоглобин. Этот белок может поражать почку, вследствие чего развивается анурия (отсутствие мочи) и острая почечная недостаточность, с последующей необходимостью проведения диализа. И такие случаи после активного занятия спортом были. Нагрузка должна быть соразмерна и возрастать планомерно.

Например, обычная пробежка — это хорошо, интенсивная – уже зависит от организма. Так что если собираетесь бежать полумарафон или активно заняться спортом, то сдайте анализы, чтобы знать, в каком состоянии у вас почки, печень и сердце.

Почки человека — это… Что такое Почки человека?

Почки человека

Почка человека.

Строение почки:
1. Мозговое вещество и почечные пирамиды (Pyramides renales)
2. Выносящая клубочковая артериола (Arteriola glomerularis efferens)
3. Почечная артерия (Arteria renalis)
4. Почечная вена (Vena renalis)
5. Почечные ворота (Hilus renalis)
6. Почечная лоханка (Pelvis renalis)
7. Мочеточник (Ureter)
8. Малая почечная чашка (Calices minores renales)
9. Фиброзная капсула почки (Capsula fibrosa renalis)
10. Нижний полюс почки (Extremitas inferior)
11. Верхний полюс почки (Extremitas superior)
12. Приносящая клубочковая артериола (Arteriola glomerularis afferens
)
13. Нефрон (Nephron)
14. Почечная пазуха (Sinus renalis)
15. Большая почечная чашка (Calices majores renales)
16. Вершина почечной пирамиды (Papillae renales)
17. Почечный столб (Columna renalis)

По́чка (лат. ren) — парный орган выделительной (мочеобразовательной) системы у позвоночных животных, в том числе человека.

В Викисловаре есть статья «почка»

Ссылки

Примечания

Wikimedia Foundation. 2010.

  • Почка (орган)
  • Почобут, Мартин

Полезное


Смотреть что такое «Почки человека» в других словарях:

  • ПОЧКИ — ПОЧКИ. Содержание: I. Анатомия П……………….. 65$ II. Гистология П. . ……………. 668 III. Сравнительная физиология 11……… 675 IV. Пат. анатомия II……………. 680 V. Функциональная диагностика 11…….. 6 89 VІ. Клиника П …   Большая медицинская энциклопедия

  • Почки —         важнейшие парные органы выделения позвоночных животных и человека, участвующие в водно солевом Гомеостазе, т. е. в поддержании постоянства концентрации осмотически активных веществ в жидкостях внутренней среды (см. Осморегуляция),… …   Большая советская энциклопедия

  • ПОЧКИ — главный выделительный (выводящий конечные продукты метаболизма) орган позвоночных. У беспозвоночных, например у улитки, тоже есть органы, выполняющие сходную выделительную функцию и иногда называемые почками, но они отличаются от почек… …   Энциклопедия Кольера

  • ПОЧКИ — (renes), парный орган выделения у позвоночных. В филогенезе позвоночных (и в эмбриогенезе высших позвоночных) происходила последовательная смена 3 типов П. пронефроса, мезонефроса и метанефроса. У круглоротых и рыб П. имеют лентовидную форму, у… …   Биологический энциклопедический словарь

  • ПОЧКИ — парные органы, образующие и выделяющие мочу у позвоночных животных и человека. Основная структурно функциональная единица почки нефрон (в обеих почках человека ок. 2 млн.), в котором происходит фильтрация плазмы крови и образование мочи. Выводят… …   Большой Энциклопедический словарь

  • ПОЧКИ — ПОЧКИ, чек, ед. чка, и, жен. У позвоночных животных и человека: парные органы, образующие и выделяющие мочу. Правая, левая почка. | прил. почечный, ая, ое. Почечные колики. Толковый словарь Ожегова. С.И. Ожегов, Н.Ю. Шведова. 1949 1992 …   Толковый словарь Ожегова

  • почки — чек, чкам; мн. (ед. почка, и; ж.). 1. Парный орган образования и выделения мочи у человека и животных. Правая, левая почка. Воспаление почек. Блуждающая почка. (мед.; ненормально подвижная или смещённая с обычного места). Искусственная п. (мед.;… …   Энциклопедический словарь

  • Почки, жаренные с помидорами

    — Тип блюда: Категория: Время приготовления (минуты): 3 Продукты: Рецепт приготовления …   Энциклопедия кулинарных рецептов

  • Почки — Почка человека (разрез). ПОЧКИ, парные органы выделительной системы позвоночных животных и человека. Основная структурно функциональная единица почек нефрон (в обеих почках человека около 2 млн.), в котором происходят фильтрация плазмы крови и… …   Иллюстрированный энциклопедический словарь

  • ПОЧКИ — парные органы, образующие и выделяющие мочу у позвоночных животных и человека. Осн. структурно функцион. единица П. нефрон (в обеих П. человека ок. 2 млн.), в к ром происходят фильтрация плазмы крови и образование мочи. Выводят из организма… …   Естествознание. Энциклопедический словарь

Рак почки — Городская больница №3 г. Ижевск

Рак почки является обобщающим названием различных по гистологическим критериям злокачественных новообразований, происходящих в почечной ткани.

Злокачественная опухоль составляет, в соответствии с данными медстатистики, около 3% всех выявленных случаев онкологических недугов человека, а во взрослой урологии этот тип занимает третью позицию среди злокачественных образований после рака простаты и рака мочевого пузыря. Чаще всего развитие ракового образования наблюдается у человека в период от 40-60 лет. Мужчин болезнь поражает значительно чаще, чем женщин. Злокачественное новообразование в почке является заболеванием, имеющим полиэтиологическую т.е. мультифакторную природу. Развитие этого типа болезни может быть спровоцировано различными факторами и влияниями, среди которых наиболее распространенными являются:

· генетические;

· гормональные;

· химические;

· иммунологические;

· лучевые.

Раковое заболевание зачастую представляет собой карциному и, как правило, развивается из эпителиальных клеток проксимальных канальцев и собирательных трубочек.

 Такой тип ракового образования носит название почечно-клеточного рака, а если развитие новообразования происходит с участием чашечно-лоханочной системы, возникает переходно-клеточный рак. Достаточно часто возможно метастатическое поражение почечно-клеточным раком других органов.

Причины развития ракового образования в почке

Все причины развития раковых заболеваний в почечной ткани не являются достоверно установленными. Специалисты предполагают, что на развитие заболевания влияют компоненты, входящие в состав красителей на основе анилина. Канцерогены, содержащиеся в анилиновой краске, считаются пусковыми механизмами, способствующими возникновению не только раковых образований в почках, но и новообразований в мочевом пузыре. Высокой является вероятность возникновения рака почек у людей, имеющих кисты в почках. Риск развития опухолей в почечной ткани имеют пациенты с подковообразной почкой. Показаниями к обследованию почек являются:

· возраст старше 40 лет;

· чрезмерный вес тела;

· табакокурение;

· развитие артериальной гипертензии;

· применение при проведении лечения мочегонных средств;

· развитие сахарного диабета;

· радиационное излучение;

· профессиональный контакты с анилиновыми красителями, продуктами нефтепереработки и другими химическими раздражителями.

Развитие раковых образований возможно под воздействием на орган травматического фактора. Возникновению болезни может способствовать наличие доброкачественных новообразований, которые могут трансформироваться в злокачественные.

Симптомы развития почечного рака

Симптомы рака почки при малом размере опухолевого очага являются практически незаметными. Основными признаками развивающегося недуга является наличие своеобразной триады признаков:

присутствие крови в моче

болевые ощущения в области поясницы

определяемое на ощупь образование на стороне поражения.

Как правило, одновременное возникновение симптомов говорит о запущенности процесса и образовании крупного опухолевого очага.

Кровь в моче при развитии почечного рака может появляться как периодически, так и постоянно даже на самых ранних стадиях развития недуга. Кровь в моче может появляться неожиданно и безболезненно. Дальнейшее развитие недуга провоцирует появление гематурии одновременно с почечными коликами.

Болевые ощущения появляются на поздних стадиях развития, имеют тупой и ноющий характер. Боли появляются в результате сдавливания нервных волокон. В процессе развития рака появляется длительное повышение температуры, очень часто оно имеет небольшое колебание от уровня нормальной до слегка повышенной, в редких случаях наблюдается высокий подъем температуры

Рекомендации населению

На современном этапе развития медицины, отмечается значительный прогресс в лечении данного заболевания, но главным условием для этого должно быть своевременная диагностика рака почки. В условия проводимых мероприятий диспансеризации населения, организованных министерством здравоохранения РФ, населению предоставляется реальная возможность проведения своевременных лабораторно – инструментальных методов исследования (УЗИ, общий анализ крови, биохимическое исследование крови, рентгенологические исследования и т.д.) которые заблаговременно дают возможность дать обобщающее представление о состоянии здоровья человека, в том числе о работе почек. Значимость проведения диспансеризации не вызывает сомнения и не может быть ни в коем случае приуменьшена. Врачи онкологи настоятельно рекомендуют не игнорировать медицинские осмотры и настоятельно просят, не реже 1 раза в 2 года проводить УЗИ органов брюшной полости, особенно в рамках диспансеризации.

Сбалансированное питание, отсутствие вредных привычек, здоровый образ жизни являются «тремя китами» на которых стоят основы профилактики любых злокачественных новообразований.

Врач онкоуролог РКОД.

Почечно-клеточный рак: лечение в Минске

Рак почки лечение 1, 2, 3 стадии. Симптомы, признаки, метастазы, прогноз.

Почки – парные органы, располагающиеся по обе стороны от позвоночника в пространстве между органами брюшной полости и мышцами спины. Каждую почку окружает жировая ткань, сверху от почки располагается надпочечник.

Почки являются органами мочевой системы. Они продуцируют мочу, с которой выводится избыток воды и солей из организма, а также продукты жизнедеятельности человека. Моча собирается в почечной лоханке и выводится по мочеточнику в мочевой пузырь.

Какие бывают опухоли почки?

В почке встречаются два основных вида злокачественных опухолей – опухоли, развивающиеся из ткани самой почки – почечно-клеточный рак и опухоли, развивающиеся из почечной лоханки.

Из доброкачественных опухолей наиболее распространенными являются ангиомиолипомы (опухоли, состоящие из жировой, мышечной тканей и сосудов). Эти опухоли имеют характерные признаки, которые можно выявить при специальном рентгеновском обследовании (компьютерная томография). При больших размерах ангиомиолипомы нужно удалять, поскольку они могут легко повреждаться даже при небольших травмах и приводить к опасному внутреннему кровотечению.

Как часто встречается рак почки?

Рак почки составляет 4 % от всех выявленных злокачественных новообразований. Опухоли почки встречаются преимущественно у людей в возрасте 50-70 лет, хотя это заболевание может встречаться у подростков и даже детей. У мужчин опухоли почки встречаются немного чаще, чем у женщин, а у городского населения чаще по сравнению с сельским.

В Республике Беларусь в 2010 году выявлено 1833 новых случаев этого заболевания. Заболеваемость злокачественными новообразованиями почки в Республике Беларусь постоянно увеличивается и в 2010 году составила 19 на 100 000 жителей.

Какие факторы предрасполагают к развитию рака почки?

  1. Курение является одним из наиболее значительных факторов риска рака почки. У курящих вероятность заболеть раком почки увеличивается примерно в 2 раза по сравнению с некурящими;
  2. Ожирение, особенно у женщин;
  3. Злоупотребление болеутоляющими средствами также может способствовать развитию этого заболевания;
  4. Профессиональные факторы. Риск этого заболевания повышен у рабочих металлургической промышленности, кожевенного производства и при работе с асбестом и кадмием. Необходимо подчеркнуть, что влияние последних факторов не очень большое и признается не всеми специалистами;
  5. Генетические факторы, проявляющиеся в случаях семейного рака почки (например, синдром Фон Гиппель-Линдау). В этих случаях характерно развитие заболевания в молодом возрасте, частое развитие опухолей в обеих почках и возникновение множественных очагов рака в почке.

Симптомы рака почки

Поскольку почки находятся глубоко в теле человека, часто опухоли растут очень долго и достигают больших размеров, прежде чем появляются признаки, позволяющие их заподозрить.

До появления в медицине сложных методов обследования диагноз рака почки можно было заподозрить на основании трех симптомов:

  • боль в пояснице;
  • наличия крови в моче;
  • пальпируемой опухоли.

Сейчас эти симптомы говорят о запущенной стадии рака почки и встречаются редко. Большинство опухолей в настоящее время выявляются случайно при ультразвуковом исследовании, выполняемом по поводу других заболеваний или симптомов:

  • Одним из самых частых симптомов рака почки является появление крови в моче. Нередко вслед за этим в области почки возникают острые боли, обусловленные закупоркой мочеточника кровяными сгустками, которые проходят после отхождения сгустков с мочой;
  • Боль в поясничной области является вторым по частоте симптомом рака почки. Боль может носить тупой характер, что связано с растяжением фиброзной капсулы почки или сдавлением опухолью нервных сплетений. Острые боли в пояснице, как правило, связаны с кровотечением и образованием сгустков, препятствующих оттоку мочи;
  • Наличие опухоли в области почки, которую возможно прощупать, характерно для распространенного опухолевого процесса.
  • Иногда при опухолях почки наблюдается расширение вен около яичка. Если такое расширение происходит внезапно или после 40 лет, необходимо обратиться к врачу, поскольку это может быть симптомом серьезной патологии.

Рак почки отличает высокая частота развития разнообразных проявлений, связанных с выработкой опухолью различных биологически активных веществ, что дало основание назвать рак почки “терапевтической опухолью”.

Опухоли почки могут вырабатывать разнообразные белковые субстанции, способные приводить к повышению температуры тела, увеличению уровня кальция в крови, снижению или повышению количества эритроцитов, повышению давления, ускорению СОЭ, нарушению свертываемости крови.

Все эти состояния проходят после полного удаления опухоли. Возврат этих симптомов, как правило, говорит о рецидиве заболевания или развитии отдаленных метастазов.

Диагностика рака почки

При подозрении на опухоль почки или при наличии неспецифических болей в пояснице в настоящее время широко используется ультразвуковое исследование (УЗИ) почек.

Преимуществами этого исследования является его низкая стоимость, доступность, безопасность, отсутствие вредного воздействия рентгеновских лучей. При УЗИ можно четко отличить обычную кисту почки от опухоли или подозрительного образования, требующего выполнения компьютерной томографии.

Недостатками УЗИ являются не вполне надежные результаты у тучных больных, иногда опухоль трудно выявить из-за экранирования ультразвука ребрами или газом в кишечнике. Кроме этого, результаты исследования зависят от опыта и квалификации врача, выполняющего УЗИ.

Методы лечения рака почки

Главным фактором, влияющим на выбор способа лечения при раке почки, является распространенность опухоли, в основном наличие или отсутствие отсевов опухоли в другие органы – метастазов.

Хирургическое лечение

Наиболее часто при этой патологии выполняется операция по удалению почки с опухолью и окружающими тканями, включающими окружающую почку жировые ткани, лимфоузлы и иногда надпочечника (радикальная нефрэктомия).

В ряде случае для полного удаления опухоли из организма требуется удаление прилежащих к опухоли других органов.

У отдельных пациентов при небольших размерах опухоли выполняется лапароскопическая радикальная нефрэктомия. Такая операция проводится без большого разреза через несколько небольших проколов. Удаленная почка с опухолью обычно извлекается через небольшой разрез внизу живота.

Преимуществом такого вмешательства является более быстрое восстановление организма после операции.

У части больных раком почки опухоль может прорастать в венозную систему почки и даже выходить в самую крупную вену человеческого организма – нижнюю полую вену. В этих случаях операция значительно усложняется и может сопровождаться большой кровопотерей.

В настоящее время значительно участилось выполнение так называемого органосохраняющего лечения опухолей почки. При небольших размерах опухоли и благоприятной их локализации возможно полное удаление опухоли с прилежащим участком ткани почки без удаления всей почки (резекция почки).

Окончательное решение о проведении той или иной операции принимает хирург после анализа данных компьютерной томографии. При маленьких опухолях у очень пожилых пациентов с противопоказаниями к хирургическому лечению допустимо применять наблюдение. При таком подходе операция проводится только при увеличении опухоли в размерах, что происходит только у небольшого количества таких больных.

Альтернативным способом лечения небольших опухолей почки является радиочастотная абляция – уничтожение опухоли при помощи специального зонда, генерирующего высокую температуру, вводимого в опухоль под контролем ультразвукового исследования, компьютерной томографии или лапароскопии.

Преимуществом такого лечения является малая травматичность и хорошая переносимость пожилыми или тяжело больными пациентами. У ряда больных раком почки при первичном обращении уже определяются отдаленные метастазы.

Несмотря на неутешительный прогноз при таком распространенном заболевании, некоторые мероприятия могут продлить жизнь больных или улучшить ее качество. Так, хотя удаление почки при метастатическом раке почки не может излечить больного, установлено, что эта операция позволяет более эффективно лечить это заболевания при помощи лекарственных препаратов, прежде всего иммунотерапии.

Лучевая терапия

Рак почки слабо чувствителен к облучению. В настоящее время лучевая терапия при раке почки используется исключительно с обезболивающей целью у больных с метастазами в костях либо при поражении головного мозга.

Химиотерапия

До настоящего времени результаты применения традиционных противоопухолевых химиопрепаратов у больных раком почки остаются малоутешительными. При раке почки применялись практически все существующие химиопрепараты. К сожалению, ни один из химиопрепаратов не показал эффективности при раке почки.

Иммунотерапия

В настоящее время иммунотерапия при метастатическом раке почки является одним из эффективных методов лечения. В основном при раке почки применяют два иммунологических препарата – интерлейкин-2 и интерферон-альфа. При сходной эффективности обеих препаратов меньше побочных эффектов развивается при лечении интерфероном, поэтому в клинической практике преимущественно используется интерферон.

Таргетная терапия

В последние годы разработан ряд новых препаратов «нацеленного» действия на различные молекулярные механизмы развития опухоли. Применение ряда средств при распространенном раке почки оказалось более эффективным, чем традиционная иммунотерапия.

Тем не менее, в настоящее время эти препараты характеризуются крайне высокой стоимостью, что препятствует их широкому внедрению в клиническую практику. Изучение возможностей использования препаратов таргетной терапии в настоящее время продолжается.

Гипертермия и гипергликемия

Неудовлетворенность результатами лечения больных распространенными формами злокачественных ново­обра­зований явилась толчком к поиску принципиально новых способов, усиливающих возможности химиолучевой терапии. В настоящее имеются данные об эффективности общей гипертермии при лечении распространенного рака почки. Повышенная температура кроме прямого деструктивного действия на опухоль, может усиливать действие противоопухолевых препаратов.

Какое наблюдение требуется после проведенного лечения?

После завершения лечения необходимо периодически проходить обследование для своевременного выявления рецидива или прогрессирования заболевания. Для граждан Республики Беларусь с онкологическими заболеваниями наблюдение осуществляется в онкологических диспансерах по месту жительства.

Как часто следует проходить обследование, а также объем необходимых исследований определит Ваш врач в зависимости от стадии заболевания и проведенного лечения.

В стандартный объем обследования входит:

  1. УЗИ органов брюшной полости;
  2. рентгенография органов грудной клетки;
  3. общий и биохимический анализ крови;
  4. общий анализ мочи.

Как сберечь почки

Сегодня мы поговорим о роли почек в жизнедеятельности человека.Природа наделила этот парный орган особой миссией: они постоянно ведут борьбу с токсинами, микробами, инфекциями, отфильтровывая и выводя их из крови.Поэтому крайне важно относится к почкам бережно, чтобы они служили верой и правдой долгие годы. Что для этого надо делать, мы попросили рассказать заместителя главного врача по стационарной помощи ФГБУЗ КБ №172 ФМБА России Наталью Олеговну Яцына. Ведите здоровый образ жизни


— Почки – мощнейший фильтр, за сутки они прокачивают более двухсот литров крови, — начинает рассказ Наталья Олеговна. — Продукты распада и инфекции этот орган, вместе с плазмой крови, отправляет к мочевому пузырю. Поэтому, нетрудно представить к чему может привести их отказ. Неслучайно природа «подстраховала» человека, наделив его двумя почками: в случае, если из строя выйдет одна, функцию выбывшей возьмет на себя оставшаяся.

Казалось бы, учитывая, какую важную роль выполняют почки в жизни человека, он должен лелеять их. На практике, к сожалению, нередко бывает наоборот. Ослабленный иммунитет, переносимые на ногах болезни, сквозняк, даже кариес, который, наряду с инфекциями, подкидывает в кровь яды, токсины и бациллы, незаметно подтачивают здоровые почки, которые вынуждены постоянно работать в усиленном режиме. Но даже самая совершенная система как почки, при такой нагрузке рискует однажды дать сбой. Поэтому самое мудрое поведение – вести здоровый образ жизни.

В нашем городе среди заболеваний почек достаточно часто встречаются пиелонефрит, мочекаменная болезнь, реже – гломерулонефрит, поликистоз, сахарный диабет с поражением почек.

Можно ли с этими недугами справиться? Все зависит от заболевания почек, и, конечно, от того, насколько оперативно поставлен диагноз и грамотно расписано лечение. К сожалению, не всегда люди вовремя обращают внимание на сигналы опасности, которые подает организм. Бывает и иначе: человек проявляет беспокойство по поводу работы почек, но, вместо немедленного обращения к специалисту, начинает лечиться самостоятельно. Ничем хорошим подобная самодеятельность не заканчивается. Об этом надо помнить.

Осложнений можно избежать, если…

Какие сигналы организма должны вызывать беспокойство? Часто заболевание почек характеризуется болями в пояснице, повышением температуры, давления, общим недомоганием, частым мочеиспусканием. Разумеется, у конкретного заболевания есть свои, специфические симптомы.

Как правило, мочеиспускание у здоровых людей происходит 4-6 раз в течение суток, главным образом в дневное время. Конечно, когда происходит отклонение от нормы, это должно, как минимум насторожить. Например, частые мочеиспускания без увеличения общего суточного количества мочи – симптом инфекционного поражения почек, мочевого пузыря или раздражения, например, инородным телом, камнями, опухолью.

Частое мочеиспускание в ночное время может возникать и на ранней стадии заболевания почек. Хотя причиной частых ночных походов в туалет может быть и не заболевание, а всего-навсего, потребление незадолго до сна большого количества жидкости (чая, кофе, алкоголя). Та же полуночная проблема может быть спутником людей, страдающих сердечной или печеночной недостаточностью, сахарным диабетом. Частое мочеиспускание ночью малым порциями может возникнуть за счет увеличения предстательной железы.

Заболевания почек нередко ведут к осложнениям, в том числе, к одному из самых грозных – почечной недостаточности. Это состояние, при котором почки частично или полностью перестают выполнять свою функцию. На начальных стадиях используется консервативное лечение, но наступает, увы, момент, когда жизнедеятельность почек надо поддерживать при помощи аппарата искусственной почки. В Димитровграде на сегодня в таком положении более 30 человек. С декабря прошлого года, после открытия в нашей клинической больнице отделения диализа, у части таких больных появилась возможность проходить заместительную почечную терапию, не выезжая в областной центр.

Медицинская практика показывает, что многих осложнений можно избежать, если вовремя обратиться к врачу. Один только общий анализ мочи может сказать о многом. Он позволяет участковому терапевту направить к врачу-нефрологу для постановки диагноза и выработки правильной схемы лечения. Если у вас возникли сомнения относительного здоровья, то не медлите, идите на прием. И ни в коем случае не принимайте сами себе назначенные лекарства. Ваши эксперименты с антибиотиками, травами и прочим лечением могут привести к необратимым последствиям.

Избегайте алкоголя, переохлаждения, больше двигайтесь

Конечно, лучше не доводить дело до болезни. Но для этого необходима высокая самодисциплина.

— При профилактике заболеваний почек важно, что человек ест и пьет, — подчеркивает Наталья Олеговна Яцына. — Наверное, любители мяса огорчатся, но переизбыток белка, вреден для почек. Дело в том, что организм не умеет накапливать в себе белок и он, вместе с продуктами полураспада, выводится. Но дается это для почек нелегко, особенно если их владелиц большой любитель мяса. В конце концов, избыточная любовь к белковой пище может привести к образованию в почках камней.

Нельзя назвать друзьями почек и алкогольные напитки, вне зависимости от их крепости.

После приема спиртовой жидкости почки испытывают колоссальную нагрузку! Почему? Организм, чтобы скорее избавиться от алкоголя, отдает всю жидкость. Но из-за этого очень скоро наступает недостаток влаги. А густую кровь почкам фильтровать очень тяжело, и в эти периоды им не позавидуешь.

Впрочем, нельзя причислить к союзникам почек и тех, кто очень любит сладкую и соленую пищу. Дело в том, что при их злоупотреблении нарушается водно-солевой баланс. Отказываться от такой еды никто не призывает, но объемы потребления, конечно, следует пересмотреть.

На что еще хотелось бы обратить ваше внимание? Отслеживайте работу мочевого пузыря. В среднем в течение дня его опорожняют 4-6 раз. Ни в коем случае не надо терпеть. При переполненном мочевом пузыре часть жидкости по мочеточникам может вернуться в почки, а это вредно.

Нельзя допускать и запоров. В противном случае вредные вещества через кишечник попадают в кровь, а с нею попадают в почки. А вести очистку ядов, произведенных в кишечнике, парному органу крайне затруднительно, почти невозможно. Как следствие, может наступить отравление организма продуктами распада.

— Надо беречься и переохлаждения! – предупреждает Наталья Олеговна. — Если игнорировать это правило, можно довести дело до хронического поражения почек. Впрочем, и высокая температура летних месяцев может преподнести неприятные сюрпризы. В жару у многих людей нарушается водно-солевой баланс, кровь густеет, и по этой причине почкам приходиться туго.

Пожалуй, все слышали выражение: «Движение – это жизнь». Для почек эти слова также актуальны. Современный человек мало двигается. Сколько времени мы проводим сидя, будь то на работе или дома? Много! В результате в области поясницы наблюдается застой крови. В этом нет ничего хорошего. Поэтому периодически в течение рабочего дня и дома надо выполнять физические упражнения. Это могут быть наклоны, повороты туловища, иные движения, ускоряющие ток крови. В идеале, конечно, надо больше ходить, поддерживать гибкость позвоночника, танцевать, плавать.

Что лучше есть и пить

Про питание, которое вредит почкам, уже было сказано, теперь о том, что им полезно. В рацион следует добавлять больше фруктов и овощей, очень полезна зелень – сельдерей, укроп, петрушка. Почки с благодарностью принимают арбуз. Его сок насыщает организм влагой и транспортирует через парный орган растворы вредных веществ, отфильтровывая их. Для почек также полезны дыня, огурцы, тыква, настои шиповника и земляники. Рекомендуется кушать яблоки, капусту, сладкий перец. Почки хорошо реагируют на витамин А, морскую рыбу.

А вот прием творога, сыра, шоколада, любых продуктов с высоким содержанием кальция и витамина С надо уменьшить.

Многие граждане считают, что пить много жидкости вредно. Но что значит много? Главное, знать меру или если хотите норму. Это примерно два с половиной литра в день. Если честно, большинство людей столько не пьют. И зря. Обилие воды в организме создает для бактерий не самые лучшие условия пребывания, способствует своевременному удалению шлаков и токсинов.

Что из жидкости лучше всего пить? Конечно, воду хорошего качества! Рекомендуется клюквенный морс. В ней присутствует специальная кислота, которая пагубно влияет на разнообразные бактерии. Хороши также компоты и зеленый чай. Кофе и черный чай, особенно крепкий, лучше не пить. Не стоит принимать и минеральную воду в большом количестве.

Конечно, это общие рекомендации. В зависимости от заболевания почек врач назначает индивидуальную диет-терапию.

Надеюсь, вы внимательно ознакомились с советами, и будете их придерживаться.

Желаю всем крепкого здоровья! Берегите себя!

Органы человека – это не запчасти, которыми можно торговать

Пересадка органов зачастую является единственным способом спасения жизни человека. Самым востребованным органом является почка – каждый год на планете производится порядка 70 тысяч операций по ее замене. В последние годы растет также спрос на роговицу, сердце, печень, легкие, поджелудочную железу и тонкую кишку. Но удовлетворить потребности всех нуждающихся в здоровых органах не удается, дефицит приводит к появлению феномена «трансплантационного туризма». Об этом в пятницу предупредила Генеральную Ассамблею Спецдокладчик ООН по торговле людьми Джой Нгози Эзейло. А Всемирная организация здравоохранения бьет тревогу по поводу безопасности операций по пересадке человеческого материала. Тему продолжит Наталия Терехова.

*****

Спрос на здоровые органы превышает их предложение практически во всех странах мира. Сегодня трансплантация признается единственным выходом из положения при некоторых тяжелых болезнях сердца и печени. Пересадка почки считается лучшим решением при конечной стадии почечной недостаточности. Без нее пациент либо умрет, либо будет вынужден прибегнуть к процедуре диализа – дорогой и зачастую недоступной для огромного числа нуждающихся. Проблема нехватки органов, тканей и клеток для трансплантации одинаково остро стоит как в странах третьего мира, так и в промышленно-развитых государствах, говорит директор федерального немецкого агентства по закупке органов, доктор Гюнтер Кирсте:

«Что касается моей страны, то Германия еще далека до удовлетворения спроса всех нуждающихся в пересадке органов. Ждать здоровую почку приходится примерно шесть лет. Но в мире есть страны, где очередь двигается очень быстро, всего 2-3 месяца. С другой стороны, во многих государствах использование органов умерших запрещено. А предоставление органов живыми донорами сопряжено с риском для их здоровья».

Нехватка человеческого материала, особенно внутренних органов, привела к расцвету глобального «черного рынка». Тот, кто может позволить себе купить необходимый орган, нередко отправляется в страны, где люди едва сводят концы с концами и готовы на все, чтобы хоть как-то удержаться на плаву. По данным ООН, благодаря такому «трансплантационному туризму» в мире осуществляется 10% всех операций по пересадке органов. Всемирная организация здравоохранения давно отслеживает ситуацию в этой сфере. Разработаны и постоянно обновляются глобальные руководящие принципы в области донорства и трансплантации клеток, тканей и органов.

Эксперты ВОЗ категорически возражают против коммерческой торговли частями тела человека и настаивают на принципе добровольного неоплачиваемого донорства. По мнению координатора программы ВОЗ по трансплантации, д-ра Люка Ноэля, вопрос донорства носит морально-нравственный характер, в его обсуждении должны принимать участие все члены семьи, а принятое решение является своего рода гражданским завещанием:

«Желательно обдумать такое решение до того, как жизненные обстоятельства поставят вас перед необходимостью заниматься столь щекотливыми вопросами одновременно с оплакиванием умерших близких. Посмертное пожертвование органов является гражданским поступком. Навыки гражданских жестов должны прививаться со школьной скамьи. Этот вопрос лежит в плоскости осознания общественной значимости своих деяний».

Ну а что может быть более общественно значимым, чем спасение жизни другого человека? 17 лет назад американке Кэрол Миллер была сделана операция по пересадке почки, без которой она бы умерла:

«Мне пришось ждать полтора года. И, возможно, я бы ждала и дольше, если бы не встала в очередь на трансплантацию сразу же, как только узнала о необходимости пересадки почки. Я тут же подала заявку, а затем прошла полный медицинский осмотр, чтобы быть полностью готовой к операции».

Кэрол полностью согласна с тем, что вопрос о донорстве должны решать все члены семьи:

«Мне кажется очень важным, чтобы люди, решившие стать донорами, обязательно обсудили этот вопрос со своими родственниками. Ведь для семьи их смерть станет колоссальным ударом. На то чтобы смириться с потерей может уйти не один год, так что не стоит рассчитывать на то, что родственники сразу же проявят благородство и пожертвуют органы умерших близких. Так что донорам стоит заранее подготовить семью к такому непростому решению. Я уверена, что это резко увеличит шансы нуждающихся в пересадке получить здоровый орган».

Почки (анатомия): изображение, функция, состояние, лечение

Источник изображения

© 2014 WebMD, LLC. Все права защищены.

Почки — это пара бобовидных органов по обеим сторонам позвоночника, ниже ребер и позади живота. Каждая почка имеет длину около 4 или 5 дюймов, что примерно равно размеру большого кулака.

Задача почек — фильтровать кровь. Они удаляют отходы, контролируют баланс жидкости в организме и поддерживают правильный уровень электролитов.Вся кровь в вашем теле проходит через них около 40 раз в день.

Кровь поступает в почки, отходы удаляются, а соль, вода и минералы корректируются, если это необходимо. Отфильтрованная кровь возвращается в организм. Отходы превращаются в мочу, которая собирается в почечной лоханке – воронкообразной структуре , которая стекает по трубке, называемой мочеточником , в мочевой пузырь.

Каждая почка имеет около миллиона крошечных фильтров, называемых нефронами. У вас может работать только 10% почек, и вы можете не заметить никаких симптомов или проблем.

Если кровь перестанет поступать в почку, часть или вся почка может погибнуть. Это может привести к почечной недостаточности.

Заболевания почек

 

  • Пиелонефрит (инфекция почечной лоханки): Бактерии могут инфицировать почки, обычно вызывая боль в спине и лихорадку. Распространение бактерий из-за невылеченной инфекции мочевого пузыря является наиболее частой причиной пиелонефрита.
  • Гломерулонефрит: Гиперактивная иммунная система может атаковать почки, вызывая воспаление и некоторые повреждения.Кровь и белок в моче — распространенные проблемы, возникающие при гломерулонефрите. Это также может привести к почечной недостаточности.
  • Камни в почках (нефролитиаз): Минералы в моче образуют кристаллы (камни), которые могут увеличиваться до размеров, блокирующих отток мочи. Это считается одним из самых болезненных состояний. Большинство камней в почках проходят сами по себе, но некоторые из них слишком велики и требуют лечения.
  • Нефротический синдром: Поражение почек приводит к выделению большого количества белка с мочой.Отек ног (отек) может быть симптомом.
  • Поликистоз почек: Генетическое заболевание, приводящее к образованию больших кист в обеих почках, препятствующих их работе.
  • Острая почечная недостаточность (почечная недостаточность): внезапное ухудшение работы почек. Обезвоживание, закупорка мочевыводящих путей или повреждение почек могут вызвать острую почечную недостаточность, которая может быть обратимой.
  • Хроническая почечная недостаточность: необратимая частичная потеря функции почек. Диабет и высокое кровяное давление являются наиболее распространенными причинами.
  • Терминальная стадия почечной недостаточности (ESRD): Полная потеря силы почек, обычно из-за прогрессирующего хронического заболевания почек. Людям с терминальной почечной недостаточностью для выживания требуется регулярный диализ.
  • Папиллярный некроз: Серьезное повреждение почек может привести к тому, что куски почечной ткани оторвутся внутри и закупорят почки. При отсутствии лечения возникающее повреждение может привести к полной почечной недостаточности.
  • Диабетическая нефропатия: Высокий уровень сахара в крови при диабете постепенно повреждает почки, в конечном итоге вызывая хроническое заболевание почек.Также может появиться белок в моче (нефротический синдром).
  • Гипертоническая нефропатия: поражение почек, вызванное высоким кровяным давлением. В конечном итоге может возникнуть хроническая почечная недостаточность.
  • Рак почки: почечно-клеточная карцинома является наиболее распространенным видом рака, поражающим почки. Курение является наиболее распространенной причиной рака почки.
  • Интерстициальный нефрит: воспаление соединительной ткани внутри почки, часто вызывающее острую почечную недостаточность. Обычными причинами являются аллергические реакции и побочные эффекты лекарств.
  • Болезнь минимальных изменений: форма нефротического синдрома, при которой клетки почек под микроскопом выглядят почти нормальными. Заболевание может вызвать значительный отек ног (отек). Стероиды используются для лечения болезни минимальных изменений.
  • Нефрогенный несахарный диабет: почки теряют способность концентрировать мочу, обычно из-за реакции на лекарство. Хотя это редко опасно, несахарный диабет вызывает постоянную жажду и частое мочеиспускание.
  • Киста почки: Полое пространство в почке.Изолированные кисты почек часто возникают с возрастом и почти никогда не вызывают проблем. Сложные кисты и образования могут быть злокачественными.

 

Изображение простаты, определение, функция, состояния, тесты и лечение

Источник изображения

© 2014 WebMD, LLC. Все права защищены.

Простата, вид сбоку

Простата представляет собой железу размером с грецкий орех, расположенную между мочевым пузырем и половым членом. Простата находится прямо перед прямой кишкой.Уретра проходит через центр предстательной железы от мочевого пузыря к половому члену, позволяя моче вытекать из тела.

Простата выделяет жидкость, которая питает и защищает сперму. Во время эякуляции простата выдавливает эту жидкость в уретру, и она выбрасывается вместе со спермой в виде спермы.

Семяпроводы (единственное число: семявыносящий проток) доставляют сперму из яичек в семенные пузырьки. Семенные пузырьки вносят жидкость в сперму во время эякуляции.

Заболевания предстательной железы

  • Простатит: воспаление предстательной железы, иногда вызванное инфекцией.Обычно лечится антибиотиками.
  • Увеличение предстательной железы. Называемый доброкачественной гипертрофией предстательной железы или ДГПЖ, рост предстательной железы наблюдается практически у всех мужчин старше 50 лет. Симптомы затрудненного мочеиспускания имеют тенденцию усиливаться с возрастом. Лекарства или хирургия могут лечить ДГПЖ.
  • Рак предстательной железы. Это наиболее распространенная форма рака у мужчин (помимо рака кожи), но только один из 41 мужчин умирает от рака предстательной железы. Хирургия, лучевая терапия, гормональная терапия и химиотерапия могут быть использованы для лечения рака предстательной железы.Некоторые мужчины предпочитают откладывать лечение, что называется выжидательным наблюдением.

Анализы простаты

  • Пальцевое ректальное исследование (ПРИ): врач вводит смазанный палец в перчатке в прямую кишку и ощупывает простату. DRE иногда может обнаружить увеличенную простату, опухоли или узлы рака предстательной железы или болезненность при простатите.
  • Простат-специфический антиген (ПСА): Простата вырабатывает белок под названием ПСА, который можно измерить с помощью анализа крови. Если ПСА высокий, рак предстательной железы более вероятен, но увеличенная предстательная железа также может быть причиной высокого уровня ПСА.Рекомендации о том, следует ли мужчине проходить обследование и в каком возрасте, различаются. Поговорите со своим врачом о том, нужно ли вам тестирование, а также о потенциальных преимуществах и рисках.
  • Ультразвуковое исследование предстательной железы (трансректальное ультразвуковое исследование): Ультразвуковой датчик вводится в прямую кишку, приближая ее к предстательной железе. Ультразвук часто делается с биопсией для проверки на рак простаты.
  • Биопсия предстательной железы: в предстательную железу вводится игла для взятия ткани для проверки на рак предстательной железы.Обычно это делается через прямую кишку.

Лечение простаты

Лечение увеличенной простаты

  • Альфа-блокаторы: Альфа-блокаторы расслабляют мышцы вокруг уретры у мужчин с симптомами увеличения простаты. Тогда моча течет более свободно.
  • Ингибиторы 5-альфа-редуктазы: эти препараты снижают уровень определенной формы тестостерона (ДГТ). Простата уменьшается, когда присутствует меньше ДГТ, улучшая отток мочи.
  • Операция по поводу увеличенной простаты: Обычно лекарства устраняют симптомы увеличенной простаты, но некоторым мужчинам требуется хирургическое вмешательство для улучшения симптомов и предотвращения осложнений.

Лечение рака предстательной железы

  • Простатэктомия. Операция по поводу рака предстательной железы, называемая простатэктомией, заключается в удалении предстательной железы с целью удаления всего рака.
  • Лучевая терапия: Радиация убивает клетки рака предстательной железы, сводя к минимуму повреждение здоровых клеток.
  • Имплантаты радиоактивных семян: вместо излучения, направленного на простату извне, радиоактивные семена могут быть имплантированы в простату для уничтожения раковых клеток.
  • Криотерапия: Криотерапия включает уничтожение клеток рака предстательной железы путем их замораживания.
  • Гормональная терапия: клетки рака предстательной железы растут в ответ на гормоны. Гормональная терапия помогает блокировать этот эффект.
  • Химиотерапия. При прогрессирующем раке простаты химиотерапия может помочь уменьшить распространение рака.
  • Настороженное ожидание: Поскольку рак предстательной железы часто развивается медленно, некоторые пожилые мужчины и их врачи воздерживаются от лечения и ждут, не появится ли рак в росте.
  • Клинические испытания: В рамках клинических испытаний рака предстательной железы исследователи проверяют влияние новых лекарств на группу добровольцев с раком предстательной железы.

Лечение простатита

  • Острый и хронический простатит: в зависимости от типа простатита лечение включает антибиотики, другие лекарства и/или хирургическое вмешательство.

Ваши почки и принцип их работы

На этой странице:

Почки представляют собой два бобовидных органа, каждый размером с кулак.Они расположены чуть ниже грудной клетки, по одной с каждой стороны позвоночника.

Здоровые почки фильтруют около полстакана крови каждую минуту, удаляя отходы и лишнюю воду для образования мочи. Моча течет из почек в мочевой пузырь через две тонкие мышечные трубки, называемые мочеточниками, по одной с каждой стороны мочевого пузыря. Ваш мочевой пузырь хранит мочу. Ваши почки, мочеточники и мочевой пузырь являются частью мочевыводящих путей.

У вас есть две почки, которые фильтруют вашу кровь, удаляя отходы и лишнюю воду для образования мочи.

Почему важны почки?

Ваши почки выводят отходы и лишнюю жидкость из организма. Ваши почки также удаляют кислоту, вырабатываемую клетками вашего тела, и поддерживают здоровый баланс воды, солей и минералов, таких как натрий, кальций, фосфор и калий, в крови.

Без этого баланса нервы, мышцы и другие ткани вашего тела могут работать неправильно.

Ваши почки также вырабатывают гормоны, которые помогают

Посмотрите видео о том, что делают почки.

Как работают мои почки?

Каждая из ваших почек состоит примерно из миллиона фильтрующих единиц, называемых нефронами. Каждый нефрон включает в себя фильтр, называемый клубочком, и каналец. Нефроны работают в два этапа: клубочки фильтруют кровь, а канальцы возвращают в кровь необходимые вещества и удаляют отходы.

У каждого нефрона есть клубочек для фильтрации крови и каналец, который возвращает в кровь необходимые вещества и выводит дополнительные отходы.Отходы и лишняя вода становятся мочой.

Клубочки фильтруют кровь

По мере поступления крови в каждый нефрон она попадает в скопление крошечных кровеносных сосудов — клубочек. Тонкие стенки клубочка позволяют более мелким молекулам, шлакам и жидкости — в основном воде — проходить в канальцы. Более крупные молекулы, такие как белки и клетки крови, остаются в кровеносном сосуде.

Трубочка возвращает в кровь необходимые вещества и удаляет отходы

Вдоль канальца проходит кровеносный сосуд.Когда отфильтрованная жидкость движется по канальцу, кровеносный сосуд реабсорбирует почти всю воду вместе с минералами и питательными веществами, в которых нуждается ваше тело. Трубочка помогает удалить из крови избыток кислоты. Оставшаяся жидкость и отходы в канальцах превращаются в мочу.

Как кровь течет через мои почки?

Кровь поступает в почку через почечную артерию. Этот крупный кровеносный сосуд разветвляется на все более мелкие кровеносные сосуды, пока кровь не достигает нефронов. В нефроне ваша кровь фильтруется крошечными кровеносными сосудами клубочков, а затем вытекает из почки через почечную вену.

Ваша кровь циркулирует через почки много раз в день. За один день ваши почки фильтруют около 150 литров крови. Большая часть воды и других веществ, которые фильтруются через клубочки, возвращаются в кровь через канальцы. Только от 1 до 2 литров становится мочой.

Кровь поступает в почки через почечную артерию и выходит через почечную вену. Ваш мочеточник переносит мочу из почки в мочевой пузырь.

Клинические испытания

Национальный институт диабета, болезней органов пищеварения и почек (NIDDK) и другие подразделения Национального института здоровья (NIH) проводят и поддерживают исследования многих заболеваний и состояний.

Что такое клинические испытания и подходят ли они вам?

Клинические испытания являются частью клинических исследований и лежат в основе всех медицинских достижений. Клинические испытания исследуют новые способы предотвращения, выявления или лечения заболеваний. Исследователи также используют клинические испытания для изучения других аспектов лечения, таких как улучшение качества жизни людей с хроническими заболеваниями. Узнайте, подходят ли вам клинические испытания.

Какие клинические испытания открыты?

Клинические испытания, которые в настоящее время открыты и набираются, можно просмотреть на сайте www.Клинические испытания.gov.

Секвенирование одноклеточной РНК почки человека

Мы представляем обзор метода почечной scRNA-seq. Весь процесс включал получение ткани почки человека, приготовление суспензии одиночных клеток и обработку образца 10x Genomics (рис. 1a).

Этическое одобрение

Мы получили одобрение Наблюдательного совета учреждения (IRB) Первой дочерней больницы Медицинского университета Гуанси, и от всех пациентов было получено подписанное информированное согласие.

Забор и изоляция ткани почки человека

Свежие образцы почек человека (дополнительная таблица S1) были собраны в Первой аффилированной больнице Медицинского университета Гуанси и в аффилированной онкологической больнице Медицинского университета Гуанси. Два из трех образцов были получены от пациентов, перенесших радикальную нефрэктомию, а оставшийся образец был получен от пациента, перенесшего радикальную нефроуретерэктомию. Нормальные ткани почек были получены на расстоянии не менее 2 см от опухолевой ткани.

Сначала свежие образцы были взяты из операционной и помещены в раствор, содержащий сбалансированный солевой раствор Хэнка (HBSS; WISENT, 311-512-CL) и 1% антибиотик-антимикотик (Gibco, 15240062) на льду, который транспортировали в лабораторию в течении 20 минут. Затем хирургическими ножницами вырезали продольно полнослойные срезы ткани почки массой 0,5–1  г. Затем ткань дважды промывали холодным фосфатно-солевым буфером Дульбекко (DPBS; WISENT, 311-425-CL). Мы помещали ткань на клеточный фильтр из нержавеющей стали, раздавливали ткань поршнем шприца и промывали ее DPBS.Мы добавили промывочную жидкость в центрифужную пробирку и собрали фрагменты почек в центрифужную пробирку, которую затем центрифугировали при 350  g в течение 5 мин при 4 °C; затем мы повторили этот шаг. После удаления супернатанта мы использовали фермент TrypLE™ Express (1X, Gibco, 12605010) для дальнейшего переваривания липких скоплений клеток в течение 5–10 минут при 37 °C, затем прекращали переваривание с использованием модифицированной среды Игла Дульбекко (DMEM; WISENT, 319). -006-CL), содержащий 10% фатальной бычьей сыворотки (FBS; Gibco, 10099141).Расщепленные клетки центрифугировали при 350 g в течение 5 мин при 4°C. После удаления супернатанта клетки ресуспендировали в 5 мл DPBS и фильтровали через сито для клеток 100 мкм. Затем мы удалили эритроциты, используя буфер для лизиса эритроцитов 1X (10X разбавленный до 1X, BioLegend, B250015) в течение 5 минут и центрифугировали клетки при 300 g в течение 5 минут при 4 °C. После удаления супернатанта клетки суспендировали в DPBS и снова центрифугировали. После удаления супернатанта клетки ресуспендировали в холодном DPBS и пропускали через 40-мкм клеточный фильтр.Живые клетки подсчитывали с использованием окрашивания трипановым синим (0,4%, Gibco, 420301). Если жизнеспособность клеток была выше 80%, мы проводим 10-кратную обработку образца Genomics.

10x Genomics для обработки образцов и подготовки библиотеки кДНК

Руководство пользователя набора 10x Genomics Chromium Single Cell 3′ Reagents Kit v2 guide-chromium-single-cell-3-regent-kits-user-guide-v2-chemistry) использовали для приготовления суспензии отдельных клеток. Образцы отдельных клеток пропускали через 40-мкм клеточный фильтр и подсчитывали с использованием гемоцитометра с трипановым синим.Затем соответствующий объем каждого образца разбавляли, чтобы получить 10 000 клеток почек. Затем суспензию отдельных клеток, гелевые шарики и масла добавляли к чипу A 10x Genomics для отдельных клеток. Перед запуском теста мы проверили, что ошибок нет. После образования капель образцы переносили в пробирки для ПЦР и проводили обратную транскрипцию с использованием термоциклера T100 (Bio-Rad). После обратной транскрипции кДНК восстанавливали с помощью агента для восстановления, предоставленного 10x Genomics, с последующей очисткой DynaBead силаном, как указано в руководстве пользователя.Перед очисткой с использованием шариков SPRIselect мы амплифицируем кДНК в течение 10 циклов. Концентрацию кДНК определяли с помощью флуорометра Qubit2.0 (Invitrogen). Библиотеки кДНК почек готовили в соответствии с руководством пользователя Chromium Single Cell 3′ Reagent Kit v2.

Детали секвенирования одноклеточной РНК и предварительные результаты

Образцы были секвенированы с помощью Hiseq Xten (Illumina, Сан-Диего, Калифорния, США) со следующими параметрами цикла: считывание 1 для 150 циклов, считывание 2 для 150 циклов, индекс для 14 циклов.Предварительные результаты секвенирования (файлы bcl) были преобразованы в файлы FASTQ с помощью CellRanger (версия 3.0, https://support.10xgenomics.com/single-cell-gene-expression/software/pipelines/latest/what-is-cell-ranger). . Мы следовали стандартному протоколу последовательностей 10x Genomics, обрезав конец штрих-кода и уникального молекулярного идентификатора (UMI) до 26 пар оснований, а конец мРНК — до 98 пар оснований. Затем файлы FASTQ были сопоставлены с эталонной последовательностью генома человека GRCh48. Впоследствии мы применили CellRanger для предварительного анализа данных и создали файл, содержащий таблицу штрих-кодов, таблицу генов и матрицу экспрессии генов.Мы провели предварительный контроль качества (QC) файлов FASTQ, чтобы обеспечить высокое качество данных scRNA-seq. Мы также провели сравнение между тремя различными методами (Cell Ranger V2.1 или 2.2 с 150 bp × 2, Cell Ranger V3.0 с 150 bp × 2, Cell Ranger V3.0 с обрезкой данных FASTQ до 26 bp × 98 bp. ). Мы обнаружили, что на самом деле с помощью Cellranger V3.0 было идентифицировано больше одиночных клеток по сравнению с Cellranger V2.0 или 2.1 (таблицы 1 и 2). В то же время мы получили некоторую базовую информацию о секвенировании на веб-сайте, такую ​​как количество клеток, среднее количество обнаруженных генов, насыщенность секвенирования и глубину секвенирования (таблица 2).Стратегия использования CellRanger V3.0 и обрезки данных FASTQ до 26 bp × 98 bp использовалась для предварительной обработки данных scRNA-seq и выполнения последующего анализа.

Таблица 1 Подробный контроль качества файлов FASTQ. Таблица 2 Информация и статистика секвенирования трех образцов и сравнение различных стратегий секвенирования. NA, после предварительной обработки данных некоторые из них не использовались для последующего анализа.

Использование Seurat для контроля качества (QC) и второго анализа данных после смягчения эффекта партии

Мы использовали R (версия 3.5.2, https://www.r-project.org/) и пакет Seurat 15,16 R (версия 3.1, https://satijalab.org/seurat/). Мы использовали функцию MergeSeurat для объединения трех наборов данных о почках. Критерии фильтрации клеток были определены после ссылки на предыдущие исследования 1,12 . В соответствии со средним числом генов и процентным содержанием митохондриальных генов в образцах почек (рис. 2а) были отфильтрованы клетки с <200 и >2500 генов (потенциальные клеточные дуплеты) и процентным содержанием митохондриальных генов >30%.После контроля качества было получено 23 366 клеток почек высокого качества. Была обнаружена и визуализирована взаимосвязь между процентным содержанием митохондриальных генов и прочтениями мРНК, а также связь между количеством мРНК и прочтениями мРНК (рис. 2b).

Рис. 2

Контроль качества (КК) данных отдельных клеток почки человека. ( a ) Диаграмма рассеяния, иллюстрирующая количество генов, уникальных молекулярных идентификаторов (UMI) и процентное содержание митохондриальных генов в каждой клетке трех образцов почек.( b ) Зависимость между процентным содержанием митохондриальных генов и прочтениями мРНК, а также связь между количеством мРНК и прочтениями мРНК. ( c ) Мы обнаружили пакетный эффект между тремя разными образцами почек. ( d ) График UMAP, показывающий состояние клеточного цикла каждой клетки. ( e ) Скрипичный график, иллюстрирующий количество генов, уникальных молекулярных идентификаторов (UMI) и процентное содержание митохондриальных генов в предыдущих данных одноклеточных почек из GSE107585 1 .

После нормализации данных все высоковариабельные гены в одиночных клетках были идентифицированы после контроля взаимосвязи между средней экспрессией и дисперсией. Все вариабельные гены (n = 16471) использовались в последующем анализе, то есть в анализе основных компонентов (PCA).

Поскольку эти данные были получены из трех разных образцов, чтобы избежать влияния пакетного эффекта на последующий анализ, мы приняли стратегию смягчения пакетного эффекта, называемую «Гармония». Пакет R Harmony ориентирован на масштабируемую интеграцию данных scRNA-seq для пакетной коррекции и метаанализа 17 (версия 0.99.9, https://github.com/immunogenomics/Harmony). Для обеспечения надежности Harmony мы также применили другой подход, основанный на взаимных ближайших соседях (MNN) 18 , который был реализован в пакете R scran 19 (функция «fastMNN»). Мы обнаружили, что эти два метода устранения пакетных эффектов дали аналогичные результаты (рис. 2c, дополнительный рис. S1a). Однако для наших данных Harmony может быть немного лучше, чем fastMNN. Harmony идентифицировал вставочные клетки собирательных трубочек с таким же сниженным разрешением, но fastMNN не смог (рис.1b, дополнительный рисунок S1b, c). Поэтому мы использовали Harmony для устранения эффектов периодического действия и продолжили дальнейший анализ.

Впоследствии мы использовали PCA с вариабельными генами в качестве входных данных и идентифицировали важные главные компоненты (PC) на основе функции jackStraw. Двадцать ПК были выбраны в качестве входных данных для аппроксимации и проекции равномерного многообразия (UMAP) и t-распределенного стохастического встраивания соседей (tSNE), когда они статистически значимы. Мы обнаружили пакетный эффект между тремя разными образцами почек (рис.2c и дополнительный рисунок S2a). С разрешением 0,25 ячейки были сгруппированы с помощью функции FindClusters и классифицированы по 10 различным типам ячеек. Затем мы использовали функцию FindAllMarkers, чтобы найти дифференциально выраженные гены между каждым типом клеток (дополнительная таблица S2).

Анализ клеточного цикла

Анализ клеточного цикла выполняли с использованием программы Seurat. Мы использовали ранее определенный основной набор из 43 генов клеточного цикла G1/S и 54 генов G2/M 20 . Клетки классифицировали по максимальной средней экспрессии («оценка цикла») в этих двух наборах генов.Когда показатели цикла G1/S и G2/M были меньше 2, мы считали эти клетки нециклирующими. В противном случае мы считали клетки пролиферативными. После анализа клеточного цикла не наблюдалось смещения, вызванного генами клеточного цикла (рис. 2d и дополнительный рисунок S2b).

Маркеры типов клеток

Назначение типа клеток было выполнено на основе маркерных генов, о которых сообщалось в предыдущих исследованиях 1,3,7,8,9,12,21,22,23 (только онлайн-таблица 1).

Реконструкция траекторий дифференцировки ПТ-клеток с помощью Monocle2

Решения о судьбах ПТ-клеток и псевдовременные траектории были реконструированы с помощью пакета Monocle2 24 R (версия 2.10.1, http://cole-trapnell-lab.github.io/monocle-release/). Прежде всего, Seurat выбрал три типа клеток PT. Данные клеток PT, которые включали 20 308 клеток PT, были импортированы в Monocle2. Мы использовали гены, которые экспрессировались не менее чем в 10 клетках и более чем в 5% клеток. Впоследствии мы использовали пороговые значения локальной плотности клеток (ро) и ближайшего расстояния (дельта) для определения количества кластеров. Затем, как и раньше, мы проводили дифференциальный анализ экспрессии генов, но по всем клеточным кластерам.Мы использовали 1000 лучших генов с наиболее выраженной дифференциальной экспрессией в качестве набора упорядочивающих генов и провели анализ уменьшения размеров и траекторий. После того, как мы установили траекторию, мы использовали дифференциальную функцию GeneTest, чтобы найти гены, характер экспрессии которых варьировался в зависимости от псевдовремени.

Сфероиды и монослои почек человека дают представление о взаимодействии SARS-CoV-2 с почками -19 возникает в результате прямой инфекции почек или непрямых механизмов.Авторы исследовали последствия заражения вирусом-возбудителем тяжелого острого респираторного синдрома коронавирус 2 (SARS-CoV-2) как в монослоях первичных клеток почек человека, так и в сфероидах почек, на трехмерной модели, воспроизводящей почки человека в клеточном составе. и функция. Они продемонстрировали, что вирус эффективно инфицирует и реплицируется в эпителиальных клетках канальцев человека, но не вызывает цитопатических эффектов. Они также предоставляют молекулярные доказательства того, что активация ответа IFN 1 типа может быть основным механизмом устойчивости к цитопатическому повреждению, связанному с SARS-CoV-2.В целом, результаты указывают на минимальное прямое повреждение канальцев SARS-CoV-2, если таковое имеется.

Abstract

Предыстория Хотя коронавирусная болезнь 2019 (COVID-19) вызывает значительную заболеваемость, в основном из-за поражения легких, внелегочные симптомы также являются основными компонентами заболевания. Заболевание почек, обычно проявляющееся в виде ОПП, особенно тяжело протекает у пациентов с COVID-19. Однако неизвестно, является ли такое повреждение результатом прямой инфекции почек вирусом, вызывающим COVID-19, коронавирусом тяжелого острого респираторного синдрома 2 (SARS-CoV-2) или косвенными механизмами.

Методы Используя модели клеток ex vivo , мы стремились проанализировать взаимодействие SARS-CoV-2 с клетками почечных канальцев и оценить прямое повреждение канальцев. Эти модели включали первичные эпителиальные клетки почки человека (полученные из нефрэктомий) и выращенные либо в виде пролиферирующих монослоев, либо в виде покоящихся трехмерных сфероидов почки.

Результаты Мы продемонстрировали, что в монослоях и сфероидах почек присутствуют молекулы проникновения вируса и высокие исходные уровни молекул, родственных ИФН 1 типа.Хотя обе модели поддерживают вирусную инфекцию и репликацию, они не проявляли цитопатического эффекта и гибели клеток, результатов, которые в значительной степени присутствовали в контроле, инфицированном SARS-CoV-2 (культуры клона почки E6 африканской зеленой мартышки [Vero E6]). Сравнение монослойных и сфероидных культур продемонстрировало более высокую инфекционность и репликацию SARS-CoV-2 в активно пролиферирующих монослоях, хотя сфероидные культуры демонстрировали более высокие уровни ACE2. Монослои показали повышение некоторых молекул повреждения канальцев, включая молекулы, связанные с фиброзом (COL1A1 и STAT6) и дедифференцировкой (SNAI2), и потерю клеточной идентичности, что проявляется снижением уровня мегалина (LRP2).Трехмерные сфероиды были менее подвержены таким повреждениям.

Выводы SARS-CoV-2 может инфицировать клетки почек без цитопатического эффекта. Индуцированная ОПП клеточная пролиферация может потенциально усилить инфекционность и повреждение канальцев SARS-CoV-2, что позволяет предположить, что раннее вмешательство при ОПП оправдано, чтобы помочь свести к минимуму почечную инфекцию.

Недавняя пандемия, вызванная коронавирусом тяжелого острого респираторного синдрома 2 (SARS-CoV-2), ответственным за коронавирусную болезнь 2019 (COVID-19), заразила >110 миллионов человек и привела к >2 500 000 смертей во всем мире, как от 18 июля 2020 года. 1 Хотя его основными проявлениями являются легочные ( например, , пневмония и острый респираторный дистресс-синдром), было показано, что вовлекаются и другие органы, одним из наиболее клинически значимых из которых являются почки. 2⇓⇓–5 Спектр поражения почек при COVID-19 широк и включает ОПП, гематурию, протеинурию и метаболический ацидоз. 6 В настоящее время ведутся споры о частоте и механизме поражения почек при COVID-19.В частности, неизвестно, является ли заболевание почек, связанное с SARS-CoV-2, результатом прямой инфекции почек или косвенных механизмов. Последние потенциально включают эндотелиальную дисфункцию с микрососудистым повреждением, 7 цитокиновый шторм, 8 и другие неспецифические этиологии ( например, , гипотонию и сепсис), которые характеризуют тяжелобольных пациентов, находящихся на ИВЛ. Действительно, как клинические, так и молекулярные исследования, связанные с повреждением почек, связанным с COVID-19, показали крайне противоречивые результаты.Что касается клинических проявлений, хотя ранние исследования в Китае сообщали о низкой (0,5–15%) заболеваемости ОПП у госпитализированных пациентов, 4 , 9 , 10 более поздние исследования в США указали на гораздо более высокую заболеваемость 37–57%. 2 , 3 Точно так же попытки раскрыть механизмы, лежащие в основе поражения почек при COVID-19, дали противоречивые результаты. Подтверждая прямое повреждение почек, несколько групп идентифицировали предполагаемые вирусные частицы в почечных канальцах с помощью электронной микроскопии 11⇓–13 и положительного иммуноокрашивания на вирус.Совсем недавно SARS-CoV-2 был выделен из аутопсийной почки, и было показано, что он инфицирует и размножается в нечеловеческих почечных клетках. 14 Кроме того, было показано, что человеческий ангиотензинпревращающий фермент 2 (ACE2), рецептор SARS-CoV-2, 15 в высокой степени экспрессируется в клетках почечных канальцев, 16 , 17 , что свидетельствует о потенциальном тропизме для почки. Напротив, другие группы показали, что антитело, используемое для обнаружения вируса, было неспецифическим, 18 , и поставили под сомнение природу частиц, обнаруженных с помощью электронной микроскопии, утверждая, что они на самом деле также неспецифичны. 19 , 20 Соответственно, несколько исследований либо не смогли обнаружить вирусную РНК в моче, либо обнаружили ее у очень небольшого числа пациентов. 21⇓–23 Следовательно, неизвестно, может ли SARS-CoV-2 инфицировать и размножаться в клетках почек. Что еще более важно, простое присутствие вируса в клетках почек не приравнивается к повреждению почек, которое еще труднее изучать у пациентов. Основным препятствием для ответа на эти ключевые вопросы является отсутствие модели болезни человека, которая повторяет инфекционные процессы с использованием клеток почек человека и позволяет нам исследовать вирусное воздействие на почки прямым и перспективным образом.Ранее мы разработали in vitro , трехмерную платформу для культивирования эпителиальных клеток почки человека, называемую почечными сфероидами (kSPH), которая позволяет поддерживать идентичность медленно пролиферирующих эпителиальных клеток почки, повторяющую нативную взрослую почку с точки зрения генов и выражение поверхностного маркера. 24 , 25 Здесь мы запросили клинические данные первых 36 последовательных пациентов в критическом состоянии с COVID-19, поступивших в Медицинский центр Шиба (SMC), и обнаружили, что все пациенты, у которых развился ОПП, также имели второе состояние, которое может объяснить ОПП, помимо самой инфекции SARS-CoV-2.Затем, чтобы проанализировать эффекты SARS-CoV-2, мы установили взрослые kSPH и монослои в качестве надежных моделей для изучения отношений хозяин-патоген в человеческом коронавирусе-229E (HCoV-229E) и SARS-CoV-2. Важно отметить, что клетки почки взрослого человека (hAK) содержат предопределенные повышенные уровни молекул IFN 1 типа по сравнению с эпителиальными клетками почек Vero E6, что может объяснять относительную защиту. Далее мы показываем, что, хотя в культурах почек человека не было отмечено никакого цитопатического эффекта/гибели клеток, пролиферирующие культуры были более склонны к инфицированию и проявляли повышенную регуляцию молекулярных маркеров канальцевого повреждения.Эти данные подрывают способность эпителиальных клеток почек Vero E6 служить надежной моделью взаимодействия почек и SARS-CoV-2. Поведение клеток ex vivo может предсказать специфическую уязвимость клеток почечных канальцев к SARS-CoV-2 после пролиферации клеток, вызванной острым канальцевым некрозом.

Методы

Дизайн исследования и участники

Мы провели одноцентровое ретроспективное когортное исследование пациентов, которые находились в критическом состоянии и были госпитализированы в специализированное отделение интенсивной терапии для пациентов с COVID-19 SMC (блок экстренной помощи при коронавирусе; CCCU). в марте-июне 2020 г.Это исследование было одобрено Институциональным наблюдательным советом SMC (7230-20-SMC).

Диагноз COVID-19 был установлен на основании положительного мазка из носоглотки, взятого при поступлении в стационар. Положительные образцы, взятые вне больницы, были подтверждены повторным тестированием перед поступлением в CCCU. Пациенты, которые находились в критическом состоянии с COVID-19, были определены как пациенты с дыхательной недостаточностью, требующей ИВЛ, шоком или недостаточностью органов, требующими лечения и наблюдения в отделении интенсивной терапии.

Сбор данных и определения

Мы использовали компьютеризированную систему SMC для идентификации всех пациентов, поступивших в CCCU в течение периода исследования. Затем мы провели поиск в электронных медицинских картах этих пациентов и извлекли их исходные характеристики, включая возраст при поступлении, пол, индекс массы тела и статус курения, а также любые серьезные сопутствующие заболевания (, например, , сахарный диабет, системная гипертензия, ХБП, хронические заболевания легких, ожирение [определяемое как индекс массы тела >30 кг/м 2 ], сердечно-сосудистые заболевания или активный рак).Кроме того, мы извлекли их непрерывные измерения основных показателей жизнедеятельности, хронические лекарства, результаты лабораторных исследований и списки медицинских назначений. Мы объединили задокументированные записи пациентов, ежедневные последующие осмотры и оценки, чтобы составить всеобъемлющий и тщательный набор данных. В частности, мы исследовали измерения АД, использование кристаллоидных жидкостей и вазопрессоров, почасовой и суточный диурез, а также состояние питания в течение дней, предшествующих диагностике ОПП, где это было возможно.

ОПП определяли в соответствии с рекомендациями по клинической практике, улучшающими глобальные исходы заболеваний почек. 26 Сепсис был определен ретроспективно как сочетание положительного результата посева крови (бактериального или грибкового) и клинических данных, свидетельствующих об органной недостаточности, в соответствии с рекомендациями рабочей группы Общества реаниматологии 2016 года. 27 Сердечно-сосудистый коллапс определялся как шок, вторичный по отношению к насосной недостаточности (острый инфаркт миокарда, фульминантный вирусный миокардит, некомпенсированная сердечная недостаточность или массивная легочная эмболия). Гипертония определялась в соответствии с рекомендациями Американского колледжа кардиологов/Американской кардиологической ассоциации по гипертонии от 2017 года. 28 Гипотензия определялась как систолическое АД <90 мм рт.ст. и/или диастолическое АД <60 мм рт.ст. Рабдомиолиз определяли, когда уровень креатинфосфокиназы превышал верхнюю границу нормы более чем в пять раз. Задержку мочи диагностировали с помощью ультразвукового исследования или при наличии объема >500 мл в мочевом мешке после катетеризации.

Почки плода человека, hAK и легкие взрослого человека

Почки плода человека (hFK) собирали при плановых абортах. Гестационный возраст плода колебался от 15 до 19 недель.Образцы hAK были извлечены из границ опухолей почечно-клеточного рака у пациентов, перенесших частичную нефрэктомию. Легочная ткань была получена из резекций легких человека. hFK, hAK и легочные ткани обрабатывали в течение 1 часа после процедур выскабливания или резекции соответственно. Согласно Хельсинкской декларации, все исследования были одобрены местными комитетами по этике, а информированное согласие было предоставлено законными опекунами пациентов. Собранные ткани разрезали на 0.5-сантиметровые кубики с помощью стерильных хирургических скальпелей. Клетки hAK и hFK выращивали, как описано ранее, 25 , 29 с использованием среды, содержащей сыворотку (SCM; модифицированная среда Дульбекко Iscove; Biological Industries, Kibbutz Beit-Haemek, Israel) с добавлением 10% FBS (Invitrogen). , 1% 100 М пенициллин-стрептомицина, 1% L-глютамина (оба куплены у Biological Industries), 100 нг/мл EGF, 100 нг/мл основного фактора роста фибробластов и 10 нг/мл фактора стволовых клеток (все факторы роста были приобретены от PeproTech Asia).

Формирование kSPH

Эпителиальные клетки почки человека (hKEpC) или клетки hFK выращивали в двух измерениях (2D). При достижении степени слияния 80–100% клетки собирали и высевали на чашки, предварительно покрытые поли(2-гидроксиэтилметакрилатом) (Sigma-Aldrich), в бессывороточной среде (SFM) в концентрации 5,5 × 10 4 –13 × 10 4 кл/мл. SFM включала среду N2 (Biological Industries) с добавлением 1% 100 М пенициллин-стрептомицина, 1% L-глутамина, 0.4% добавка B27 (Gibco), 4 мкг г/мл гепарина натрия (IntraMed), 1% заменимых аминокислот, 1% пируват натрия, 0,2% концентрат липидов химического состава (все приобретены у Invitrogen), 2,4 мг/мл глюкоза, 0,4 мг/мл трансферрина, 10 мг/мл инсулина, 38,66 мк 90 290 г/мл путресцина, 0,04% селенита натрия, 12,6 90 289 мк 90 290 г/мл прогестерона (все от Sigma-Aldrich), 10 нг/мл роста фибробластов фактора и 20 нг/мл EGF. kSPH были сфотографированы с помощью камер Nikon Eclipse TS100 и Nikon Digital Sight.После 7–10 дней культивирования kSPH собирали и диссоциировали путем инкубации с TrypLE (Gibco) в течение 10 минут. Затем производные kSPH клетки подсчитывали для дальнейших экспериментов. Для создания агарозных блоков и РНК собирали и центрифугировали среду, содержащую 2 миллиона клеток kSPH, и извлекали осадок kSPH.

Клеточные линии и вирусы

Клетки Vero E6 (CRL-1586; ATCC) выращивали в питательной среде (DMEM, содержащей 10% FBS, MEM заменимых аминокислот, 2 мМ l-глютамина, 100 ЕД/мл пенициллина, 0.стрептомицин 1 мг/мл, нистатин 12,5 ЕД/мл; все из биологической промышленности). Клетки культивировали при 37°С с 5% углекислым газом и при 95% влажности.

SARS-CoV-2 (инвентарный номер GISAID EPI_ISL_406862) был любезно предоставлен Институтом микробиологии Бундесвера (Мюнхен, Германия). Запасы вируса размножали (4 пассажа) и титровали на клетках Vero E6. Все работы с SARS-CoV-2 проводились в учреждении с уровнем биобезопасности 3 в соответствии с рекомендациями по биобезопасности Израильского института биологических исследований.

In Vitro Процедура вирусной инфекции
Адгезивные клетки

Первичные культуры клеток, полученных из hAK (hKEpC), культивировали на шестилуночных планшетах. В день заражения лунки промывали PBS и вносили 200 мкл мкл вирусного раствора (2 × 10 7 вирусных копий HCOV-229E или SARS-CoV-2 в СКМ с 2% FBS и без антибиотиков). добавлен. В контрольные лунки добавляли среду (200 мкл мкл) без вируса. Затем планшеты инкубировали при 35°C (для HCOV-229E) или 37°C (для SARS-CoV-2) в течение 2 часов.После инкубации лунки дважды промывали PBS и добавляли ростовую среду (SCM). Через 48 часов клетки собирали, удаляли 100 мкл мкл супернатанта и добавляли 200 мкл мкл тризола для анализа РНК. Осадок клеток суспендировали в 300 мкл мкл тризола для анализа РНК.

Сфероидные клетки

Первичные культуры сфероидов, полученных из почек взрослого человека (kSPH), культивировали на шестилуночных планшетах, покрытых поли(2-гидроксиэтилметакрилатом). В день заражения клетки собирали и центрифугировали.Оставшуюся среду удаляли, а осадок промывали PBS и снова центрифугировали. Затем осадок суспендировали либо с 200 90 289 мкл 90 290 л вирусного раствора (2 × 10 90 221 7 90 222 копий вируса в SFM без антибиотиков), либо с 200 90 289 мкл 90 290 мкл среды без вируса для контрольных лунок. Затем пробирки инкубировали при 35°C (для HCOV-229E) или 37°C (для SARS-CoV-2) в течение 2 часов. После инкубации клетки центрифугировали и промывали PBS, осадок возвращали в исходную лунку и добавляли свежий SFM.Клетки собирали и центрифугировали, удаляли 100 мкл мкл супернатанта и добавляли 200 мкл мкл тризола для анализа РНК. Осадок клеток суспендировали, используя 300 мкл мкл TRIzol для анализа РНК.

Выделение РНК и количественная ПЦР

Тотальную РНК готовили с использованием набора Direct-zol RNA MiniPrep (Zymo Research) в соответствии с инструкциями производителя. Количественную ПЦР в реальном времени (кПЦР) проводили, как описано ранее, 30 , с использованием следующих праймеров:

  • IRF7 , вперед, GCTGGACGTGACCATCATGTA; реверс, GGGCCGTATAGGAACGTGC;

  • USP18 , вперед, AACGTGCCCTTGTTTGTCCAA; реверс, GAGTCCTTCACCCGGATCGTA;

  • CCL5 , вперед, CCAGCAGTCGTCTTTGTCAC; реверс, CTCTGGGTTGGCACACACTT;

  • ACTB , вперед, CCACCATGTACCCTGGCATT; реверс, CGGACTCGTCATACTCCTGC;

  • ACE2 , вперед, CATTGGAGCAAGTGTTGGATCTT; реверс, GAGCTAATGCATGCCATTCTCA;

  • TMPRSS2, вперед, CAAGTGCTTCCAACTCTGGGAT; реверс, AACACACCGAATTCTCGTCCTC;

  • BSG, вперед, GAAGTCGTCAGAACACATCAACG; реверс, TTCCGGCGCTTCTCGTAGA; и

  • GAPDH, переадресация, ACAGTCAGCCGCATCTTCTT; реверс, GTTAAAAGCAGCCCTGGTGA.

Праймеры и зонды для количественной ПЦР для обнаружения SARS-CoV-2 N1 были получены с использованием набора разрешений CDC для экстренного использования 2019-nCoV (каталожный номер 10006606; Integrated DNA Technologies).

Иммуногистохимическое и иммунофлуоресцентное окрашивание трансплантатов, залитых в парафин

Парафиновые срезы (5 мкм мкм) предварительно обрабатывали раствором OmniPrep (Zytomed Systems) при 95°C в течение 1 часа в соответствии с протоколом производителя. Для иммуногистохимии (ИГХ) блокирование выполняли с использованием раствора CAS-Block (Invitrogen) в течение 20 минут, после чего инкубировали в течение 1 часа при комнатной температуре с первичными антителами анти-ACE2 (15348) и анти-CD147 (666; оба от Abcam ).Образцы инкубировали со вторичными антителами (ImmPRESS против мышиного/кроличьего реагента пероксидазы; Vector Laboratories, Burlingame, CA) в течение 30 минут при комнатной температуре и определяли с помощью набора ImmPACT DAB (Vector Laboratories) в соответствии с протоколом производителя. Для контрастного окрашивания использовали гематоксилин. Для иммунофлуоресценции срезы блокировали раствором CAS-Block (Invitrogen) в течение 1 часа, а затем инкубировали с первичными антителами, биотинилированным лектином тетрагонолобуса лотоса (Vector Laboratories), анти-EMA (247M-98; Cell Marque) и анти-CD13. (108382; абкам).Для обнаружения SARS-CoV-2 мы использовали гипериммунную кроличью сыворотку от кролика, инфицированного SARS-CoV-2 внутривенно. Затем срезы промывали и инкубировали со вторичными антителами в течение 1 часа, после чего наносили заливочную среду, содержащую 4′,6-диамидино-2-фенилиндол (Southern Biotech). Фотографии были получены с использованием флуоресцентного микроскопа Olympus BX51TF с камерой Olympus DP72 и стандартным программным обеспечением CellSens.

Пересадка мышам

В общей сложности 1 × 10 6 –2 × 10 6 kSPH были суспендированы в Matrigel (BD Biosciences) и имплантированы в подкожное пространство NOD-SCID возрастом от 8 до 10 недель. мышей.Трансплантаты собирали через 14 дней после инъекции, фиксировали в течение ночи в 4% забуференном параформальдегиде, а затем заливали в парафин.

Анализ секвенирования РНК

Для сравнения уровней экспрессии маркеров сегмента нефрона между клетками Vero E6 и hKEpC было рассчитано среднее значение log 2 (транскриптов на миллион [ТРМ]+1) для известных маркеров каждого обозначенного нефрона. ортолог сегмента. Значения TPM для клеток Vero E6 были получены из данных секвенирования РНК (RNA-seq), полученных для клеток Vero E6 Ogando et al. 31 (GSE153940; три контрольных образца). Значения TPM для hKEpC были получены из данных секвенирования РНК эпителиальных клеток 2D, полученных из почек взрослых, полученных Harari-Steinberg et al. 25 (GSE141257; четыре образца Adherent).

Статистический анализ

Сводные статистические данные по исследуемой группе выражались в виде среднего значения (SD) или процента. Для сравнения категориальных переменных использовался точный критерий Фишера, а для сравнения метрических непрерывных переменных применялся согласованный двухвыборочный тест t .Анализ вирусной нагрузки в среде с течением времени проводили посредством однофакторного ANOVA с апостериорной Тьюки апостериорной коррекцией. Двустороннее значение P <0,05 считалось статистически значимым.

Результаты

kSPH Экспрессируют рецепторы SARS-CoV-2 ACE2, TMPRSS2 и CD147

Чтобы оценить взаимодействие между SARS-CoV-2 и почками человека, мы попытались оценить влияние инфекции SARS-CoV-2 в модели in vitro почки человека.С этой целью мы решили использовать kSPH, которые, как было показано ранее, повторяют эпителиальные фенотипы и функции почек человека. 25 Первоначально, чтобы определить, может ли kSPH служить моделью для изучения взаимодействия хозяина и патогена в почках человека и SARS-CoV-2, мы оценили, экспрессируют ли они поверхностные маркеры, которые, как считается, служат рецепторами для SARS-CoV. -2: ACE2, 32 TMPRSS2, 33 и BSG (CD147). 34 Интересно, что kSPH экспрессировал значительно более высокие уровни как ACE2 , так и BSG и аналогичные уровни TMPRSS2 по сравнению с первичным 2D hKEpC, по оценке РНК-seq (рис. 1А).

Рисунок 1.

kSPH экспрессируют рецепторы SARS-CoV-2. (A) Относительная экспрессия гена, показанная как TPM ACE2 , TMPRSS2 и BSG в hKEpC, выращенном в монослое, и kSPH. (B) Иммуноокрашивание почек плода (FK) и почек взрослых (AK) и тканей легких на ACE2, TMPRSS2 и CD147. (C) Иммуноокрашивание kSPH, полученных из почек взрослого здорового донора (левая панель), пациента с ХБП (средняя панель) и из почек плода (правая панель) на ACE2, TMPRSS2 и CD147.(D) kSPH вводили подкожно мышам NOD-SCID, и трансплантаты анализировали через 14 дней на образование почечных тубулоидов. Показано иммунофлуоресцентное окрашивание маркера проксимальных канальцев лектина лотоса тетрагонолобуса (LTL; зеленый) и ACE2 (красный). DAPI, 4′,6-диамидино-2-фенилиндол. (Шкала: B: 100 мкм, C: 20 мкм, D: 20 мкм).

ИГХ-окрашивание почек взрослого и плода человека подтвердило устойчивую и широко распространенную тубулярную экспрессию ACE2, CD147 и TMPRSS2 на уровне белка, которая была сравнима с их экспрессией в легочной ткани (рис. 1В).Примечательно, что белки были локализованы в почечных канальцах и отсутствовали в клубочках, как описано ранее. 16 Подтверждая их сходство с нативной тканью почек взрослых, kSPH демонстрировали сильную экспрессию ACE2, CD147 и TMPRSS2 на уровне белка, независимо от того, был ли донор здоровым или пациентом с ХБП (рис. 1C). Интересно, что kSPH, полученный из почек плода, демонстрировал более низкие уровни экспрессии ACE2 (рис. 1C). Наконец, мы вводили kSPH подкожно мышам NOD-SCID, тем самым создавая человеческие тубулярные структуры, как описано ранее. 25 Окрашивание канальцевых структур на маркер проксимальных канальцев лектина lotus tetragonolobus и ACE2 продемонстрировало, что проксимальные канальцы экспрессируют ACE2 (рис. 1D), что согласуется с наблюдениями in vitro . В совокупности эти результаты демонстрируют, что kSPH напоминает нативную почку по экспрессии рецепторов SARS-CoV-2.

SARS-CoV-2 заражает kSPH и монослои

Впоследствии мы стремились установить прямую связь между инфекцией SARS-CoV-2 и поражением почек, наблюдаемым при COVID-19, путем проверки того, может ли SARS-CoV-2 инфицировать первичные клетки почек человека и kSPH, и приводит ли это к цитопатическому эффекту.Первоначально в качестве доказательства концепции мы оценили, могут ли hKEpC и kSPH быть инфицированы HCoV-229E, который представляет собой другой штамм коронавируса и распространенную причину вирусных инфекций верхних дыхательных путей. 35 Транскриптомные данные продемонстрировали сильную экспрессию рецептора CD13 HCoV-229E (ANPEP) как в hKEpC, так и в kSPH (рис. 2A), что было подтверждено на уровне белка с помощью иммунофлуоресцентного окрашивания (рис. 2B) взрослой ткани почки, hKEpC, kSPH и in vivo трубчатых структур, производных от них.Следовательно, мы инкубировали hKEpC и kSPH с HCoV-229E в течение 48 часов и оценивали уровень инфекции, на что указывали вирусные копии в среде, при этом клетки легкого человека первого пассажа служили в качестве положительного контроля. КПЦР продемонстрировала высокие уровни вирусной нагрузки во всех типах клеток, при этом уровни инфицирования hKEpC и kSPH были сопоставимы с уровнями клеток легких человека (рис. 2С).

Рисунок 2.

HCOV-229E инфицирует hKEpC и kSPH. (A) hKEpC и kSPH экспрессируют CD13 (ANPEP), который является рецептором для HCOV-229E.(B) Иммуноокрашивание CD13 тканей почек взрослых, hKEpC, kSPH и тубулоидов in vivo , полученных из них. (C) После заражения HCOV-229E, hKEpC и kSPH экспрессируют вирусную РНК на тех же уровнях, что и клетки легких человека (hLung). EMA, антиген эпителиальной мембраны; DAPI, 4′,6-диамидино-2-фенилиндол. (Шкала шкалы: B: 100 мкм).

Показав, что hKEpC и kSPH эффективно способствуют заражению HCoV-229E, мы затем попытались заразить оба типа культур SARS-CoV-2, количественно определив уровень инфекции в соответствии с общим количеством эквивалентов бляшкообразующих единиц в обоих среда и клетки, измеренные с помощью количественной ПЦР через 48 часов после заражения (рис. 3А).Интересно, что и hKEpC, и kSPH продемонстрировали значительное увеличение вирусной РНК как в клетках, так и в среде (рис. 3А). Кроме того, мы измерили уровни вируса в культуральной среде клеток hKEpC, kSPH и Vero E6, сравнив общее количество бляшкообразующих единиц в неинфицированных клетках по сравнению с инфицированными клетками в день 0 и день 1. Мы обнаружили значительное увеличение уровней вируса в 24 дня. часов во всех типах клеток (рис. 3B). Примечательно, что эти уровни инфекции аналогичны (kSPH) или выше (hKEpC), чем те, которые, как сообщается, приводят к функциональным цитопатическим эффектам в других типах клеток. 36 Затем мы протестировали субгеномную РНК, чтобы проверить репликацию вируса. Мы могли видеть высокие уровни вирусной субгеномной РНК в инфицированной группе как в hKEpC, так и в kSPH (рис. 3C), что подтверждает вирусную инфекцию. Для обнаружения SARS-CoV-2 с помощью иммунного окрашивания мы использовали гипериммунную кроличью сыворотку от кролика, инфицированного SARS-CoV-2 внутривенно. Мы могли видеть присутствие вируса как в hKEpC, так и в kSPH, а также в клетках Vero E6, которые служили положительным контролем (рис. 3D).

Рисунок 3.

SARS-CoV-2 инфицирует hKEpC и kSPH.(A) Количественная оценка вирусной нагрузки в среде и в hKEpC и kSPH через 48 часов после заражения SARS-CoV-2. (B) Количественная оценка вирусной нагрузки в среде в день заражения и через 24 часа после заражения. (C) ПЦР в реальном времени вирусной субгеномной РНК через 48 часов после инфицирования в hKEpC и kSPH. (D) Обнаружение SARS-CoV-2 в клетках hKEpC, kSPH и Vero E6 путем иммуноокрашивания с использованием гипериммунной кроличьей сыворотки от кролика, инфицированного SARS-CoV-2 внутривенно. * Р <0,05. Д0, день 0; Д1, день 1; DAPI, 4',6-диамидино-2-фенилиндол; БОЕ, бляшкообразующие единицы.(Масштабная линейка: D: 200 мкм).

SARS-CoV-2 не вызывает цитопатического эффекта, но может вызывать изменения в молекулах, поражающих почки любые узнаваемые морфологические изменения, наблюдаемые с помощью световой микроскопии, даже при инфицировании с использованием очень высоких титров вируса (множественность = 4–8; рис. 4А). Это проявление наблюдалось и при более длительном заражении клеток, 72 часа, и тестировании жизнеспособности клеток.Эти результаты показывают, что, хотя инфицированные клетки Vero E6 демонстрируют значительно сниженную жизнеспособность, hKEpC и kSPH не обнаруживают различий в жизнеспособности при заражении (рис. 4B). Важно отметить, что хотя клетки Vero E6 первоначально были получены из почек обезьян, экспрессия различных специфических для почек маркеров была незначительной по сравнению с нативной почкой человека, что указывает на очень низкое сходство с первичными клетками почки человека (рис. 4C). Кроме того, мы могли наблюдать активацию генов

IRF7 , USP18 и CCL5 , которые активируются во время вирусной инфекции, 37⇓–39 , особенно в hKEpC (рис. 4D).Впоследствии, чтобы оценить, могут ли вредные эффекты быть очевидными на молекулярном уровне, мы проверили влияние инфекции на экспрессию генов, связанных с повреждением канальцев. Таким образом, мы провели количественный ПЦР-анализ генов, связанных с фиброзом, и тех, которые вовлечены в ответ канальцев на повреждение, который включает дедифференцировку и эпителиально-мезенхимальный переход. 40 В kSPH мы не обнаружили существенных изменений, подразумевая, что во время стационарного состояния, как это отражено в состоянии покоя kSPH, в результате инфекции не происходит молекулярного повреждения.Поскольку COVID-19 часто приводит к ОПП, во время которого клетки почек переходят в пролиферативное состояние, мы затем проверили, будут ли 2D hKEpC, которые более пролиферативны и, следовательно, больше напоминают поврежденную почку, будут демонстрировать молекулярные доказательства повреждения. Действительно, мы обнаружили увеличение нескольких генов, связанных с фиброзом ( STAT6 и COL1A1 ), и увеличение гена SNAI2 , что свидетельствует об эпителиально-мезенхимальном переходе и повреждении почечных канальцев (Рисунок 4E, верхний график).Соответственно, мы обнаружили подавление маркера проксимальных канальцев LRP2 , что указывает на временную потерю эпителиальной идентичности (, т.е. , дедифференцировка), типичную для ОПП. Взятые вместе, эти результаты показывают, что, хотя почки в устойчивом состоянии допускают проникновение и пролиферацию вируса, это не приводит к повреждению клеток. Напротив, в более пролиферативном состоянии, как это происходит при ОПП, репликация вируса усиливается и, соответственно, можно увидеть молекулярные признаки повреждения.

Рисунок 4.

SARS-CoV-2 вызывает молекулярные изменения, связанные с повреждением почек в hKEpC и kSPH, без признаков цитопатического эффекта. (A) Морфология клеток hKEpC и Vero E6, инфицированных SARS-CoV-2, по сравнению с неинфицированными клетками. (B) Жизнеспособность клеток hKEpC, kSPH и Vero E6 через 72 часа после заражения по сравнению с неинфицированными клетками. (C) Графики, представляющие средние уровни экспрессии (log 2 [TPM+1]) маркеров сегмента нефрона в клетках Vero E6 и hKEpC на основе данных секвенирования РНК.Гены сегмента нефрона подавляются в клетках Vero E6 по сравнению с их человеческими ортологами, hKEpC. (D) Относительная экспрессия генов, связанных с ответом на IFN 1 типа, в инфицированных hKEpC по сравнению с kSPH. (E) Относительная экспрессия генов, связанных с повреждением почечных канальцев. CD, собирательный канал; DCT, дистальный извитой каналец; LOH, петля Генле; PT, проксимальный каналец.

Заражение SARS-CoV-2 приводит к активации пути ответа на интерферон 1 типа в клетках почек человека цитопатическое поражение.Поскольку недавние сообщения показали, что ответ IFN 1 типа играет ключевую роль в иммунном ответе пациентов с COVID-19,

41⇓–43 мы сравнили активность этого пути в клетках почек человека (hKEpC и kSPH) и Vero E6. клеток, которые демонстрируют значительные цитопатические эффекты при заражении SARS-CoV-2.

Интересно, что мы обнаружили значительную активацию нескольких генов, связанных с активацией реакции IFN 1 типа в hKEpC и kSPH, по сравнению с клетками Vero E6 (рис. 5), включая IRF7, IRF8 и STAT2.

Рисунок 5.

SARS-CoV-2 активирует ответ IFN типа 1 в клетках почек человека. (A) Гистограммы, показывающие средние уровни экспрессии (log 2 [TPM+1]) генов, связанных с термином Gene Ontology «ответ на IFN 1 типа» (0034340) в клетках Vero E6, hKEpC и kSPH из РНК- сл. Эти гены подавляются в клетках Vero E6 по сравнению с их человеческими аналогами, hKEpC и kSPH. (B) Представление 15 генов, демонстрирующих самые высокие уровни экспрессии в клетках hKEpC, kSPH и Vero E6.

Клинические данные не подтверждают основную роль первичного повреждения почек в ОПП, вызванном COVID-19 -19 поступили в CCCU в нашем учреждении в период с марта по июнь 2020 года. В дополнительной таблице 1 показаны исходные характеристики этих пациентов. Средний возраст ± стандартное отклонение в когорте составил 60,9 ± 14,9 года, и большинство пациентов были мужчинами (83,9 года).3%). Все больные находились на ИВЛ, 47,3% умерли во время госпитализации. Приблизительно две трети (61,1%) пациентов (22 из 36) имели ОПП во время госпитализации, в среднем через 4 дня. Из этих пациентов у 36,4% (8 из 22) было ОПП при поступлении, а у 65,6% (14 из 22 пациентов) ОПП развилось во время госпитализации (дополнительная таблица 2). В попытке дифференцировать ОПП, возникающее в результате прямого вирусного поражения, и ОПП, вторичного по отношению к другим факторам, мы запросили медицинские записи на предмет возможных инсультов, вызывающих ОПП, кроме инфекции COVID-19, предшествующих появлению ОПП.К ним относятся длительная гипотензия, гиповолемия, шок (септический [не связанный с COVID-19], кардиогенный, обструктивный, геморрагический), воздействие нефротоксичных препаратов, рабдомиолиз и постренальная обструкция. Интересно, что у всех восьми пациентов с ОПП при поступлении была зарегистрирована гиповолемия и обезвоживание за несколько дней до госпитализации. Аналогичным образом, в группе ОПП у большинства пациентов отмечалась артериальная гипотензия до ухудшения функции почек (86,4%, 19 из 22 пациентов). Из пациентов с ОПП 27.У 3% (шесть из 22) ОПП развилась в течение нескольких часов после интубации. Более того, у 40,1% пациентов (девять из 22) сепсис был диагностирован до ОПП, а у 27,3% (шесть из 22) до ОПП был сердечно-сосудистый коллапс (дополнительная таблица 2). В совокупности в нашей когорте пациентов с COVID-19, находящихся в критическом состоянии, развитию ОПП всегда предшествовал явный этиологический фактор, отличный от инфекции COVID-19. В совокупности это указывает на то, что прямая вирусная инфекция не является причиной ОПП у этих пациентов, что согласуется с предыдущими отчетами и результатами исследования

in vitro , хотя мы отмечаем, что размер когорты слишком мал, а определение этиологии ОПП слишком мало. субъективно, чтобы делать определенные выводы.

Обсуждение

Хотя отличительной чертой нынешней пандемии COVID-19 является поражение легких, было показано, что в нее вовлечены и различные системы органов. Согласно двум недавним метаанализам, частота ОПП составляет 8–9%, 44 , 45 ОПП является особенно загадочным аспектом COVID-19, при этом механизм повреждения представляет собой нерешенную проблему.

Одним из основных препятствий на пути к расшифровке основных механизмов повреждения почек при COVID-19 является необходимость в надежной клеточной модели, которая может позволить прямую оценку инфекции на клетках hAK.Примечательно, что в большинстве исследований использовались разные клеточные линии, как человеческие, так и нечеловеческие, что дало противоречивые результаты. Например, хотя инфицирование клеточных линий обезьяны Vero и Vero E6 приводило к цитопатическому эффекту, 46 , 47 клеточные линии MDCK 47 собаки и человека 293 48 не были затронуты. Точно так же недавнее исследование, в котором сообщалось о выделении SARS-CoV-2 из аутопсийной почки, основывалось на клетках почек приматов, а не на клетках почек человека, чтобы проверить способность вируса к репликации. 14

Важно отметить, что как монослой hKEpC, так и трехмерный kSPH поддерживают инфицирование и репликацию SARS-CoV-2. Однако это не приводит ни к цитопатическому эффекту, ни к серьезному повреждению клеток, что явно проявляется в клетках Vero E6. Мы обнаружили высокие базовые уровни молекул, связанных с ответом на IFN 1 типа, связанных с транскриптомами hKEpC и kSPH до заражения, по сравнению с таковыми в клетках Vero E6. IFN-ответ типа 1 был предложен в качестве клеточного средства для борьбы с вирус-индуцированной цитопатией , 42, , , , , 49, , и, следовательно, это наблюдение может заложить основу для уровня цитопатического ответа/ответа на повреждение клеток в культурах почек человека. раз заразился.В целом эти данные, показывающие отсутствие глубоких клеточных эффектов, согласуются с нашей клинической информацией, полученной от первых 36 пациентов, лечившихся в отделении интенсивной терапии (см. Дополнительную таблицу 2), которая демонстрирует, что ОПП имеет вторичную этиологию.

Потребуется дальнейшая работа, чтобы определить, почему, несмотря на эффективную инфекцию и репликацию SARS-CoV-2 в клетках почек человека, не наблюдается цитопатического повреждения. Примечательно, что сходные уровни вирусных титров вызывают значительные цитопатические эффекты в других органах, таких как сердце 36 ; однако успешное инфицирование органоидов легких человека, моделирующих первичный очаг вирусной инфекции, как in vitro , так и in vivo , не приводило к цитопатическому эффекту. 50 Как предполагается, одним из возможных объяснений является более сильная и эффективная активация противовирусных клеточных путей, таких как сигнальный путь IFN, который, как недавно предполагалось, обладает мощной активностью против SARS-CoV-2. 42 , 43 , 49 Кроме того, учитывая значительное повреждение сосудов, наблюдаемое у пациентов с COVID-19, было бы интересно оценить воздействие вируса с использованием более сложных моделей, включающих как почки, так и сосудистые компартменты (DOI: https://doi.org/10.1681/ASN.20108).

Тем не менее, после вирусной инфекции молекулярная оценка молекул повреждения, индуцированных во время ОПП, таких как STAT6 , COL1A1 и SNAI2 , показала значительное повышение, в то время как LRP2 был снижен, что указывает на то, что более тонкие повреждения могут возникать после вирус заражает и размножается. Эти изменения были наиболее очевидны в культурах hKEpC. Интересно, что тщательное сравнение kSPH и монослоев показало, что последние поддерживают более высокую инфекционность/репликацию и более выраженное повышение уровня молекул, связанных с инфекцией SARS-CoV-2, таких как IRF7, USP18 и CCL5.

kSPH и hKEpC представляют две противоположные стороны спектра. 25 При hKEpC диссоциированная ткань почки человека, однажды помещенная в культуру и выращенная в виде монослоя, демонстрирует потерю покоя, пролиферацию и частичную дедифференцировку — каскад событий, происходящих при ОПП.

Напротив, kSPH больше напоминает клеточный состав компартментов почечных канальцев, как ранее было показано с помощью транскриптомики и анализа белков. 24 , 25 Подобно нативной почке взрослого человека, kSPH содержат эпителиальные клетки с низкой цикличностью.Хотя они экспрессируют высокий уровень молекул проникновения вируса и поддерживают инфекцию и репликацию, доказательства значительного повышения количества молекул, связанных с повреждением канальцев, связанных с ОПП, не были очевидны. Таким образом, дихотомия между культуральными моделями может указывать на возможный сценарий, при котором прямая вирусная инфекция не вызывает значительного повреждения почечных канальцев, но как только происходит индуцированная ОПП пролиферация клеток из-за множества других этиологий, вирусная инфекция и репликация могут усиливаться. повреждение, приводящее к дальнейшей дедифференцировке, потере клеточной идентичности и профиброзному состоянию.

Наконец, возможность генерировать аналогичные культуры из мочи может позволить использовать этот подход для персонализированной и точной медицины путем культивирования собственных клеток пациента неинвазивным способом. Это может помочь ответить на некоторые из нерешенных вопросов, связанных с вовлечением почек в COVID-19, в отношении возраста, пола и этнического происхождения, а также последствий существовавшей ранее ХБП.

Раскрытие информации

Б. Декель сообщает, что владеет долей участия в KidneyCure в качестве учредителя и акционера; наличие патентов и изобретений с SMC; и выступая в качестве научного консультанта или члена редакции Stem Cells Translational Medicine, Stem Cell Reports и Платформы регенеративной медицины Великобритании.Всем остальным авторам нечего раскрывать.

Финансирование

Это исследование было поддержано Семейным фондом Лизы и Дэвида Пулвер, грантом 2071/17 Израильского научного фонда, грантом KAMIN 61910 Управления инноваций Израиля и Евроазиатским еврейским конгрессом.

  • Copyright © 2021 Американского общества нефрологов (SARS-CoV-2, ранее условно называвшийся новым коронавирусом 2019 года или 2019-nCoV) с декабря 2019 года в Ухане, Китай, стал чрезвычайной ситуацией, вызывающей серьезную международную озабоченность.Помимо дыхательной системы, неясно, может ли SARS-CoV-2 также напрямую заражать другие ткани, такие как почки, или вызывать острую почечную недостаточность.

    МЕТОДЫ Мы провели ретроспективный анализ расчетной скорости клубочковой фильтрации (рСКФ) вместе с другими клиническими параметрами у 85 пациентов с лабораторно подтвержденным COVID-19, поступивших в больницу в Ухане с 17 января 2020 г. по 3 марта 2020 г. Ткани почек шести пациентов при патологоанатомическом исследовании были проанализированы с помощью гематоксилина и эозина (H&E) и in situ экспрессии антигена вирусного нуклеокаспидного белка (NP), маркеров иммунных клеток (CD8, CD68 и CD56) и комплемента C5b-9. методом иммуногистохимии.Кроме того, вирусные частицы в почках также исследовали с помощью просвечивающего электронного микроскопа (ЭМ).

    РЕЗУЛЬТАТЫ У 27,06% (23/85) пациентов развилась острая почечная недостаточность (ОПН). У пациентов пожилого возраста и пациентов с сопутствующими заболеваниями, такими как артериальная гипертензия и сердечная недостаточность, легче развивалась ОРЛ (65,22% vs 24,19%, p < 0,001; 69,57% vs 11,29%, p < 0,001 соответственно). Окрашивание гематоксилин-эозином продемонстрировало, что почечные ткани после вскрытия имеют тяжелый острый тубулярный некроз и лимфоцитарную инфильтрацию.Иммуногистохимия показала, что антиген NP SARS-CoV-2 накапливался в почечных канальцах. ЭМ-наблюдение также показало, что в почках видны вирусоподобные частицы. Вирусная инфекция не только индуцирует инфильтрацию макрофагов CD68 + в тубулоинтерстиций, но также усиливает отложение комплемента C5b-9 в канальцах.

    ВЫВОДЫ SARS-CoV-2 вызывает ОРЛ у пациентов с COVID-19. Вирусы напрямую инфицируют канальцы почек человека, вызывая острое повреждение канальцев. Вирусы не только обладают прямой цитотоксичностью, но также инициируют макрофаги CD68 + вместе с отложением комплемента C5b-9, опосредуя канальцевый патогенез.

    Заявление о конкурирующих интересах

    Авторы заявили об отсутствии конкурирующих интересов.

    Заявление о финансировании

    Финансирующие агентства не участвовали в разработке плана исследования, сборе данных, анализе данных или написании рукописи.

    Декларации авторов

    Соблюдены все соответствующие этические принципы; были получены все необходимые одобрения ЭСО и/или комитета по этике, и подробная информация о ЭСО/надзорном органе включена в рукопись.

    Да

    Все необходимые согласия пациента/участника были получены, и соответствующие институциональные формы были заархивированы.

    Да

    Я понимаю, что все клинические испытания и любые другие проспективные интервенционные исследования должны быть зарегистрированы в утвержденном ICMJE реестре, таком как ClinicalTrials.gov. Я подтверждаю, что любое такое исследование, указанное в рукописи, было зарегистрировано, и предоставлен идентификатор регистрации исследования (примечание: если публикуется проспективное исследование, зарегистрированное ретроспективно, укажите в поле идентификатора исследования заявление, объясняющее, почему исследование не было зарегистрировано заранее) .

    Да

    Я выполнил все соответствующие инструкции по отчетности об исследованиях и загрузил соответствующие контрольные списки отчетов об исследованиях сети EQUATOR и другие соответствующие материалы в качестве дополнительных файлов, если это применимо.

    Да

    Доступность данных

    В целях защиты конфиденциальности пациентов все данные, используемые во время исследования, предоставляются только в обезличенной версии.

    американских хирургов успешно испытали трансплантацию почки свиньи на пациенте-человеке прогресс, который в конечном итоге может помочь уменьшить острую нехватку человеческих органов для трансплантации.

    Процедура, проведенная в NYU Langone Health в Нью-Йорке, включала использование свиньи, чьи гены были изменены таким образом, что ее ткани больше не содержали молекулы, которая, как известно, вызывает почти немедленное отторжение.

    Реципиентом была пациентка с мертвым мозгом и признаками почечной дисфункции, семья которой дала согласие на эксперимент до того, как ее должны были отключить от системы жизнеобеспечения, сообщили исследователи агентству Reuters.

    Зарегистрируйтесь сейчас и получите БЕСПЛАТНЫЙ неограниченный доступ к Reuters.com

    Зарегистрируйтесь

    В течение трех дней новая почка была прикреплена к ее кровеносным сосудам и находилась вне ее тела, что дало исследователям доступ к ней.

    Прервано

    Проект Alphabet’s Wing представит новую модель доставки дронами в Техасе

    Объяснитель: Что такое «метавселенная»?

    ИИ может видеть вас насквозь: язык руководителей под микроскопом

    Результаты тестирования функции пересаженной почки «выглядели вполне нормально», сказал хирург-трансплантолог доктор Роберт Монтгомери, который руководил исследованием.

    Почка произвела «количество мочи, которое можно было бы ожидать» от трансплантированной человеческой почки, сказал он, и не было никаких доказательств энергичного раннего отторжения, наблюдаемого при трансплантации немодифицированных почек свиньи нечеловекообразным приматам.

    Хирургическая бригада исследует почку свиньи на наличие каких-либо признаков острого отторжения, так как орган был имплантирован вне тела для наблюдения и взятия образцов ткани в течение 54-часового периода исследования в NYU Langone в Нью-Йорке, США, в этом раздаточное фото без даты. Джо Карротта для NYU Langone Health / Раздаточный материал через REUTERS.

    Подробнее

    Аномальный уровень креатинина у реципиента — показатель плохой функции почек — вернулся к норме после трансплантации, сказал Монтгомери.

    По данным United Network for Organ Sharing, в Соединенных Штатах в настоящее время около 107 000 человек ожидают трансплантации органов, в том числе более 90 000 человек ожидают пересадки почки. Время ожидания почки в среднем составляет от трех до пяти лет.

    Исследователи десятилетиями работали над возможностью использования органов животных для трансплантации, но не знали, как предотвратить немедленное отторжение человеческим организмом.

    Команда Монтгомери предположила, что удаление у свиньи гена углевода, вызывающего отторжение – молекулы сахара или гликана, называемого альфа-гал, – могло бы предотвратить проблему.

    Генетически измененная свинья, получившая название GalSafe, была разработана подразделением Revivicor United Therapeutics Corp (UTHR.O). Он был одобрен Управлением по санитарному надзору за качеством пищевых продуктов и медикаментов США в декабре 2020 года для использования в качестве пищи для людей с аллергией на мясо и в качестве потенциального источника лекарственных средств для человека. Агентство заявило, что

    Медицинские продукты, разработанные на основе свиней, по-прежнему требуют специального одобрения FDA, прежде чем их можно будет использовать у людей.

    Другие исследователи рассматривают вопрос о том, могут ли свиньи GalSafe быть источником чего угодно, от сердечных клапанов до кожных трансплантатов для пациентов-людей.

    Эксперимент по трансплантации почки NYU должен проложить путь для испытаний у пациентов с почечной недостаточностью на терминальной стадии, возможно, в ближайшие год или два, сказал Монтгомери, сам реципиент трансплантата сердца. Эти испытания могут проверить подход в качестве краткосрочного решения для пациентов в критическом состоянии, пока не станет доступной человеческая почка, или в качестве постоянного трансплантата.

    Текущий эксперимент включал одиночную трансплантацию, и почка оставалась на месте всего три дня, поэтому любые будущие испытания, вероятно, откроют новые барьеры, которые необходимо будет преодолеть, сказал Монтгомери.Участниками, вероятно, будут пациенты с низкими шансами получить человеческую почку и плохим прогнозом на диализе.

    «Для многих из этих людей смертность столь же высока, как и при некоторых видах рака, и мы не задумываемся об использовании новых лекарств и проведении новых испытаний (на больных раком), когда это может дать им пару месяцев больше жизни», — сказал Монтгомери.

    Добавить комментарий

    Ваш адрес email не будет опубликован.