Салициловая кислота левомицетин метронидазол: Болтушка от прыщей. Рецепт дерматолога с Левомицетином и Салициловой кислотой. Как приготовить и использовать

Содержание

Болтушка от прыщей. Рецепт дерматолога с Левомицетином и Салициловой кислотой. Как приготовить и использовать

Среди косметических продуктов широко представлены средства для борьбы с прыщами. Но проверенным способом избавления от прыщей выступает и простая болтушка, которую можно приготовить самостоятельно, не выходя из дома. Рецепт этого средства подберет дерматолог после определения индивидуальных особенностей кожи.

Как выглядит болтушка

Болтушка от прыщей (рецепт дерматолога необходимо отнести в аптеку) имеет непрезентабельный вид. Она готовится по индивидуальному рецепту и отпускается из аптеки в стеклянной банке. При покупке можно заметить, что консистенция болтушки имеет мутноватый вид. Перед использованием состава его нужно взбалтывать, чтобы активизировать и смешать все компоненты воедино.

Внешний вид состава не важен, главное, его эффективность.

Эффективность

Используя болтушку от прыщей, приготовленную по рецепту дерматолога, можно заметить ее выраженное дезинфицирующее действие. С первого применения наблюдается значительное уменьшение воспалительного процесса.

Болтушка от прыщей эффективно очищает и омолаживает кожу

Прыщи быстро подсыхают, кожа становится чистой, без лишнего  жирного блеска. Поры основательно очищаются от сальных пробок. Во время курса заметно уменьшается количество воспаленных прыщей, кожа приобретает очищенный и здоровый вид.

Что входит в состав

В состав готовой болтушки от прыщей от дерматолога входит:

  • антибиотик – он необходимо для снятия воспалительного процесса. Также он способствует уничтожению патогенной флоры и эффективен в борьбе с имеющейся инфекцией. Часто используют Банеоцин, Левомицетин, Эритромицин;
  • антисептик – в смесь добавляют борную либо салициловую кислоту, оксид цинка, серу и стрептоцид;
  • чтобы добиться антибактериального эффекта, используется Трихопол, Аспирин, Метрогил. Они противостоят размножению опасных бактерий.

Нужен ли рецепт

Посетить дерматолога необходимо для достижения нужного эффекта от болтушки против прыщей. Обязательно следует выявить происхождение патологии.

После этого по индивидуальному  рецепту заказывают изготовление состава. Такую услугу предоставляют в некоторых аптечных пунктах. Однако люди, страдающие от прыщей, могут изготовить данное средство и самостоятельно, следуя инструкции и соблюдая пропорции, указанные в рецепте от дерматолога.

Особенности приготовления

Чтобы болтушка от прыщей по рецептуре дерматолога получилась действенной, во время приготовления необходимо соблюдать перечень рекомендаций.

К таким рекомендациям принадлежат:

  • твердые составляющие рецепта перед приготовлением измельчают до порошкообразного состояния в ступке, кофемолку или блендер не используют;
  • жидкие ингредиенты смешивают в отдельной таре, после чего подсыпают с постоянным перемешиванием сыпучие составляющие;
  • хранить приготовленную смесь рекомендуется исключительно в стеклянной таре в защищенном от воздействия тепла и света месте;
  • после того как болтушка готова, необходимо ей дать постоять несколько часов при комнатной температуре, периодически встряхивая;
  • если болтушка готовится впервые, то лучше ограничиться малыми объемами, так как состав может не подойти.

Болтушка с календулой – рецепт

Календула, по-другому ее называют ноготками, оказывает агрессивное воздействие на кожу. Тем, у кого наблюдается склонность к сухости или к повышенной чувствительности кожи, лучше всего отказать от данного рецепта и подобрать что-то другое совместно с лечащим врачом-дерматологом.

Для изготовления болтушки по данному рецепту потребуется:

Календула (спиртовой настой)Дистиллированная водаАспирин (таблетки)Левомицетин (таблетки)
50 мл150 мл5 шт.5 шт.

Настойку и воду нужно перемешать, добавив к ним заранее измельченные в ступке таблетки Левомицетина. Вся масса хорошо перемешивается и настаивается в течение двух дней в темном месте. Использовать состав следует в виде лосьона перед отходом ко сну. Утром после подъема следует обязательно умыться теплой проточной водой.

Противовоспалительная с Левомицетином и салициловой кислотой

Понадобятся следующие ингредиенты:

СпиртБорная кислотаСалициловая кислотаТаблетки Левомицитина
50 мл50 мл50 мл10 шт.

Жидкие ингредиенты нужно перемешать в стеклянной банке и добавить заранее растолченные таблетки Левомицетина. 

Составом обтирают лицо перед сном без последующего смывания.

С Трихополом

Для приготовления болтушки потребуется:

Спирт (водка)Трихопол (таблетки)
1 стакан4 шт.

Смешав ингредиенты в стеклянном сосуде, нужно убрать его в место, куда не поступает свет, для того, чтобы болтушка настоялась. Обязательно периодически проводят встряхивающие манипуляции для перемешивания и растворения ингредиентов.

Места, где образовались прыщи, протирают смоченным в составе ватным диском, а после того, как пройдет 5 минут, обрабатывают кожу кремом с эффектом увлажнения.

От красных прыщей с серой и стрептоцидом

Нужно взять:

Салициловая кислота (2%)СтрептоцидСераСпирт (борный)
50 мл1,5 ч. л.1,5 ч. л.50 мл

Все составляющие необходимо перемешать и нанести вбивающими движениями с помощью ватного диска на предварительно очищенную кожу. По прошествии 5 минут на кожу наносят крем для увлажнения.

С эритромицином и цинком

Нужно подготовить:

Спирт (салициловый)Кислота (борная)Оксид цинкаЭритромицин
50 мл50 мл1 ч. л.1 ч. л.

Все ингредиенты перемешивают и полученный состав наносят перед сном на участки, где  локализовались прыщи. После обработки обязательно наносят крем, чтобы увлажнить кожные покровы. Не стоит злоупотреблять этим лосьоном, так как может возникнуть привыкание к компонентам, а антибиотик уничтожит защитный барьер кожи.

С Левомицетином и камфорным спиртом для сухой кожи

Этот рецепт болтушки против угревой сыпи поможет побороть мелкие высыпания.

Для приготовления потребуется взять:

Спирт камфорыТаблетки стрептоцидаКислота (салициловая 2%)Левомицетин (таблетки)
80 мл10 шт.50 мл4 шт.

Все компоненты следует тщательно смешать и использовать состав как лосьон на ночь. После каждого применения лицо увлажняют кремом.

С Димексидом от угрей и комедонов

Для приготовления потребуется:

ДимексидДоксициклин (таблетки)Дистиллированная вода
50 мл20 шт.150 мл

Заранее измельченные таблетки необходимо смешать с Димексидом и оставить настояться в течение суток, периодически взбалтывая состав.

Когда пройдет нужное количество времени, в смесь следует добавить воду и интенсивно взболтать жидкость. Лечить прыщи данным составом рекомендовано не более 20 дней.

От гнойников с Метронидазолом

Метронидазол (таблетки)Левомицетин (таблетки)Кислота (борная)Водка (спирт)
10 шт.10 шт.2 ч. л.300 г

И те и другие таблетки нужно растереть в порошок и перемешать с остальными ингредиентами. Затем составу дают настояться в течение нескольких часов.

Наносить средство следует перед сном на очищенное лицо с помощью ватного диска.

С активированным углем

Для приготовления понадобится:

Календула (спиртовой настой)Уголь активированныйЛевомицетин (таблетки)Аспирин (таблетки)
70 мл5 шт.3 шт.3 шт.

Таблетки необходимо заранее измельчить в порошок, смешать с остальными составляющими. Жидкость наносят на очищенную кожу лица.

Инструкция по применению

Перед тем как болтушку от прыщей, приготовленную по рецепту дерматолога, нанести на лицо необходимо выполнить подготовительные действия. Для начала лицо нужно умыть, лучше всего для его очищения подойдет дегтярное мыло. Причем в продаже имеется мыло с различными добавками в виде увлажнителей – такое мыло не подходит. Обязательно нужно приобретать чистое мыло, без посторонних примесей.

Болтушку нужно наносить два раза в день, чтобы быстрее получить эффект. Операцию нанесения выполняют осторожно, с помощью ватного диска, не затрагивая кожу возле глазниц.

Кроме борьбы с прыщами, болтушку применяют для общей тонизации кожи и в качестве местного антисептика.

Меры предосторожности

Болтушка от прыщей имеет множество положительных отзывов и является эффективным средством в борьбе с прыщами.

Но нужно понимать, что из-за входящих в состав медикаментов при применении смеси необходимо соблюдать меры предосторожности:

  1. Нельзя в период лечения использовать плотный тональный крем, он закупорит поры, создаст благоприятную среду для развития воспалений, и эффект от применения лекарственного средства будет слабо выраженным.
  2. Не рекомендуется использовать болтушку во время вынашивания ребенка.
  3. Перед применением нового состава обязательно нужно провести тест на аллергию.

Противопоказания

Болтушку от прыщей по рецепту дерматолога допустимо применять не всегда. От нее необходимо отказаться:

  • при повышенной чувствительности к компонентам, которые входят в состав болтушки;
  • в период вынашивания ребенка, независимо от сроков.

Побочные эффекты

Применяя болтушку от прыщей, необходимо помнить о побочных действиях, так как в ее составе содержится большое количество сильнодействующих  компонентов, которые могут нарушить кислотно-щелочной баланс кожи.

Необходимо прекратить использование болтушки, если наблюдаются следующие кожные изменения:

  • повышенная сухость кожи;
  • появление раздражения;
  • повышенное шелушение;
  • ожоги химического происхождения;
  • чрезмерная засаленность кожи.

Можно ли применять при беременности

Болтушку от прыщей по индивидуальному рецепту дерматолога недопустимо применять в период вынашивания ребенка. Это связано в первую очередь с тем, что в ее состав входят лекарственные средства, которые противопоказаны в период  беременности.

Кроме того, в связи с изменениями в организме, с наступлением беременности могут возникнуть серьезные аллергические реакции на компоненты болтушки.

Как усилить эффект

Чтобы усилить действие болтушки в борьбе с прыщами, необходимо соблюдать правильный, здоровый режим питания. Многие типы высыпаний являются результатом потребления неправильной пищи.

Постоянное очищение кожи лица и правильно подобранная косметика также не будут препятствовать действию болтушки. Для умывания можно использовать натуральное дегтярное мыло, оно будет способствовать скорейшему избавлению от прыщей.

Какой у нее срок годности

Срок годности болтушки от прыщей недолгий. Он зависит от срока годности продуктов, ее составляющих. В среднем сроки годности болтушек варьируются от 1,5 до 3 месяцев. Тем, кто не может подобрать для себя оптимальное косметическое средство от прыщей или ограничен в средствах, дерматологи рекомендуют попробовать те или иные рецепты болтушки. Это эффективное средство уже опробовано многими.

Видео о болтушке от прыщей

Как приготовить болтушку от прыщей с левомецитином:

Приготовление болтушки от прыщей и угревой сыпи:


Поделиться с друзьями:

Рецепт болтушки от прыщей — BookCooks.ru

Для лечения прыщей и угревой сыпи применение лекарств вовнутрь не всегда приносит нужный эффект. В большинстве случаев дерматологи рекомендуют пользоваться болтушками – особой смесью лекарств, приготовленной по индивидуальному рецепту.

Болтушки от прыщей часто готовятся прямо в аптеках по рецепту врача, однако иногда такие средства можно приготовить и самостоятельно. Хотите узнать, как это средство помогает избавиться от прыщей, какие преимущества, минусы, механизм действия и популярные рецепты? Тогда читайте дальше.

Как применять болтушку

Болтушка – это не косметическое, а скорее лекарственное и профилактическое средство, приготовленное по рекомендациям врача-дерматолога. Применение подобного средства не составит особого труда, поскольку не требует особой подготовки. Достаточно просто протирать лицо смоченным в средстве ватным тампоном, исключая области вокруг рта и глаз. Рекомендуется протирать не только проблемные участки с прыщами и сыпью, но и близлежащие участки для исключения распространения воспалений.

Обратите внимание: перед использованием рекомендуется тщательно очистить лицо, умыться антибактериальным средством, мылом на основе дегтя или казеина, что поможет убрать остатки сала и пыли.

Средство эффективнее всего наносить пальцами, аккуратно массируя и втирая его в дерму. Такой способ поможет компонентам быстрее проникнуть в слои кожи. После обработки рекомендуется обязательно нанести увлажняющий крем во избежание сухости и вялости.

Какие компоненты входят в состав болтушки

Для приготовления лечебной смеси от прыщей используются ингредиенты с выраженным антисептическим, подсушивающим, противомикробным и заживляющим действием. К подобным относятся как лекарственные средства, так и натуральные продукты.

Чаще всего, в состав входит:

  • левомицин;
  • серная мазь;
  • деготь березовый;
  • доксициклин;
  • эритромицин;
  • димексид;
  • салициловая кислота;
  • метронидазол;
  • борная кислота;
  • камфора;
  • настойки трав;
  • аспирин.

Указанные компоненты смешиваются между собой в пропорциях, которые определяет лечащий врач-дерматолог. Состав смеси зависит от типа лица, вида заболевания и его состояния, а также на основе результатов дерматологических тестов.

10 рецептов болтушек от прыщей, которые советуют дерматологи

Приготовить эффективную смесь для лечения прыщей можно в домашних условиях, воспользовавшись популярными рецептами приготовления от дерматологов в интернете. Ля приготовления понадобится подготовить указанные в рецепте компоненты и продезинфицированный флакон для хранения.

Рецепт с борным спиртом

Ингредиенты:

  • борная кислота – 50 мл;
  • этил (90%) – 50 мл;
  • салициловый спирт – 10 мл;
  • левомицетин – 2 таблетки.

Применение: смешать все указанные ингредиенты, таблетки растолочь и добавить к смеси, наносить на очищенное лицо, оставлять не более чем на 7 минут, затем смывать и наносить увлажняющее средство.

Рецепт с серой

Ингредиенты:

  • стрептоцид – 6 гр.;
  • салициловая кислота (2%) – 50 гр.;
  • сера – 5 гр.;
  • борный раствор – 50 мл.

Применение: протирать очищенную заранее дерму раствором, предпочтительно наносить на ночь, оставлять в течение 5 минут и смывать теплой водой.

Рецепт с эритромицином

Ингредиенты:

  • эритромицин – 3 таблетки;
  • салициловый спирт – 50 мл;
  • борная кислота – 50 мл;
  • оксид цинка – 3 гр.

Применение: использовать для протирания проблемных участков, наносить только на прыщи, выдерживать до 10 минут, затем смывать водой, после процедуры обязательно наносить увлажняющий крем.

Рецепт с левомицетином

Ингредиенты:

  • левомицетин – 2-3 таблетки;
  • борный раствор – 50 мл;
  • медицинский спирт – 50 мл;
  • сера – 2 гр.

Применение: таблетки растолочь до состояния мелкого порошка, смешать с остальными ингредиентами, наносить только перед сном, смывать по истечению 5 минут, применять 1 раз в день.

Смесь на основе трихопола

Ингредиенты:

  • трихопол – 3 таблетки;
  • этил (90%) – 200 мл.

Применение: смешать растолченные таблетки с жидкостью, использовать для протирания лица единожды в день, не оставлять дольше чем на 3-4 минуты. Средство не смывается. Спустя 7 минут после нанесения рекомендуется увлажнить жирным кремом.

Салициловая смесь

Ингредиенты:

  • камфорный спирт – 60 мл;
  • стрептоцид – 8-10 таблеток;
  • салициловый раствор – 50 мл;
  • левомицетин – 4 таблетки.

Применение: таблетки растолочь и перемешать с жидкими компонентами, нанести на проблемные участки, не смывать, по истечении 10 минут нанести увлажняющее средство.

Средство на основе календулы

Ингредиенты:

  • клиндамицин – 3 таблетки;
  • ацетилсалициловая кислота – 4 таблетки;
  • настойка календулы – 100 мл.

Применение: смешать все ингредиенты, протирать полученным раствором лицо дважды в сутки, не смывать, не забывать увлажнять кожу после нанесения.

Средство на основе аспирина и клиндамицина

Ингредиенты:

  • клиндамицин – 3 таблетки;
  • аспирин – 4 таблетки;
  • борная кислота – 50 мл;
  • медицинский спирт – 50 мл.

Применение: спиртовые растворы соединяют отдельно во флаконе, таблетки размолачивают и добавляют к жидкости, встряхивают флакон и дают порошку полностью раствориться, готовую смесь используются для протирания лица, не смывают.

Рецепт с цинком

Ингредиенты:

  • борный спирт – 30 мл;
  • этил – 30 мл;
  • оксид цинка в порошке – 5-7 гр.;
  • эритромицин – 4 таблетки.

Применение: таблетки растираются и смешиваются с жидкими компонентами, готовый раствор используется в качестве тоника для протирания лица, не смывается, применение жирного крема после него обязательно.

Раствор на основе димексида

Ингредиенты:

  • димексид – 20 мл;
  • теплая вода – 20 мл;
  • хлорфиллипт – 4 мл.

Применение: перемешать все компоненты до однородного состояния, наносить на проблемные участки с помощью ватного диска, смывать теплой водой спустя 10 минут после нанесения.

Плюсы и минусы лечения с помощью болтушек

Преимущества лечения прыщей с помощью дерматологического раствора на лицо. Это полностью безопасное противобактериальное средство, не вызывающее побочных явлений и позволяющее побороть даже серьезную угревую сыпь.

При регулярном применении раствор позволяет:

  • сгладить неровности;
  • уменьшить застойные явления;
  • отбелить пятна постакне;
  • уменьшить пигментацию;
  • избавиться от внутренних прыщей;
  • эффективно очищать и дезинфицировать лицо.

Кроме того, она отличается дешевизной и доступностью, а самостоятельное приготовление избавляет от риска покупки некачественного средства. К минусам указанного лекарства относится длительный срок лечения и хранения, повышение сухости и раздражения, а также возможности возникновения аллергии.

Болтушка от прыщей в аптеке

Для исключения возникновения побочных реакций и аллергии рекомендуется применять составы для лечения прыщей только после консультации у врача-дерматолога. Только врач после осмотра, определения особенностей вашей кожи, вида и усугубления заболевания сможет подобрать подходящие компоненты и определить их оптимальную дозировку.

Готовится такое средство непосредственно в аптеке по рецепту врача и отличается ограниченным сроком хранения.

Когда ждать результат

Конечный результат лечения болтушкой зависит от типа кожного заболевания и его состояния. Обычно лечение воспаленных прыщей, гнойных комедонов и акне занимает не меньше 14-20 дней. В случае усугубленной или запущенной формы заболевания срок может быть увеличен до нескольких месяцев.

Первый видимый результат можно наблюдать уже по истечению недели: количество прыщей сокращается, уменьшается насыщенность воспалений, кожа очищается. Однако конечный результат применения можно оценить только по истечению всего срока лечения.

А вы пробовали наши рецепты? Делитесь отзывами!

Болтушка от прыщей – препарат на основе лекарственных средств, которые обладают заживляющим, антибактериальным и подсушивающим эффектом. Воздействует на внешние проявления прыщей и акне, делая кожу ровной и гладкой. Средство готовится в домашних условиях, или приобретается в аптеке. Аптечное приготовление проводится по рецепту, выписанному дерматологом.

Что за лекарство – болтушка?

Препарат представляет собой смесь из множества компонентов, связующая основа — этиловый спирт, который оказывает антисептическое действие. Консистенция препарата – маслянистая, либо эмульсия. Название болтушка препарат получил из-за необходимости тщательно встряхивать перед применением флакон с данной жидкостью, чтобы масляные компоненты поднялись со дна.

Как действует?

Каждый компонент болтушки обладает своим спектром действия:

  1. Кислоты – борная, ацетилсалициловая, салициловая. Оказывают антисептическое действие, способствуют отшелушиванию мертвого эпидермиса, активизируют процесс регенерации.
  2. Минеральные элементы – сера, цинк. Нормализуют процесс выработки кожного сала, оказывают противомикробное и противопаразитарное действие.
  3. Настойки на основе лекарственных трав и растений – шалфей, ромашка, мята. Подсушивают и успокаивают раздраженную кожу, оказывают антибактериальный и противовоспалительный эффект.
  4. Средства антибактериального спектра действия – эритромицин, тетрациклин. Уничтожают патогенную микрофлору.
  5. Эфирные масла – восстанавливают и нормализуют функционирование эпидермиса.
  6. Вещества – проводники – способствуют глубокому проникновению в кожу основных компонентов болтушки. Наиболее эффективным и часто используемым проводником является Димексид.

Сочетание всех составляющих средств дает положительную динамику в избавлении от изъянов на лице, ликвидирует патогенные бактерии, препятствуя повторному возникновению сыпи.

Какие проблемы кожи решает болтушка от прыщей?

Лекарство применяется в лечении угрей, черных точек, воспалительных очагов и прыщиков с гнойным содержимым. Помогает при обширной угревой сыпи, вызванной проникновением инфекции, или бактерий, или возникающей по причине гормонального сбоя.

Болтушка назначается в терапии подкожных воспалительных процессов. Назначается при наличии симптоматической картины, что может указывать на развитие демодекоза.

Плюсы и минусы

Несмотря на широкое использование болтушек в лечении заболеваний кожи лица, средство не лишено недостатков.

К положительным свойствам болтушек можно отнести:
  • эффективная борьба и быстрое устранение начальных стадий акне, воспалений, угрей и других изъянов на коже лица легкой и средней степени тяжести;
  • избавление от мертвого, ороговевшего слоя эпидермиса;
  • защита кожи от проникновения патогенных микроорганизмов;
  • оказание профилактического действия по предупреждению появления акне и прыщей;
  • глубокое очищение кожных пор;
  • регулирование процесса выработки кожного сала, за счет чего устраняется чрезмерная жирность и блеск.
К числу отрицательных свойств болтушки относится:
  • имеются ограничения к применению;
  • риски возникновения побочной симптоматики;
  • чрезмерная сухость кожи при частом, или продолжительном применении;
  • необходимость в дополнительном увлажнении;
  • отсутствие положительного эффекта в лечении тяжелых стадий и запущенных случаев сыпи на лице;
  • болтушка оказывает влияние только на поверхностные слои кожи;
  • отсутствие лечения первопричины прыщей и воспалений.

Недостаток средства в том, что оно убирает только внешнее проявление прыщиков и воспалений. Если не вылечить причину развития данных изъянов на коже, проблема вернется вновь. В течение всего курса применения средств для лечения кожи, необходимо соблюдать диету, отказаться от вредных привычек и тщательно следить за чистотой кожи.

Побочные проявления:

  • покраснение кожного покрова лица;
  • сухость;
  • чрезмерное шелушение;
  • неприятные ощущения стянутой кожи на лице;
  • развитие дерматита контактного вида;
  • ухудшение внешнего вида кожи – данный побочный симптом является временным, проявляется в начале лечения, потом проходит самостоятельно.

Не исключается проявление аллергической реакции, если у пациента есть индивидуальная непереносимость отдельных компонентов. При длительном использовании болтушки с антибиотиками в составе, есть риск привыкания, из-за чего терапевтическая эффективность лекарства будет снижена.

При тяжелой степени тяжести заболевания болтушка не окажет желаемого терапевтического эффекта. В данном случае ее назначают в качестве вспомогательного препарата для проведения симптоматического лечения.

Домашние рецепты приготовления

Составляющие компоненты зависят от интенсивности симптоматической картины и вида сыпи. Общепринятые, рекомендованные рецепты препарата:

Угри с воспалениемСпирт

Кислота (чаще аспирин)

Сульфаниламиды

Черные точкиСпирт

Кислота (подойдет, как борная, так и салициловая)

Проблемы, связанные с возникновением прыщей, знакомы большинству людей. Подобные высыпания могут долго заживать, воспаляться, гноиться, болеть и чесаться, к тому же они доставляют и психологический дискомфорт при появлении на видимых участках тела.

Когда следует применять болтушку от прыщей?

Применение болтушки рекомендовано в следующих случаях:

  • Наличие необширных кожных поражений с прыщами;
  • Склонность к появлению прыщей — в данном случае средство помогает тонизировать кожу и применяется в профилактических целях.

При появлении угрей или обширных высыпаний болтушка малоэффективна, в подобных ситуациях требуется обращение к дерматологу для проведения диагностики, установления причин и назначения комплексной терапии.

Чем полезна болтушка для кожи?

Существует множество различных рецептов приготовления болтушки, задействование разных компонентов позволяет достигать необходимых результатов в зависимости от специфики возникшей проблемы.

Среди положительных свойств, которыми обладает средство, можно выделить:

  • Советы по применению

    Применение болтушки от прыщей рекомендуется осуществляться в соответствии со списком правил, изложенных ниже:

    • Эффективные рецепты болтушек от прыщей

      Состав болтушки подбирается с учетом типа кожи и характера высыпаний. Рассмотрим наиболее эффективные и часто назначаемые составы.

      Болтушка с Левомицетином

      Левомицетин добавляется во многие маски для кожи, тоники и иные средства для наружного применения, предназначенные для борьбы с прыщами.

      Он позволяет уменьшить воспаления, воздействия на локальные участки, и ускорить процесс избавления от кожных высыпаний.

      Болтушка с Левомицетином и салициловой кислотой хорошо подходит для борьбы с прыщами на жирной коже.

      Рецепт приготовления выглядит следующим образом:

      • Болтушка с салициловой кислотой

        При невозможности применения Левомицетина его можно исключить из состава, сделав салициловую кислоту основным компонентом.

        Существуют различные способы приготовления подобной болтушки, один из эффективных рецептов подробно описывается ниже:

        • Болтушка со Стрептоцидом и серой

          Болтушка со стрептоцидом и серой эффективна при лечении кожных высыпаний, вызванных деятельностью подкожных клещей, гнойных поражений и больших красных прыщей.

          Рецепт приготовления и правила применения средства описаны ниже:

          • Болтушка с Эритромицином и окисью цинка

            Болтушка, в составе которой присутствует Эритромицин и окись цинка, ускоряет процесс заживления поврежденных участков кожи и эффективно борется с прыщами, возникающими на фоне перенесения длительных стрессов или гормонального сбоя.

            Применять средство рекомендуется обладателями кожи жирного типа, поскольку оно помогает очистить поры от избытков сала и нормализовать функционирования сальных желез.

            Средство эффективно только при средней тяжести кожных поражений.

            Рецепт ее приготовления и особенности применения описываются ниже:

            • Болтушка с аспирином

              Применение болтушки с аспирином и Левомицетином рекомендуется при попадании во вскрывшиеся прыщи бактериальной микрофлоры, поскольку такое средство обладает мощным антисептическим эффектом.

              Процесс приготовления и применения выглядит следующим образом:

              • Болтушка с Трихополом

                Применение болтушки с Трихополом и другими препаратами на основе метронидазола позволяет подсушивать мокнущие прыщи. Средство обладает усиленным противовоспалительным воздействием, применять его можно для лечения высыпаний на коже любого типа.

                Рецепт приготовления и правила применения описаны ниже:

Еще одним средством, обладающим хорошим подсушивающим эффектом, является болтушка на основе камфорного спирта; наиболее эффективна она при борьбе с обильными мелкими высыпаниями.

Рецепт приготовления и правила применения приведены ниже:

Лечение акне у беременных и кормящих грудью женщин » Фармвестник

При обращении к дерматологу женщины чаще всего получают рекомендацию отложить лечение до окончания беременности и лактации, хотя существуют вполне безопасные средства и способы лечения. Косметологи либо «осторожничают», прибегая к самому нейтральному, а потому и бесполезному уходу, либо полагают, что от профессионального ухода не может быть вреда. Цель данной публикации – внести ясность в проблему ухода и лечения акне у беременных и кормящих грудью женщин.

Беременность

Обострение заболевания обычно происходит в 1–2-м триместрах беременности. Причины обострения – отмена наиболее эффективных системных противоугревых средств (ретиноиды, гормональные контрацептивы, антиандрогены), прекращение применения местных ретиноидов, повышение уровня тестостерона, а также активное применение фолиевой кислоты как на этапе подготовки к беременности, так и во время беременности.

Уровень андрогенов, в частности тестостерона, в период беременности постепенно повышается, к 3-му триместру концентрация свободного тестостерона в крови увеличивается вдвое.

Под влиянием повышения уровня тестостерона сальные железы становятся активнее, наблюдается возрастание жирности кожи, сыпь становится обильнее. Воспаление при беременности более выражено, но сами воспалительные элементы (папулы, пустулы, узлы) разрешаются скорее, а вероятность образования рубцов снижается. Места, где прежде были очаги воспаления, легко пигментируются, поэтому нужно более внимательно относиться к применению фотозащитных средств.

Трудности назначения тех или иных препаратов – как наружно, так и системно – связаны с отсутствием клинических исследований, данных фармакокинетики при беременности, противоречивостью рекомендаций и отсутствием единого подхода к лечению беременных1,2. Рассмотрим профиль безопасности наиболее часто применяемых для лечения наружных средств, так как именно они будут основными в лечении беременных (Таблица 1).

Бензоила пероксид (Базирон АС гель 2,5% и 5%, Проактив) обладает кератолитической, антимикробной противовоспалительной и комедолитической активностью. Антимикробный эффект достигается за счет образования кислородных радикалов в коже. Около 5% нанесенного препарата абсорбируется с поверхности кожи3, но внутри кожи бензоила пероксид переходит в безопасную бензойную кислоту, которая выводится с мочой, поэтому применение бензоила пероксида у беременных признано безопасным1,4. В связи с выраженным раздражающим и подсушивающим эффектом лучше применять гель более низкой концентрации (2,5%), наносить его локально, на отдельные высыпные элементы.

Наружные ретиноиды (Ретасол раствор, ретиноевая мазь 0,1% и 0,05%, Дифферин гель и крем, Клензит гель, а также комбинированные препараты Изотрексин, Клензит С, Эффезел) слабо абсорбируются с поверхности кожи, но в научной литературе описаны единичные случаи рождения детей с уродствами, сходными с таковыми при системном лечении ретиноидами. В связи с этим наружные ретиноиды во время беременности применять запрещено. Их использование прекращают, как только констатировано наступление беременности. На этапе планирования беременности наружные ретиноиды применять не противопоказано.

Местных препаратов с антибиотиками немного – раствор Зинерит (содержит эритромицин), а также гели Далацин и Клиндовит, раствор Зеркалин (содержат клиндамицин). Наружное применение эритромицина признано безопасным. Клиндамицин ингибирует синтез бактериальных протеинов путем прикрепления к их рибосомам, также безопасен при беременности4. Однако следует иметь в виду частую резистентность микробной флоры к местным антибиотикам. Зинерит, как правило, назначают первым. При его недостаточной эффективности можно назначить препараты клиндамицина, которые проявляют активность при резистентности к эритромицину.

Азелаиновая кислота (Скинорен гель 15% и крем 20%, Азелик гель 15%, Азикс-дерм крем 20%, Акне-дерм крем 20%) подавляет рост Propionibacterium acnes, снижает количество жирных кислот в составе кожного сала. К азелаиновой кислоте не развивается резистентность, она обладает умеренным осветляющим эффектом, не обнаруживается в системном кровотоке и может применяться при беременности и лактации. К недостаткам можно отнести раздражение, сухость кожи, жжение и пощипывание при нанесении, особенно в начальной стадии лечения, отсутствие влияния на салоотделение и медленное наступление эффекта. При адекватном подборе косметических средств указанные недостатки можно преодолеть.

Салициловая кислота (2–3% салициловый спирт, салициловые лосьон, гель, карандаш) обладает антисептическим и противовоспалительным действием. При системном применении салициловая кислота тератогенна (возможны дефекты строения сердца у плода), но при местном нанесении влияния на плод не описано. Нанесение на отдельные высыпные элементы возможно.

Наружные препараты цинка (Куриозин гель и раствор, Регецин гель, Циновит спрей и крем-гель от угрей) оказывают умеренное противовоспалительное действие, влияние на плод не описано, однако использование Куриозина запрещено во время беременности, а остальные препараты рекомендовано использовать с осторожностью.

Местный ингибитор 5-α редуктазы (Клироген лосьон) содержит β-ситостерин в составе экстракта карликовой пальмы сереноа ползучей, α- и γ-линоленовые кислоты (восстанавливают эпидермальный барьер), очищенную серу 3%, может использоваться при беременности и лактации.

Рецептурные серосодержащие прописи можно использовать на ограниченные участки кожи при любом сроке беременности, а Делекс-акне гель от угрей (содержит серу, экстракты растений, ментол) – с осторожностью в связи с наличием ментола.

Препараты йода (Бетадин 10% р-р) не рекомендуются с 3-го месяца беременности.

Содержащими гликолан (соединение лантана) наружными средствами в виде крема Эплан и Квотлан, обладающими антибактериальной и заживляющей активностью, можно пользоваться.

Системная терапия при беременности ограничена (Таблица 2). Особенностями обмена веществ при беременности являются замедление освобождения желудка, увеличение объема плазмы и усиление почечного кровотока. В связи с этим снижается абсорбция лекарственных веществ, уменьшается их концентрация в крови и ускоряется выведение4.

Наиболее эффективная при акне группа антибиотиков – тетрациклины (Тетрациклина гидрохлорид, Доксициклин, Юнидокс солютаб, Минолексин). Однако во 2–3-м триместрах беременности тетрациклины вызывают обесцвечивание зубов и костей, возможна жировая дистрофия печени плода, в связи с этим их прием запрещен при беременности. Эритромицин разрешен, но его использование ограничено частой резистентностью микробной флоры, рекомендуется комбинировать его с местной терапией5. Вильпрафен (джозамицин) разрешен после врачебной оценки пользы/риска, то есть его применение ограничено. Клиндамицин и Линкомицин (группа линкозамидов) проходят через плаценту и могут концентрироваться в печени плода, однако неблагоприятных последствий такого накопления не зарегистрировано, тератогенности не выявлено. Частые побочные эффекты в виде диареи, колита, усиления риска инфицирования Clostridium difficile ограничивают применение линкозамидов. Безопасность азитромицина при беременности не доказана, поэтому антибиотик применяется «только при отсутствии альтернатив». Сульфаниламидные препараты (Триметоприм) тератогенны, запрещены.

Препараты цинка (Цинктерал, Цинкит) обладают противовоспалительной активностью путем ингибирования экспрессии толл-лайк рецепторов TLR2. При беременности увеличена потребность организма в цинке из-за его использования во время эмбриогенеза и развития плода. Прием препаратов цинка при беременности рекомендуется при наличии дефицита цинка в организме, но и без выраженного дефицита не противопоказан6.

Пантотеновая кислота (витамин В5) уменьшает количество высыпаний через свой метаболит CoA, влияющий на саловыделение и улучшающий эпидермальный барьер, рекомендуется во время беременности, назначается в дозе 1,0 г (2 капсулы) 2 раза в день.

Средства домашнего ухода не должны содержать в качестве активных компонентов ретинол, ретиноевые кислоты, ретинальдегид, витамин А, гидроксикислоты, гормоны, плаценту, ростовые факторы, эфирные масла. Нежелательны также некоторые вспомогательные компоненты – лаурил сульфат натрия (более 2%), минеральное масло (церезин, микрокристаллический воск, диметикон, петролатум), бензол, парабены, гликоли, формальдегид, бронопол7.

Во время беременности не следует пользоваться средствами для осветления кожи, особенно содержащими гидрохинон (его системная абсорбция 35–45%) и его производные (арбутин), запрещена также койевая кислота. Вместе с тем, учитывая высокую способность кожи беременных к пигментации, особенно в местах разрешившихся угревых высыпаний, обязательно использование солнцезащитных средств. Солнцезащитные кремы и эмульсии не влияют на организм женщины и плода. Но все же преимущество нужно отдать шляпам с широкими полями, солнцезащитным очкам и возможности избегать прямых солнечных лучей. Средства для автозагара (бронзанты) зачастую содержат дигидроксиацетон, вредный при беременности. Для устранения волос лучше пользоваться бритвой, фотоэпиляция и химические депиляторы (содержащие тиогликолевую кислоту) противопоказаны. Нежелательно во время беременности пользоваться красками для волос.

Период кормления грудью

Увеличение количества высыпаний в период лактации объясняется тем, что после родов резко уменьшается количество эстрогенов и прогестерона, а уровень тестостерона снижается постепенно в течение первых 2–3 месяцев после родов.

В период кормления грудью возможно расширение спектра наружных средств от акне за счет включания наружных препаратов цинка (Куриозин, Регецин, Циновит). Ограничивается назначение наружных средств с клиндамицином, из наружных антибиотиков разрешен только эритромицин (раствор Зинерит). Тетрациклины противопоказаны в связи с неблагоприятным влиянием на формирование зубной эмали у ребенка, эритромицин во время лактации также противопоказан8.

———————
1 Pugashetti R., Shinkai K. Treatment of acne vulgaris in pregnant patients. // Dermatol Ther. 2013 Jul-Aug; 26(4):302-11.
2 Kong Y.L., Tey H.L. Treatment of acne vulgaris during pregnancy and lactation. // Drugs. 2013 Jun; 73(8):779-87.
3 Nacht S., Yeung D., Beasley J.N. et al. Benzoyl peroxide: percutaneous penetration and metabolic disposition. // J Am Acad Dermatol. 1981; 4(1):31–7.
4 Meredith F.M., Ormerod A.D. The Management of Acne Vulgaris in Pregnancy // Am J Clin Dermatol. 2013; 14:351–358.
5 Thiboutot D., Gollnick H., Bettoli V. et al. New insights into the management of acne: an update from the Global Alliance to improve outcomes in acne group. // J Am Acad Dermatol. 2009; 60(5 Suppl.):S1–50.
6 Dréno B1, Blouin E. Acne, pregnant women and zinc salts: a literature review.// Ann Dermatol Venereol. 2008 Jan;135(1):27-33.
7 Bozzo P., Chua-Gocheco A., Einarson A. Safety of skin care products during pregnancy. // Can Fam Physician. 2011 Jun; 57(6):665-7.
8 Bayerl C. Acne therapy in pregnancy. // Hautarzt. 2013 Apr; 64(4):269-73.

Салициловая кислота и левомицетин. Болтушка средство от прыщей всех времен и народов, лучший рецепт

Несмотря на обилие средств от прыщей, как в магазинах, так и в аптеках, в борьбе с данной проблемой люди до сих пор используют старую проверенную болтушку. В этом нет ничего удивительного, так как именно она доказала свою эффективность. Для ее приготовления используют многие компоненты, но наибольшей популярностью пользуется болтушка, выполненная с салициловой кислотой и стрептоцидом. Она заслужила наиболее число положительных отзывов в интернете. Именно поэтому сегодня о ней пойдет речь в нашей статье. Мы выясним, как помогает салициловая кислота и стрептоцид от прыщей и как приготовить болтушку с данными компонентами.

Лечение прыщей салициловой кислотой и стрептоцидом

Полезные свойства салициловой кислоты и стрептоцида

Данные средства обладают некоторыми полезными свойствами, которые позволяют их использовать в борьбе с прыщами.

  1. Подсушивают кожу. Именно поэтому эти компоненты помогают быстро справиться с прыщами. Однако это свойство данных средств может губительно сказаться на коже, поэтому применять их рекомендуют путем точечного нанесения на очаги локализации высыпаний.
  2. Помогают справиться с пятнами после схождения прыщей. Дело в том, что данные препараты проникают в нижние слои кожи и тем самым увеличивают циркуляцию крови, а также способствуют глубокому прохождению кислорода. Именно поэтому клетки начинают активно обновляться, и происходит быстрое схождение пятен после прыщей.
  3. Убивают вредоносные микроорганизмы, которые вызывают образование прыщей. Именно поэтому средство, приготовленное с данными компонентами, не только справляется с данными высыпаниями, но и препятствует их повторному появлению.
  4. Налаживают работу сальных желез и они начинают вырабатывать меньше жира, что положительно сказывается на общем состоянии кожи.
  5. Помогают справиться с черными точками. В данном случае начинает активно действовать салициловая кислота. Именно она растворяет черные точки, а в некоторых случаях просто обесцвечивает их. В любом случае, после применения этого средства, данные образования исчезают.

Безопасное использование салициловой кислоты и стрептоцида

  1. Сухой тип кожи. Не следует забывать, что средство, приготовленное на основе салициловой кислоты и стрептоцида, обладает подсушивающими свойствами. Именно поэтому их применение для сухой кожи может губительно сказаться на ее состоянии.
  2. Шелушение, если этот процесс происходит непосредственно рядом с высыпанием или недалеко от него. В данном случае эти компоненты только усилят процесс. Тогда после схождения прыщей вам придется долго бороться с шелушением.
  3. Период вынашивания младенца.

Правила применения болтушки с салициловой кислотой

Салициловая кислота и стрептоцид от прыщей имеют некоторые правила применения, а именно:

  1. В период лечения следует ограничить себя в употреблении сладкой, соленой, копченой и жирной пищи. Сделать это нужно хотя бы на пару месяцев. Именно это поможет достигнуть результата гораздо быстрее. Кроме того, если вы имеете лишний вес, то это поможет вам его сбросить.
  2. Перед применением болтушки выполните тест на аллергические реакции. Для этого готовое средство нанесите на кожу на сгибе локтя на 15 минут. Если реакции не последовало, то можете использовать его для лица.
  3. Болтушку нужно наносить только на чистую кожу. Именно поэтому перед ее применением необходимо умыться. Для данной процедуры лучше всего использовать дегтярное мыло, но только в том случае, если у вас жирная или комбинированная кожа.
  4. Используйте средство 2 раза в день утром и вечером ежедневно. Чаще этого делать не нужно, в противном случае вы пересушите кожу, и она начнет шелушиться.
  5. После использование болтушки наносите на кожу увлажняющие крем, чтобы избежать пересушивания.
  6. Курс лечения данным средством составляет 14 дней. После этого следует сделать перерыв на такой же период и при необходимости можно повторить лечение.
Салициловая кислота и стрептоцид: доступное действенное средство для очищения кожи лица от прыщей

Болтушка с салициловой кислотой и стрептоцидом

Болтушка с серой

Вам потребуется:

  1. Сера — 7 гр.
  2. Стрептоцид — 7 гр.
  3. Раствор борной кислоты — 50 мл.
  4. Раствор салициловой кислоты — 50 мл.

Если вы берете стрептоцид в таблетках, то вам их нужно измельчить в порошок. После этого смешайте с указанным количеством серы. Далее добавьте в полученное средство раствор борной и салициловой кислоты. Тщательно его размешайте и можете применять по назначению. Делайте это по правилам, указанным выше.

Болтушка с левомицетином

  1. Левомицетин — 4 таблетки.
  2. Стрептоцид — 10 таблеток.
  3. Камфорный спирт — 80 мл.
  4. Салициловая кислота — 30 мл.

Возьмите левомицетин и стрептоцид и разомните их. Вы можете их растолочь отдельно друг от друга, если вам так удобнее, а потом просто соединить их и размешать. После этого смешайте салициловую кислоту и камфорный спирт. Оба состава соедините и тщательно размешайте. Можете использовать полученное средство по назначению.

Салициловая кислота и стрептоцид от прыщей является эффективным и проверенным средством. Однако при неправильном применении оно может причинить коже сильный вред. Чтобы этого не произошло, рекомендуем внимательно ознакомиться с рекомендациями, указанными выше.

Если вам надоели дорогие средства от прыщей, которые сушат кожу и вызывают привыкание, может пора попробовать средства намного проще и старомоднее, но доступнее и эффективнее, такие как борная кислота?

Прыщи на лице не были бы такой большой проблемой для нас, если не провоцировали дискомфорт, и самое главное, неуверенность в себе. Они неэстетичные и нередко оставляют после себя пятна на коже, которые еще труднее удалить, чем самих прыщей.

Что же делать? Пока отложить лечение акне новомодными, дорогими средствами и попробовать старомодные, дешевые и очень доступные средства, такие как левомицетин от прыщей, отвар из календулы, салициловая кислота и борная кислота, о которой и идет речь в этом материале.

Борная кислота – что это такое и как применяется

Борная кислота – химическое вещество, которое в своей естественной форме пребывает в виде мелких кристаллов. В аптеках обычно продается спирт с содержанием борной кислоты в пропорции 3%.

Применяется данное вещество довольно широко – в медицине в качестве антисептического средства, в лабораториях в качестве буферных растворов, в ювелирном деле, в пищевой промышленности и даже в ядерных реакторах.

Борная кислота также используется как инсектицид, для уничтожения вшей.

Во многих странах, борная кислота признана токсическим веществом, поэтому продажи строго ограничены.

Применение борной кислоты для борьбы с прыщами

Показания к применению

  • Угревая сыпь;
  • Жирная кожа;
  • Расширенные поры;
  • Черные точки;
  • Дерматиты, высыпания.

Так как борная кислоты быстро проникает в глубокие слои эпидермиса, она эффективно борется с болезнетворными бактериями, очищает кожу и снимает воспаления.

Сушит кожу это средство не так сильно как салициловая кислота, но несколько более эффективна.

С другой стороны, борная кислота менее безопасна в применении и не стоит легкомысленно относиться к противопоказаниям.

Борная кислота не подходит для чувствительной кожи.

Противопоказания и меры предосторожности

Борная кислота проникает через кожу быстро, но очень медленно выводится, поэтому ее не рекомендуется применять беременным и кормящим женщинам. Также, врачи не рекомендуют часто использовать этот препарат при лечении детей раннего возраста.

При длительном применении борной кислоты могут возникнуть многие побочные эффекты, такие как:

  • Нарушение работы почек;
  • Чрезмерная сухость кожи;
  • Токсические реакции: тошнота, рвота, диарея, кожная сыпь, головная боли;
  • Не подтверждено, но есть мнения, что длительное применение борной кислоты может к нарушениям в развитии плода в утробе матери.

Основное правило: Ни в коем случае не пользоваться борной кислотой регулярно или для профилактики. Из-за токсичности, это средство логично использовать только в качестве экстренного средства, когда другие методы уже испробованы и не помогли.

Рецепты лосьонов и болтушек от прыщей с борной кислотой

Самый простой способ использовать борную кислоту в борьбе с угрями это просто намочить спиртовым раствором ватный диск и протирать им проблемные места, однако, обыватели придумали много более действенных рецептов. Если добавить к борной кислоте дополнительные ингредиенты, которые также эффективно работают против прыщей, результат можно увидеть гораздо быстрее.

  • Борная кислота, левомицетин и салициловая кислота в равных количествах;

Самый жесткий вариант болтушки. Нужно быть готовым, что кожу будет сильно сушить, так что подходит только для очень жирной. По возможности, стоит наносить средство только точечно.

Читайте также: Левомицетин от прыщей

  • Борная кислота(3%)-30мл, салициловая кислота(2%)- 30мл, цинковая паста – 1 ложка;

Борная кислота обеззараживает кожу, очищает ее от бактерий и омертвевших клеток, салициловая сужает поры и регулирует выработку кожного сала, а цинковая паста укрепляет местный иммунитет клеток, создает защитный барьер и предотвращает повторное заражение.

Более натуральный и щадящий вариант лосьона от прыщей. Им протирают лицо 2 раза в день, убирает прыщи, а потом и пятна после них.

Читайте также: Отвар календулы от прыщей

  • Борная кислота, настойка календулы, глицерин, настойка прополиса, теплая кипяченая вода

Положить по 1 ложке каждого ингредиента в чистую баночку, добавить примерно 30 мл воды, все тщательно смешать. Лосьоном пользоваться 2 раза в день.

  • Борная кислота- 20мл, левомицетин – 3 табл., 50мл камфорного спирта;

Камфорный спирт также известен как эффективное средство для лечения угрей, поэтому его сочетание с борной кислотой дает хорошие результаты, а данный вариант болтушки очень популярен.

Информативное видео об уходе за проблемной кожей:

Об эффективности борной кислоты в борьбе с прыщами никто не спорит, однако всегда стоит помнить, что этот препарат не самый безопасный и пользоваться умеренно и крайне осторожно.

Читайте также:

  • Маска для лица с алоэ от прыщей
  • Медовые маски от прыщей
  • Что действительно помогает от прыщей — личный опыт
  • Крем с кислотами для лица – виды, особенности, как…

Прыщи, угревая сыпь, акне – практически каждый человек так или иначе сталкивался с подобной проблемой. Кому-то удалось быстро и бесследно избавиться от них, а кто-то борется долго и малорезультативно.

Такая проблема способна сильно снизить качество жизни человека – неуверенность в себе, неустроенная личная жизнь, комплексы со всеми вытекающими последствиями – все это может стать следствием появления прыщей. Болтушка от прыщей с левомицетином проявила себя высокой эффективностью по лечению от таких высыпаний.

Что это такое

Существует множество различных средств от прыщей – как дорогих и разрекламированных, так и народных, передающихся из поколения в поколение. Отчаявшийся человек готов испробовать все, что угодно.

По-настоящему хорошее средство должно быть эффективным и недорогим. Такая задача кажется невыполнимой, но выход все же есть. Болтушка от прыщей способна быстро избавиться от подростковой угревой сыпи и прыщей.

Составы изготавливались и успешно применялись уже достаточно давно. Они готовятся с добавлением абсолютно разных составляющих.

Преимуществами болтушек являются:

  • В состав входят лекарства, продающиеся в аптеках. Обычно они отличаются недорогой ценой.
  • Компоненты абсолютно разные, поэтому их можно подбирать и варьировать исходя из индивидуальности кожи.

Видео: Как вылечить высыпания?

Как приготовить

Основным компонентом болтушки всегда является какой-либо активный препарат – будь то антибиотик, антисептик или антибактериальное вещество.

Также обязательно наличие какой-либо кислоты или спирта, который будет растворять активное лекарственное средство. К примеру, камфорный или медицинский спирт, салициловая или борная кислота.

Раствор на основе антибиотика – крайне популярное средство. Подойдет практически любой антибиотик, как в таблетках, так и порошкообразный.

Это могут быть эритромицин, левомицетин, стрептоцид или банеоцин. Такой компонент способен блокировать размножение вредных бактерий, уничтожать их и тем самым эффективно излечивать прыщи.

Единственным минусом антибиотиков можно назвать приспосабливаемость к ним микроорганизмов. В связи с этим применение таких болтушек не должно быть постоянным.

Антисептик в роли активного компонента хорошо купирует процессы гниения внутри и на поверхности кожи, подсушивает прыщи.

При изготовлении болтушки можно применять как один, так и несколько антисептиков, а также смешивать их с антибактериальными средствами. В роли антисептического компонента обычно выбирают серу, цинк, циндол.

Антибактериалные вещества, входящие в состав болтушек, направлены на подавление развития вредоносных микроорганизмов. К таким компонентам относят метрогил, трихопол или обычный аспирин.

Преимуществом таких препаратов перед антибиотиками является то, что они не спровоцируют привыкания, но от этого не менее эффективно справляются с прыщами.

Рецепт болтушки от прыщей с левомицетином

Левомецитин относится к антибиотикам. В составе имеется действующее вещество – хлорамфеникол. Левомецитин давно и успешно применяется при терапии прыщей бактериальной и инфекционной природы.

Лечение болтушкой с левомецитином – достаточно серьезная процедура, обязательно нужно пройти полный курс лечения (как и при лечении любым другим антибиотиком).

Как правило, терапия составляет 10 дней. Данный препарат обладает, помимо антибактериального, подсушивающим свойством, а также эффективно очищает и дезинфицирует кожу. Левомицитин продается в аптеках в виде таблеток, спиртового раствора и мази.

Для приготовления такой болтушки понадобится:

  • левомецитин – 5 г;
  • борная кислота – 50 мл;
  • салициловая кислота 2% – 50 мл;
  • медицинский спирт – 50 мл.

Все компоненты нужно соединить в чистой баночке подходящего размера и тщательно перемешать. Каждый раз перед использованием емкость с болтушкой надо взбалтывать.

Еще один рецепт с левомецитином:

  • 10 таблеток левомецитина;
  • 10 – метронидазола;
  • 10 мл кислоты борной;
  • 40 мл салицилового спирта.

Приготовление начинается с того, что таблетки надо потолочь до образования мелкого порошка. Далее соединить все ингредиенты в баночке и тщательно перемешать.

Применяется путем нанесения ватным диском на самые пораженные места кожи. Не рекомендуется использовать более одного раза в сутки.

Перед нанесением болтушки кожа должна быть подготовлена: очищена тоником от остатков макияжа и пыли. Нельзя применять состав под декоративную косметику, поэтому использование состава лучше всего отложить на вечернее время.

После применения болтушки нужно обязательно умыть лицо теплой водой и нанести крем – либо увлажняющий, либо питательный – в зависимости от типа кожи.

Любая из этих болтушек очень эффективна – она убивает микробов, устраняет повышенную жирность кожи (при этом сушат прыщи), очищает кожу от отмерших частиц.

С календулой

Состав:

  • настойка календулы – 40 мл;
  • аспирин – 4;
  • левомецитин – 4.

Все препараты в таблетках размельчить до образования мелкого порошка и высыпать в пузырек с календулой. Раствор рекомендуется применять в виде тоника. Если замечается сильная сухость кожи, то данное средство можно разбавить водой 1:1

Со стрептоцидом

Состав:

  • 4 т. стрептоцида;
  • 1 ч.л. серы;
  • 3 ст.л. борного спирта;
  • 3 ст.л салициловой кислоты 2%.

Состав наносится ватным диском, не попадая на зону вокруг глаз. Далее необходимо тщательное увлажнение кожи с помощью специальных кремов.

Дегтярное мыло или мыло на казеине – хороший способ очистить кожу перед такой манипуляцией и защитить ее от чрезмерного пересушивания.

Такая болтушка полезна при лечении единичных прыщей или же незначительных высыпаниях. Если акне имеет запущенную форму, данный состав не будет эффективным.

Такую болтушку можно применять в целях профилактики прыщей. Чтобы избежать пересушивания кожи, применять состав лучше всего один раз в день, на ночь.

С аспирином

Состав:

  • 10 г аспирина;
  • 20 г цинковой мази;
  • 70 г борного спирта.

Истолченный аспирин смешивается сначала с цинковой мазью до однородной массы, а затем этот состав взбалтывается с борным спиртом.

Нанесение раствора проводится раз в день. Перед процедурой обязательно провести обычное очищение кожных покровов лица.

С трихополом

Состав:

  • 4 т. трихопола;
  • 4т. левомецитина;
  • 1 флакон салицилового спирта.

Истолченные в мелкий порошок таблетки вносят в салициловый спирт и тщательно взбалтывают.

Мажут кожу ватным диском стандартным способом. Такой состав применяется дважды в день. Курс лечения 1-2 недели.

Эта болтушка незаменима против угрей, вызванных подкожным клещом. Можно применять состав при лечении высыпаний, связанных с патологическими процессами в ЖКТ.

При юношеских угрях лучше совмещать лечение болтушкой с внутренним приемом таблеток Трихопол.

Для лечения вульгарных угрей болтушка с трихополом не используется.

Возможные осложнения

Перед началом использования любого вида болтушки желательно проконсультироваться со специалистом. При лечении любого вида прыщей любым возможным способом первоочередную роль должно играть устранение самой причины их возникновения.

Болтушки с разными компонентами не будут эффективны при попытке вылечить прыщи, появление которых связано с гормональными нарушениями, заболеваниями внутренних органов и аллергиях.

Абсолютными противопоказаниями для применения болтушек является беременность, период лактации, индивидуальная непереносимость какого-либо компонента, детский возраст до 12 лет.

Основными осложнениями после использования болтушек можно назвать:

  • повышенная сухость кожи;
  • шелушение и раздражение кожных покровов;
  • покраснение.
Обычно такие проявления связаны со слишком частым применением составов, сильным втиранием в кожу, несоблюдением правильных пропорций.

Как правильно использовать

Болтушку с любыми компонентами нужно правильно использовать.

Нанесение средства производится после очистки кожи от косметики и уличной пыли. Использование лечебного средства под декоративную косметику и, особенно, под тональный крем не только нежелательно, но даже опасно.

Нанесение проводится легкими массажными движениями в проблемные участки кожи лица. Нельзя покрывать средством кожу вокруг глаз – она слишком нежная для воздействия для таких компонентов.

Время оставления болтушки на лице не должно превышать 5-7 минут, это может способствовать сильному иссушению кожи. Если высыпание прыщей незначительные, возможно точечное использование составов с помощью ватной палочки.

После процедуры обязательно нужно смыть лицо от остатков лекарства теплой водой. Нанесение вечернего увлажняющего или питательного крема – завершающий этап процедуры.

Перед выбором состава болтушки нужно досконально ознакомиться с воздействием того или иного компонента и подобрать оптимальный вариант для себя. Если использовать состав наугад, это может навредить коже.

Аптечный состав

Такая болтушка представляет собой сбалансированный комплекс активных компонентов. Можно заказать в аптеке приготовление по индивидуальному рецепту. Покупателю понадобится только рецепт, назначенный дерматологом.

Такая мера вполне оправдана – состав будет приготовлен с учетом всех личных особенностей пациента, а также противопоказаний.

Помимо этого преимущества, есть ряд других: стерильность используемой посуды, точность технологии и пропорций, легкость (купил и можно пользоваться).

Показания

Основные показания:

  • Подростковые прыщи.
  • Угревая сыпь любого происхождения.
  • Черные точки.
  • Излишняя жирность кожи.
  • Кожные высыпания любого происхождения.
  • Не слишком крупные гнойники.

Противопоказания

Возможные противопоказания:

  • Беременность и лактация.
  • Большие или гнойные раны.
  • Чувствительная кожа.
  • Непереносимость любого из составляющих.
  • Слизистые оболочки и участи рядом с ними.
  • Герпес и высыпания связанные с ним.

Побочное действие

Список побочных эффектов:

  • Чувствительность кожи к внешним факторам и пигментация.
  • Еще более сильное появление прыщей или отсутствие ожидаемой пользы.
  • Химический ожог кожных покровов.
  • Краснота, зуд и раздражение кожи.
  • Аллергия.
  • Чрезмерная сухость кожи, шелушение и чувство стянутости.

Помогает ли

По отзывам специалистов, данное средство можно характеризовать с положительной стороны. Однако врачи не рекомендуют практиковать самолечение – это может только усугубить ситуацию. Перед применением средства лучше всего заранее проконсультироваться с дерматологом.

Если пользоваться средством аккуратно и соблюдать комплексность лечения, то шансы избавиться от такой проблемы, очень велики.

Фото: До и после

Несмотря на то, что проблема появления прыщей актуальна и болезненна для многих людей, есть недорогие проверенные средства, помогающие бороться с высыпаниями эффективно и гарантированно.

Но, как и к любому лечению, нужно обязательно подойти к вопросу серьезно и тогда положительный результат обязательно наступит.

1 Comment

Нет такой женщины, которая бы не мечтала иметь идеальную кожу. Но, к сожалению, не всем удается избежать воспалительных процессов в виде прыщей. Они не только выглядят не эстетично, но и крайне сильно понижают самооценку.

Обычно, проблемная кожа – очень распространенный недуг среди людей, вступивших в фазу полового созревания. Это напрямую связано с колебаниями гормонального баланса в организме. Также могут являться свидетельством нарушения обмена веществ, болезней кишечника, или следствием повышенной секреции сальных желез кожи.

Гнойные образования могут быть следствием грибкового заболевания кожи, зараженной, например, гонококками или стрептококками.

Одним из наилучших средств по борьбе с подобными несовершенствами кожи является болтушка от прыщей с левомицетином. Средство применяется уже давно, поэтому успело себя зарекомендовать.

В последнее время фармацевтическими компаниями создано множество дорогостоящих препаратов от прыщей(к примеру ), в состав которых входит левомицетин. Но если бюджет не позволяет тратиться на дорогие лекарства, можно сделать самостоятельно. Действие вашего препарата будет аналогичным действию этих лекарств. Спиртовой раствор левомицетина является превосходным антисептиком с противобактериальным действием. Он останавливает размножение бактерий и микробов прямо в очагах воспалений. Новые прыщи не появляются, а старые заживают. Салициловая кислота дезинфицирует и усиливает свойства левомицетина.

Болтушка — это эффективное средство, основой которого является спиртовой раствор левомицетина.

Занимаются изготовлением такой болтушки в аптеках. Помимо левомицетина в составе могут быть и другие компоненты, направленные на подсушивание кожи в местах воспалений и гнойничковых образований. Это может быть спирт, сера и другие составляющие.

Состав изготовляемой болтушки определяется на приеме у дерматолога в зависимости от состояния кожи, ее типа, этиологии прыщей и других критериев.

Также параллельно назначается соблюдение диеты, направленной на улучшение обмена веществ. Таким образом, из рациона рекомендуют исключить острое, копченое, жареное, сильно соленое и сладкое.

Действие такой болтушки направлено на очистку кожи от излишков жира, подсушивание прыщей. Левомицетин, как наиболее действующий компонент, относящийся к антибиотикам, убивает бактерии и грибки. Если бактерии окажутся чувствительными к компонентам препарата, то болтушка поможет в лечении. Довольно быстро пройдут покраснения, и гнойничковые образования подсохнут. Новые высыпания появляться не будут. Если же кожу поразили бактерии вида, устойчивого к антибиотику, входящему в состав болтушки, то она не будет эффективна.

Именно поэтому необходимо предварительно узнать причину появления прыщей, посетив кожного специалиста и сдав назначенные им анализы.

Рецепт изготовления

К счастью, рецепт изготовления болтушки с левомицетином не является секретом. И появилось много вариантов ее приготовления.

Аптечная «болтушка» имеет множество действующих составляющих помимо основного – левомицетина. В ее состав могут входить: эритромицин, цинк, салициловая кислота, серный эфир, борный порошок, настойки трав и другие компоненты.

Но в домашних условиях тоже можно приготовить болтушку от прыщей по упрощенному рецепту с меньшим числом компонентов, но тоже очень эффективную.

Вот несколько из них.

Основой является спирт.

Спирт — это мощнейший антисептик и отличный растворитель других действующих веществ. Также он является усилителем действия остальных, входящих в болтушку, компонентов.

Рецепт 1

  • Спирт 90 % — 2,5 части
  • Левомицетин – 2 части
  • Аспирин – 2,5 части
  • Борная кислота – 1 часть
  • Сера – 2,5 части

Берем 50 мл спирта, растворяем в нем толченые левомицетин и аспирин (в таблетках) и добавляем борный порошок и серу. Ингредиенты нужно точно вымерять по количеству, чтобы не нарушить рецептуру.

Содержимое осядет на дне, поэтому нужно взболтать емкость. Наибольшую эффективность средство будет иметь после полного растворения в ней измельченных таблеток.

Рецепт 2

  • Бутылочка спиртового раствора салициловой кислоты 2%
  • Глицерин – треть.
  • Борный порошок – треть.
  • Метронидазол – 2 табл.
  • Левомицетин – 2 табл.

Содержимое растворить в спиртовом растворе и протирать кожу в течение месяца каждый день. Потом рекомендуется использовать еженедельно.

Существуют болтушки и с меньшим количеством ингредиентов.

Рецепт 3

Один из самых простых рецептов в приготовлении. Необходимо смешать в одинаковых частях спиртовой раствор и борный раствор, по 50 мл. Добавить по 5 г толченых таблеток: аспирина и левомицетина.

Рецепт 4

Необходимо взять таблетки стрептоцида и левомицетина в соотношении 10:4). В отдельной емкости перемешать камфарный спирт и аспирин в соотношении 80 мл:30 мл. Все ингредиенты соединить и тщательно взболтать.

Рецепт 5

Растолките по 2 таблетки трихопола и левомицетина. Пересыпьте порошок в пузырек с салициловым спиртом.

Рассмотрим более подробно действие различных компонентов болтушки.

Стрептоцид.

Противогонококковый и противострептококковый антибиотик.

Борная кислота.

Антисептик. Токсичен, и в связи с этим противопоказан детям и беременным женщинам.

Антисептик.

Оказывает противовоспалительное, антисептическое действие. Подсушивает.

Обладает антисептическими и ранозаживляющими свойствами, заживляет, снимает воспаление.

Используется для обеззараживания и очищения кожи. Подсушивает.

Эритромицин.

Мощнейший антибиотик, используемый в лечении кожных инфекций, а также гнойных образований и акне.

Трихопол.

Эффективен, когда возбудители прыщей – анаэробы и аэробы.

Болтушку необходимо наносить точечно на пораженные участки кожи. Нанесение на всю поверхность кожи может спровоцировать ее пересыхание. Кожу необходимо предварительно очистить одним из специальных средств для проблемной кожи. Наносить болтушку нужно раз в сутки, на ночь. Не стоит применять ее днем, так как некоторые компоненты в составе болтушки чрезмерно активизируются под действием ультрафиолетовых лучей и могут сжечь кожу.

Регулярное использование даст свои результаты приблизительно через 2 недели. Применять болтушку лучше в комплексе с другими средствами по борьбе с прыщами. Так результат лечения будет достигнут быстрее.

Применение болтушки может не принести желаемых результатов, если прыщей слишком много и проблема их кроется в работе внутренних систем организма. В данном случае необходимо сначала выяснить причину появления гнойничковых нарывов для искоренения проблемы.

Плюсы и минусы использования болтушки с левомицетином

Несомненным преимуществом болтушки является не только ее высокая эффективность при борьбе с прыщами, но и низкая стоимость.

К тому же при самостоятельном приготовлении в домашних условиях болтушка обходится еще дешевле, так как приобретение всех компонентов по отдельности намного выгоднее.

Болтушка оказывает тонизирующее воздействие на кожу, но на всю поверхность ее наносить не стоит.

К недостаткам можно отнести сильное пересушивающее действие, делающее кожу очень чувствительной и восприимчивой к бактериям. Поэтому, не будет лишним применение увлажняющего крема после болтушки.

Долгосрочное применение болтушки, в составе которой антибиотики, может вызвать ослабление иммунитета кожи.

В связи с этим перед применением болтушки необходимо тщательно оценить все ее преимущества и недостатки, чтобы не нанести вреда.

У болтушек есть и побочные эффекты, но возникают они обычно от неверного применения.

Некоторые не понимают, почему мало эффекта при правильном использовании и строгого соблюдения рецептуры.

Это может быть из-за того, что после нанесения болтушки вы подвергли свою кожу солнечным облучениям, воздействию пыли, косметических средств и других факторов окружающей среды.

Во время лечения стоит воздержаться от применения косметики. Тональная основа, пудра забивают поры и сводят борьбу с акне на нет. Лучше лечение сочетать с использованием увлажняющего крема для чувствительной кожи. Прекрасно подойдут крема, содержащие декспантенол, либо просто детский крем.

А лучше предварительно проконсультироваться с дерматологом.

После похода к врачу, можно заказать болтушку в аптеке. Ее выполнят по рецепту, написанному дерматологом. Получение рецепта хорошо тем, что дерматолог подбирает состав исходя из особенностей вашей кожи.

С другой стороны, имея на руках состав, можно купить ингредиента в аптеке и смешать их в домашних условиях.

Ну и, наконец, можно воспользоваться одним из распространенных рецептов приготовления болтушки.

Инфицирование бактериями пор на коже и волосяных фолликулов приводит к развитию воспаления и появлению прыщей. Причём проблема эта – не только эстетическая: такого рода высыпания без соответствующего лечения прогрессируют и нередко приводят к серьёзным осложнениям и формированию рубцов. Существует ли надёжное средство для борьбы с этим заболеванием? Да, причём проверенное годами, недорогое и очень эффективное – Левомицетин ® . В статье содержится полная информация о лекарстве, способах применения и отзывы.

Международное название этого антибиотика – хлорамфеникол ® . Его бесцветные кристаллы в фармакологии используются для изготовления различных лекарственных форм, которые применяются как внутрь, так и наружно. Практически все отечественные фармпредприятия выпускают следующие разновидности препаратов:

  • таблетки по 250 и 500 мг действующего вещества;
  • спиртовые растворы различной концентрации (наружное средство) – 1% или 3%;
  • капли глазные 0,25% с добавлением воды и борной кислоты;
  • мазь под другими торговыми названиями.

Перечисленные лекарственные средства отличаются невысокой стоимостью и всегда есть в наличии в аптечных сетях. Если дерматолог назначает от прыщей, то имеется в виду готовый раствор на спирту, мазь или таблетки, а также различные болтушки и лосьоны на их основе.

Как применять спиртовой раствор

Данное лекарственное средство представляет собой смесь двух активных компонентов: 70-процентного этилового спирта и антибиотика с широким спектром противомикробного действия. Хлорамфеникол ® активен по отношению к большинству представителей патогенной микрофлоры (как грамположительным, так и грамотрицательным), действует на них бактериостатически, подавляя белковый синтез.

Спиртовая составляющая даёт дезинфицирующий и подсушивающий эффект. Таким образом, спиртовая настойка левомицетина при наружном применении обеспечивает следующие результаты:

  • устранение причины появления прыщей – инфекции, и, соответственно, снятие воспаления и покраснения;
  • предотвращение их дальнейшего распространения за счёт дезинфекции кожи спиртом;
  • быстрое исчезновение прыщей в результате подсушивающего действия раствора;
  • снижение активности сальных желез и уменьшение секреции кожного сала.

Несмотря на то, что препарат продаётся свободно, без рецепта, предварительная консультация врача-дерматолога обязательна. Специалист поможет правильно подобрать нужную концентрацию и схему терапии. Кроме того, необходимо учитывать индивидуальные особенности кожного покрова (чувствительность, склонность к жирности), чтобы лечение не навредило.

Протирание лица

Этот способ категорически не подходит, если кожа слишком сухая или чувствительная. Тем, у кого таких проблем нет, можно использовать спиртовой 1% раствор (более высокая концентрация нежелательна, поскольку чревата раздражением).

Протирать лицо рекомендуется дважды в сутки – утром и перед сном – смоченным в жидкости тампоном. После этой процедуры обязательно нужно воспользоваться кремом с увлажняющим эффектом, поскольку даже склонную к жирности кожу можно пересушить. Длительность лечения обычно не превышает 2 недель, а если прыщи исчезли раньше, то и протирания следует прекратить.

Точечное нанесение

Этот метод подходит для кожи любого типа, поскольку лекарственное средство действует исключительно на очаг инфекции. Можно воспользоваться более концентрированным раствором – 3%, чтобы повысить эффективность терапии. Средство в данном случае наносится с помощью обычной ватной палочки (и только на сам прыщ) тоже два раза в сутки до исчезновения воспаления и покраснения. Если высыпания очень обильны, врач может порекомендовать добавить к готовому раствору 1-2 таблетки трихопола ().

Рецепт болтушки для лица с левомицетином

Такая лекарственная форма является более щадящей (практически не сушит кожу лица), а за счёт содержания дополнительных ингредиентов оказывает на прыщи более мощное комплексное воздействие. Оптимальный вариант – изготовление лечебного состава в аптеке по рецепту дерматолога, но можно и самостоятельно сделать смесь дома. При этом состав компонентов может варьироваться.

На основе таблеток

В данном рецепте используется два антибиотика, что усиливает терапевтический эффект болтушки. Все ингредиенты стоят недорого, продаются практически в каждой аптеке. Для получения лекарственного средства потребуются:

  • по 10 таблеток Метронидазола ® и левомицитина, содержащих 0,5 г действующего вещества;
  • 10 мл (2 чайные ложки) кислоты борной;
  • 40 мл двухпроцентного салицилового спирта.

Смешать все составляющие в чистом флаконе, предварительно измельчив таблетки, взбалтывать до однородного состояния. Протирать этим составом на основе метронидазола ® , борной кислоты и левомицетина лицо дважды в день до исчезновения прыщиков.

На основе раствора

Для этой смеси потребуются спиртовой раствор антибиотика (флакон объёмом 25 мл), две измельчённые таблетки аспирина, 40 мл аптечной настойки календулы. Ингредиенты смешиваются в стерильной ёмкости до однородности состава, который затем переливается в подходящую бутылочку. Используется аналогично предыдущему средству.

Дополнительная информация по применению

Чтобы лечение дало ожидаемый результат и не привело к осложнениям, следует соблюдать определённые правила по изготовлению, нанесению и хранению лекарственного средства. Вне зависимости от рецепта болтушки для лица с левомицетином нужно выполнять следующие условия:

  • готовить смесь в чистой посуде с точным соблюдением указанных пропорций;
  • хранить её в плотно закрытом флаконе в прохладном месте не более двух недель;
  • перед очередным применением взбалтывать до однородности;
  • наносить на предварительно очищенную кожу, уделяя особое внимание поражённым участкам;
  • во время лечения пользоваться только увлажняющим кремом после процедуры, избегая декоративной косметики;
  • не применять больше 2 недель.

Если высыпания обильны, целесообразно иногда делать маску для лица с левомицетином. Для сухого типа кожи подойдёт смесь из двух таблеток антибиотика, ложки мёда и небольшого количества ромашкового отвара, которая наносится на 15 минут, затем смывается водой или тем же отваром. В случае с жирной кожи потребуется уже 3 таблетки по 500 мг левомицетина, пара ложек настоя календулы и столовая ложка косметической глины (зелёной или же голубой). Компоненты смешиваются и применяются так же, как и предыдущий вариант.

Лосьон для наружного применения

Изобретение относится к косметической промышленности, а именно к лосьону для наружного применения. Лосьон для наружного применения, содержащий стрептоцид, левомицетин, салициловый спирт, трихопол, спирулин, эфирный спирт и витамин С, при определенном количественном составе компонентов. Вышеописанный лосьон является простым по составу и эффективным для устранения высыпаний, восстановления проблемной кожи. 3 ил., 3 пр.

 

Настоящее изобретение относится к области косметических средств, в частности к средствам для ухода за кожей лица.

Известен набор средств для лечения угревой болезни (патент на изобретение RU 2394557, опубл. 20.07.2010 Бюл. № 20), который содержит противовоспалительную маску, включающую окись магния, тальк, крахмал, каолин, камфару, борную кислоту, серу, при этом вода используется в качестве разбавителя; отшелушивающую маску, включающую каолин, бодягу, при этом перекись водорода используется в качестве разбавителя; антисептическую маску, включающую синтомициновую эмульсию, серу, левомицетин, норсульфазол, кислоту салициловую, кислоту бензойную, кислоту борную, кислоту лимонную (и/или аскорбиновую), раствор бриллиантового зеленого; лечебный лосьон, включающий камфару, кислоту салициловую, стрептоцид, левомицетин, буру, спирт этиловый, при этом компоненты взяты в определенном количестве. Недостатком данного набора является сложный состав масок.

Наиболее близким к заявленному техническому решению является способ лечения угревой болезни (патент на изобретение RU 2345753, опубл. 10.02.2009 Бюл. № 4), где лечение проводят сеансами, через день. Первый сеанс включает очищение кожи с помощью антисептического геля, вапоризацию, мануальную чистку, обработку антисептическим лосьоном, проведение дарсонвализации, точечного и лимфодренирующего массажа, и последующее нанесение противовоспалительной маски, а затем — защитного крема или сыворотки, применение криомассажа. Второй сеанс после очищения кожи включает нанесение противовоспалительной маски и последующее нанесение маски рассасывающего и отшелушивающего действия, осуществление глубокого массажа, проведение дарсонвализации и криомассажа и обработку кожи на ночь в области угрей лосьоном, содержащим 70% спирт, камфору, кислоту салициловую, стрептоцид, левомицетин, буру. Третий сеанс после очищения кожи включает нанесение противовоспалительной маски, антисептической маски, проведение массажа по Жаке, и осуществление дарсонвализации и криомассажа локально на воспаленные элементы. В качестве противовоспалительной маски используют композицию, содержащую окись магния, тальк, крахмал, каолин (белая глина), камфору, борную кислоту, серу. В качестве маски рассасывающего и отшелушивающего действия используют смесь каолина и бодяги. В качестве антисептической маски используют композицию, содержащую 5% синтомициновую эмульсию, серу, левомицетин, норсульфазол и/или стрептоцид, кислоту салициловую, кислоту бензойную, кислоту борную, кислоту лимонную, бриллиантовый зеленый. Указанные сеансы используют в последовательности, зависящей от степени угревой болезни. Недостатком данного способа также является многоэтапность способа, сложность его осуществления.

Задачей, на решение которой направлено заявляемое изобретение, является разработка лосьона для наружного применения, доступного в применении.

Данная задача решается тем, что лосьон для наружного применения содержит стрептоцид, левомицетин, салициловый спирт, трихопол, спирулин, эфирный спирт и витамин С при следующем количественном составе компонентов:

— салициловый спирт — 38-42 мл

— левомицетин — 2950-3050 мг

— трихопол — 980-1020 мг

— спирулин — 2155-2245 мг

— стрептоцид — 585-615 мг

— эфирный спирт — 2,94-3,06 мл

— витамин С — 1,9-2,1 мг

Техническим результатом, обеспечиваемым приведенной совокупностью признаков, является простота и эффективность состава.

Лосьон для наружного применения предназначен для устранения воспалительных элементов (прыщей), восстановления проблемной кожи. Лосьон подходит для любого типа кожи, от любых высыпаний, для потребителей любого возраста.

Лосьон для наружного применения состоит из салицилового спирта, левомицетина, трихопола, спирулина, стрептоцида, эфирного спирта и витамина С.

Салициловый спирт — эффективное средство для устранения кожных проблем. Часто средство используется в борьбе с угревой сыпью и прыщами. Спиртовой раствор салициловой кислоты обладает отличными антисептическими, антибактериальными, противогрибковыми и противовоспалительными свойствами.

Трихопол (метронидазол) — противопротозойный препарат с антибактериальной активностью, производное 5-нитроимидазола. Механизм действия заключается в биохимическом восстановлении 5-нитрогруппы метронидазола внутриклеточными транспортными протеинами анаэробных микроорганизмов и простейших. Восстановленная 5-нитрогруппа метронидазола взаимодействует с ДНК клетки микроорганизмов, ингибируя синтез их нуклеиновых кислот, что ведет к гибели микроорганизмов.

Левомицетин — бактериостатический антибиотик широкого спектра действия, нарушает процесс синтеза белка в микробной клетке. Эффективен в отношении штаммов бактерий, устойчивых к пенициллину, тетрациклинам, сульфаниламидам.

Бисептол — комбинированный антибактериальный препарат, содержит сульфаметоксазол и триметоприм. Сульфаметоксазол, сходный по строению с ПАБК, нарушает синтез дигидрофолиевой кислоты в бактериальных клетках, препятствуя включению ПАБК в ее молекулу. Триметоприм усиливает действие сульфаметоксазола, нарушая восстановление дигидрофолиевой кислоты в тетрагидрофолиевую — активную форму фолиевой кислоты, ответственную за белковый обмен и деление микробной клетки. Является бактерицидным препаратом широкого спектра действия.

Спирулина относится к нитчатым сине-зеленым водорослям. Польза растения содержится в его биологическом составе. Каждый из компонентов отвечает за жизненно важные функции и свойства человеческого тела. Она богата не только полезными веществами, но и витаминами. В2, В6 и В12 регулируют холестерин в крови, нормализуют обмен веществ и принимают активное участие в процессе творения крови.

Стрептоцид — антибактериальное средство широкого спектра действия. Сульфаниламид (стрептоцид) — один из первых представителей химиотерапевтических средств группы сульфаниламидов. Оказывает бактериостатическое действие. Механизм действия обусловлен конкурентным антагонизмом с ПАБК и конкурентным угнетением фермента дигидроптероатсинтетазы. Это приводит к нарушению синтеза дигидрофолиевой, а затем тетрагидрофолиевой кислоты и в результате — к нарушению синтеза нуклеиновых кислот. Применяется при лечении инфекционных заболеваний кожи и слизистых оболочек.

Витамин C — витаминное средство, оказывает метаболическое действие, не образуется в организме человека, а поступает только с пищей. Участвует в регулировании окислительно-восстановительных процессов, углеводного обмена, свертываемости крови, регенерации тканей; повышает устойчивость организма к инфекциям, уменьшает сосудистую проницаемость, снижает потребность в витаминах B1, B2, А, Е, фолиевой кислоте, пантотеновой кислоте.

Лосьон применяется:

— как противовоспалительное;

— как противогрибковое;

— от раздражения;

— при ссадинах;

— при дерматитах;

— как антисептическое;

— как ранозаживляющее;

— как противомикробное;

— как осветляющее.

Лосьон для наружного применения в основном содержит следующий количественный состав компонентов:

— салициловый спирт 38-42 мл

— левомицетин 2950-3050 мг

— трихопол 980-1020 мг

— спирулин 2155-2245 мг

— стрептоцид 585-615 мг

— эфирный спирт 2,94-3,06 мл

— витамин С 1,9-2,1 мг

Способ производства лосьона следующий. Все ингредиенты смешиваются в емкости и фасуются в тару.

Используют полученный лосьон следующим образом. Лосьон наносится на ватный диск и наносится на ночь на очищенную кожу, не смывается.

Ниже приведены примеры осуществления изобретения.

Пример 1

Лосьон для наружного применения содержит:

— салициловый спирт 40 мл

— левомицетин 3000 мг

— трихопол 1000 мг

— спирулин 2200 мг

— стрептоцид 600 мг

— эфирный спирт 3 мл

— витамин С 2 мг

Пациент №1, 22 года (фиг.1). Кожа жирная, множественные комедоны, атрофические рубцы синюшно-багрового цвета. Прошел двухнедельный курс лечения лосьоном. После лечения кожные покровы очистились, новые высыпания отсутствуют. Кожный рельеф выровнялся, остались единичные узелки и пятна, цвет лица улучшился.

Пример 2

Лосьон для наружного применения содержит:

— салициловый спирт 38 мл

— левомицетин 2950 мг

— трихопол 1020 мг

— спирулин 2155 мг

— стрептоцид 615 мг

— эфирный спирт 3,06 мл

— витамин С 2,1 мг

Пациент №2, 20 лет (фиг.2). Повышенная жирность кожи, единичные высыпания на щеках, мелкие красные пятна. Получал лечение в течение одной недели. После лечения состояние кожи удовлетворительное, воспаление спало.

Пример 3.

Лосьон для наружного применения содержит:

— салициловый спирт 42 мл

— левомицетин 3050 мг

— трихопол 980 мг

— спирулин 2245 мг

— стрептоцид 585 мг

— эфирный спирт 2,94 мл

— витамин С 1,9 мг

Пациент №3, 23 года (фиг.3), обратился с жалобами по поводу угревой сыпи. Прошел трехнедельный курс лечения бальзамом. После лечения кожные покровы очистились, новые высыпания отсутствуют. Кожный рельеф выровнялся, остались единичные узелки и пятна, цвет лица улучшился.

Преимуществами заявленного лосьона являются:

— не вызывает аллергии;

— не сушит кожу;

— не раздражает кожу;

— возможно применение в любое время года;

— количество нанесений не ограниченно;

— нет возрастных ограничений;

— нет конкретной локализации нанесения;

— доступность;

— эффективность;

— низкая цена.

Однако существует индивидуальная непереносимость препарата.

Лосьон для наружного применения, содержащий стрептоцид, левомицетин, отличающийся тем, что также содержит салициловый спирт, трихопол, спирулин, эфирный спирт и витамин С при следующем количественном составе компонентов:

салициловый спирт 38-42 мл
левомицетин 2950-3050 мг
трихопол 980-1020 мг
спирулин 2155-2245 мг
стрептоцид 585-615 мг
эфирный спирт 2,94-3,06 мл
витамин С 1,9-2,1 мг

Взаимодействий с хлорамфениколом — Средство проверки взаимодействий с Drugs.com

  1. Препараты от А до Я
  2. Хлорамфеникол
  3. Взаимодействия

Всего известно 441 лекарство, взаимодействуют с хлорамфеникол классифицируются как 36 основных, 388 умеренных и 17 второстепенных.

Взаимодействует ли хлорамфеникол с другими моими препаратами?

Введите другие лекарства, чтобы просмотреть подробный отчет.

Наиболее часто проверяемые взаимодействия

Просмотр отчетов о взаимодействии хлорамфеникола и перечисленных ниже лекарств.

  • Майор
  • Умеренная
  • Незначительный
  • Неизвестно

Взаимодействие с хлорамфениколом при болезни

Левомицетин может взаимодействовать с 3 болезнями, в том числе:

Подробнее о хлорамфениколе

Сопутствующие руководства по лечению

Классификация лекарственного взаимодействия
Эти классификации являются только ориентировочными. Релевантность взаимодействия конкретных лекарств для конкретного человека определить сложно.Всегда консультируйтесь со своим врачом перед началом или прекращением приема каких-либо лекарств.
Major Очень клинически значимо. Избегайте комбинаций; риск взаимодействия перевешивает пользу.
Умеренная Умеренно клинически значимо. Обычно избегают комбинаций; используйте его только при особых обстоятельствах.
Незначительное Минимально клинически значимое. Минимизировать риск; оценить риск и рассмотреть альтернативный препарат, предпринять шаги, чтобы избежать риска взаимодействия и / или разработать план мониторинга.
Неизвестно Информация о взаимодействии отсутствует.

Дополнительная информация

Всегда консультируйтесь со своим врачом, чтобы убедиться, что информация, отображаемая на этой странице, применима к вашим личным обстоятельствам.

Заявление об ограничении ответственности в отношении медицинских услуг

Метронидазол: применение, взаимодействие, механизм действия

Резюме

Метронидазол — это нитроимидазол, используемый для лечения трихомониаза, амебиаза, воспалительных поражений розацеа и бактериальных инфекций, а также для предотвращения послеоперационных инфекций.

Торговые наименования

Flagyl, Flagystatin, Metrocream, Metrogel, Metrolotion, Nidagel, Noritate, Nuvessa, Pylera, Rosadan, Vandazole

Общее название DB
Metronidazole
Справочная информация о банке лекарств

Метронидазол — широко используемый антибиотик, относящийся к классу антибиотиков нитроимидазола. 14 Он часто используется для лечения желудочно-кишечных инфекций, а также трихомониаза, лямблиоза и амебиаза, которые являются паразитарными инфекциями. 4 Метронидазол использовался в качестве антибиотика в течение нескольких десятилетий 15 с дополнительными противопаразитарными свойствами, которые отличают его от многих других антибактериальных препаратов, что позволяет лечить широкий спектр инфекций. Он доступен в форме капсул, таблеток и форм для местного применения, а также в виде суппозиториев для лечения различных инфекций.

Тип
Малая молекула
Группы
Утверждено
Структура
Вес
Среднее значение: 171.154
Моноизотоп: 171.0643
Химическая формула
C 6 H 9 N 3 O 3
Синонимы
  • 1- (2-гидрокси-1-этил) -2-метил -5-нитроимидазол
  • 1- (2-гидроксиэтил) -2-метил-5-нитроимидазол
  • 1- (β-этил) -2-метил-5-нитро-3-азапиррол
  • 1- (β-гидроксиэтил ) -2-метил-5-нитроимидазол
  • 1- (β-оксиэтил) -2-метил-5-нитроимидазол
  • 2-метил-1- (2-гидроксиэтил) -5-нитроимидазол
  • 2-метил-3 — (2-гидроксиэтил) -4-нитроимидазол
  • 2-метил-5-нитроимидазол-1-этанол
  • Метронидазол
  • Метронидазол
  • Метронидазол
  • Метронидазол
    • Внешний вид
      • 9 9004
      • БАЙЕР-5360
      • НСК-50364
      • NSC-69587
      • RP 8823
      • RP-8823
Показания

Метронидазол показан для лечения подтвержденного трихомониаза, вызванного Trichomonas vaginalis (за исключением первого триместра беременности) и половых партнеров пациентки, бактериального вагиноза 16 , некоторых типов амебиаз и различные анаэробные инфекции. 11 Вышеуказанные анаэробные инфекции могут возникать на коже и кожных структурах, в брюшной полости, сердце, репродуктивных органах, центральной нервной системе и дыхательной системе. Некоторые из них также могут присутствовать в кровотоке в случае сепсиса. Обычными инфекциями, которые лечатся метронидазолом, являются инфекции видов Bacteroides, инфекции Clostridium и инфекции Fusobacterium, а также инфекции Peptococcus и Peptostreptococcus. 14

Он также используется не по назначению при лечении болезни Крона и розацеа, в качестве профилактического средства после хирургических вмешательств 5 и при лечении инфекции Helicobacter pylori. 7 Он также был изучен для предотвращения преждевременных родов и лечения заболеваний пародонта. 1,12

Снижение количества неудачных попыток разработки лекарств.

Создание, обучение и проверка моделей машинного обучения с использованием структурированных наборов данных, основанных на фактических данных.

Создавайте, обучайте и проверяйте прогнозные модели машинного обучения с помощью структурированных наборов данных.

Сопутствующие условия
Сопутствующие методы лечения
Противопоказания и предупреждения «черного ящика»

Избегайте опасных для жизни побочных эффектов, связанных с приемом лекарств & более.

Избегайте опасных для жизни побочных эффектов лекарств и улучшайте поддержку принятия клинических решений.

Фармакодинамика

Метронидазол лечит амебиаз, трихомониаз и лямблиоз, проявляя как антибактериальное, так и противопротозойное действие. 16 Метронидазол — эффективное средство для лечения некоторых анаэробных бактериальных инфекций. 11 Метронидазол продемонстрировал антибактериальную активность против большинства облигатных анаэробов, однако во время исследований in vitro он не продемонстрировал значительного действия против факультативных анаэробов или облигатных аэробов. 14 Восстановление нитрогруппы метронидазола анаэробными организмами, вероятно, отвечает за антимикробные цитотоксические эффекты препарата, вызывая повреждение цепи ДНК у микробов. 5,7

Записка о судорогах, невропатии и канцерогенезе

Важно знать о риске периферической невропатии и судорог, связанных с метронидазолом, особенно в более высоких дозах. При возникновении судорог или онемения конечностей немедленно прекратите прием препарата. 14 Метронидазол оказался канцерогенным для мышей и крыс. Актуальность этого эффекта для людей неизвестна. Рекомендуется назначать метронидазол только при клинической необходимости и только по утвержденным показаниям. 17

Механизм действия

Точный механизм действия метронидазола полностью не установлен, однако возможно, что промежуточное соединение при восстановлении метронидазола, которое вырабатывается только анаэробными бактериями и простейшими, связывает дезоксирибонуклеиновую кислоту и электроны. транспортные белки организмов, блокирующие синтез нуклеиновых кислот. 14 После приема метронидазол попадает в клетки путем пассивной диффузии. После этого ферредоксин или флаводоксин восстанавливают свою нитрогруппу до нитрорадикалов. Окислительно-восстановительный потенциал частей транспорта электронов анаэробных или микроаэрофильных микроорганизмов делает метронидазол селективным по отношению к этим организмам, которые вызывают восстановление нитрогрупп, что приводит к образованию токсичных метаболитов. К ним относятся N- (2-гидроксиэтил) оксамовая кислота и ацетамид, которые могут повредить ДНК реплицирующихся организмов. 5

Поглощение

После внутривенной инфузии дозы 1,5 г пиковая концентрация была достигнута в течение 1 часа и составила 30-40 мг / л. 16 При внутривенном введении нескольких доз по 500 мг три раза в день, стабильные концентрации достигаются в течение примерно 3 дней, а пиковая концентрация составляет 26 мг / л. 16 При пероральном приеме в форме таблеток метронидазол полностью абсорбируется, демонстрируя биодоступность более 90%. 7 Один ресурс указывает, что Cmax после однократного перорального приема 500 мг метронидазола колеблется от 8 до 13 мг / л с Tmax от 25 минут до 4 часов. AUC после однократного перорального приема 500 мг метронидазола составила 122 ± 10,3 мг / л • ч. 7

Примечание о абсорбции препаратов местного действия

Незначительное чрескожное всасывание метронидазола происходит после местного применения 1% крема метронидазола. Здоровые добровольцы нанесли одну дозу 100 мг 2% крема метронидазола, меченного 14C, на целую кожу.Через 12 часов метронидазол в плазме не обнаруживался. Примерно от 0,1% до 1% введенного метронидазола было измерено в моче и кале. 16

Объем распределения

Метронидазол широко распространяется в организме 5 и в различных жидкостях организма. К ним относятся желчь, слюна, грудное молоко, спинномозговая жидкость и плацента. 16 Устойчивое объемное распределение метронидазола у взрослых колеблется от 0.От 51 до 1,1 л / кг. Он достигает от 60 до 100% концентраций в плазме в различных тканях, таких как центральная нервная система, однако не измеряется в высоких концентрациях в ткани плаценты. 7

Связывание с белками

Метронидазол связывается с белками плазмы менее чем на 20%. 7,16

Метаболизм

Метронидазол подвергается метаболизму в печени путем гидроксилирования, окисления и глюкуронизации. Метронидазол в процессе метаболизма дает 5 метаболитов.Гидроксиметаболит, 1- (2-гидроксиэтил) -2-гидроксиметил-5-нитроимидазол, считается основным активным метаболитом. 7,13 Неизмененный метронидазол обнаруживается в плазме вместе с небольшими количествами его 2-гидроксиметилового метаболита. В моче обнаруживается несколько метаболитов метронидазола. Они в первую очередь являются продуктом окисления боковых цепей в дополнение к конъюгации глюкуронида. Только 20% дозы, обнаруженной в моче, приходится на неизмененный метронидазол. 16 Два основных окислительных метаболита метронидазола — это метаболиты гидрокси и уксусной кислоты. 6,9

Наведите указатель мыши на продукты ниже, чтобы увидеть партнеров по реакции.

Путь выведения

Метронидазол и его метаболиты выводятся на 60–80% с мочой, а 6–15% — с калом. 7,14

Период полувыведения

Период полувыведения метронидазола составляет 7,3 ± 1,0 после однократного внутривенного введения 500 мг здоровым предметам. 16 Другой источник указывает, что период полувыведения метронидазола составляет от 6 до 10 часов. 7

Клиренс

У пациентов с печеночной недостаточностью может потребоваться корректировка дозы, так как у этих пациентов нарушен клиренс. 16 Клиренс метронидазола в почках оценивается в 10 мл / мин / 1,73 м2. 14 Общий клиренс из сыворотки составляет от 2,1 до 6,4 л / ч / кг. 7

Неблагоприятные эффекты

Улучшение поддержки принятия решений и результатов исследований

Со структурированными данными о побочных эффектах, включая: предупреждений в виде черного ящика, побочные реакции, предупреждения и меры предосторожности, а также показатели заболеваемости.

Улучшите поддержку принятия решений и результаты исследований с помощью наших структурированных данных о побочных эффектах.

Токсичность

Информация о LD50

Пероральная LD50 метронидазола у крыс составляет 5000 мг / кг 16

Информация о передозировке

Побочные эффекты, которые могут быть преувеличены при передозировке, включают периферическую невропатию, токсичность для центральной нервной системы, судороги, дисульфирамоподобный эффект (в сочетании с алкоголем), темную мочу, металлический привкус во рту, тошноту, дискомфорт в эпигастрии и головокружение. помимо нейтропении. 10,16 Специфического антидота при передозировке метронидазолом не существует. В дополнение к введению активированного угля следует использовать симптоматическое и поддерживающее лечение для удаления неабсорбированного лекарственного средства из желудочно-кишечного тракта. В дополнение к вышеуказанным мерам, свяжитесь с местным токсикологическим центром для получения обновленной информации о лечении передозировки метронидазола. 16

Пути
Недоступно
Фармакогеномные эффекты / ADR
Недоступно

Аспирин увеличивает чувствительность Helicobacter pylori к метронидазолу за счет увеличения внутриклеточных концентраций антимикробных препаратов

Резюме

ЦЕЛЬ: изучить механизмы увеличения чувствительности Helicobacter pylori ( H pylori ) в метронидазол.

МЕТОДЫ. В это исследование были включены эталонный штамм H. pylori 26 695 и два метронидазолустойчивых изолята H. pylori . Штаммы инкубировали в бульоне Brucella с аспирином или без него (1 ммоль / л). Ген rdxA H pylori амплифицировали с помощью ПЦР и секвенировали. Проницаемость H pylori для противомикробных препаратов определяли путем анализа внутриклеточной радиоактивности клеток после инкубации с [7- 3 H] -тетрациклином.Белки внешней мембраны (OMP) H pylori 26 695 были очищены и проанализированы с помощью SDS-PAGE. Экспрессию 5 поринов (hopA, hopB, hopC, hopD и hopE) и предполагаемую систему оттока RND (hefABC) H pylori анализировали с помощью количественной ПЦР в реальном времени.

РЕЗУЛЬТАТЫ: Мутации в гене rdxA не изменились в изолятах, устойчивых к метронидазолу, обработанных аспирином. Радиоактивность H pylori увеличивалась при лечении аспирином, что указывает на то, что аспирин улучшает проницаемость внешней мембраны H pylori .Однако экспрессия двух полос OMP между 55 и 72 кДа изменялась в присутствии аспирина. Экспрессия мРНК hopA, hopB, hopC, hopD, hopE и hefA, hefB, hefC H. pylori не изменялась при лечении аспирином.

ЗАКЛЮЧЕНИЕ: Хотя аспирин увеличивает чувствительность H pylori к метронидазолу, он не влияет на мутации гена rdxA H pylori . Аспирин увеличивает внутриклеточные концентрации противомикробных препаратов, вероятно, за счет изменения экспрессии OMP.

Ключевые слова: Helicobacter pylori, аспирин, метронидазол, резистентность, минимальные ингибирующие концентрации

ВВЕДЕНИЕ

Аспирин, называемый нестероидными противовоспалительными препаратами (НПВП), является одним из наиболее широко используемых препаратов во всем мире. Он ингибирует циклооксигеназы (ЦОГ), тем самым необратимо блокируя превращение арахидоновой кислоты в простаноиды. Вдобавок считается, что аспирин обеспечивает некоторую защиту от ишемической болезни сердца [1], частично благодаря ингибированию тромбоксана А2, мощного агрегатора тромбоцитов.Сообщалось, что аспирин демонстрирует химиопрофилактическую активность против рака пищевода, желудка и толстой кишки, вызывая апоптоз в эпителиальных клетках и регулируя ангиогенез [2–4]. Аспирин также оказывает множество эффектов на различные виды бактерий. Предыдущие исследования показали, что аспирин может подавлять рост некоторых бактерий, влиять на выработку факторов вирулентности некоторыми бактериями и изменять восприимчивость бактерий к некоторым антибиотикам, влияя на экспрессию генов и вызывая ряд морфологических и физиологических изменений у бактерий [5 ].

Мы ранее сообщали, что НПВП, включая салицилат натрия, аспирин, индометацин и целекоксиб, подавляли рост H pylori дозозависимым образом при инкубации в бульоне бруцелл in vitro [6–9]. Эти препараты также существенно влияли на активность факторов вирулентности H pylori , например уреазы и вакуулирующего цитотоксина [8,9]. Кроме того, минимальные ингибирующие концентрации (МПК) кларитромицина, метронидазола и амоксициллина до H pylori снижались при лечении низкой концентрацией аспирина [6–8], что указывает на то, что аспирин увеличивает чувствительность H pylori к этим антимикробным препаратам. .

Целью настоящего исследования было изучить механизмы действия аспирина, повышающего чувствительность H pylori к метронидазолу. Ген rdxA H pylori , обработанный аспирином и без него, анализировали с помощью ПЦР-амплификации и секвенирования. Влияние аспирина на проницаемость внешней мембраны H pylori определяли с использованием [7- 3 H] -тетрациклина. Также было определено влияние аспирина на экспрессию белков внешней мембраны (OMP) H pylori .

МАТЕРИАЛЫ И МЕТОДЫ

Chemicals

Аспирин (Sigma Chemical Co, Сент-Луис, Миссури, США) и карбонилцианид с протонным проводником м-хлорфенилгидразон (CCCP, Sigma Chemical Co.) растворяли в ДМСО (Sigma Chemical Co.) в продвигать. [7- 3 H] -тетрациклин (0,6 Ки / ммоль; 22,2 ГБк / ммоль; Dupont / NEN Research Products, Бостон, Массачусетс) недавно растворяли в разбавленной соляной кислоте.

Штаммы и условия культивирования

H pylori эталонный штамм 26 695 (чувствительный к метронидазолу) и два клинических изолята H pylori (устойчивый к метронидазолу, R1 и R2) были включены в это исследование.Штаммы культивировали на чашках с колумбийским агаром, содержащим 8% овечьей крови, в микроаэробной атмосфере (10% CO 2 и 5% O 2 ) при 37 ° C в течение 2-3 дней. H pylori из 10 8 КОЕ / мл затем инокулировали в 20 мл бульона Brucella (Difco Laboratories, Детройт, штат Мичиган, США) с добавлением 10% фетальной бычьей сыворотки (FBS; Gibco-BRL, Гранд-Айленд, штат Нью-Йорк, США). ) в наборе 10 см чашек Петри с 1 ммоль / л аспирина или с контролем носителя (ДМСО 0,1%). Чашки помещали в анаэробный сосуд (Oxoid) и инкубировали при 37 ° C на шейкере со скоростью 60 об / мин в микроаэробных условиях в течение 48 часов.

Определение МИК

Бактерии готовили в бульоне для инфузии сердца мозга с получением количества жизнеспособных клеток 3 × 10 8 КОЕ / мл (что эквивалентно 1 стандартной единице мутности МакФарланда) и использовали в качестве инокулята для тестирования чувствительности. Бактериальную суспензию (100 мкл) наносили в двух экземплярах на чашки с колумбийским агаром с аспирином (1 ммоль / л) или без него. На каждую пластину наносили одну тест-полоску метронидазола (OXOID Ltd, Англия). МИК метронидазола и возможное влияние аспирина на МИК метронидазола определяли через 72 часа инкубации при 37 ° C в микроаэробных условиях.

Экстракция геномной ДНК

H pylori геномная ДНК была экстрагирована с использованием метода диоксицида кремния. Клетки собирали и дважды промывали фосфатно-солевым буфером (PBS) (0,01 моль / л, pH 7,2). Осаждение клеток суспендировали в 100 мкл ТЕ. Затем 5 мкл SiO 2 Liq. и 400 мкл связывающего буфера (содержащего 4 моль / л изотиоцианата гуанидиния, 50 ммоль / л трис-HCl, 20 ммоль / л EDTA) добавляли и инкубировали при 55 ° C в течение 5 минут при встряхивании один раз в минуту. Суспензию центрифугировали при 8000 об / мин в течение 30 с при комнатной температуре и осадок трижды промывали очищающим буфером (содержащим 20 ммоль / л Трис-HCl, 1 ммоль / л EDTA, 100 ммоль / л NaCl и дегидратированный спирт).Полученную суспензию сушили при 55 ° C и хранили при -20 ° C.

Амплификация гена rdxA H. pylori и секвенирование

Фрагменты (886 п.н.), содержащие полный ген rdxA , амплифицировали с помощью ПЦР. Прямой праймер: 5′-AGGGATTTTATTGTATGCTACAA-3 ‘; Обратный праймер: 5’-AGGAGCATCAGATAGTTCTGA-3 ‘. ПЦР-амплификацию проводили в 25 мкл реакционного раствора, содержащего 2 мкл геномной ДНК H pylori , 4,5 мкл 10-кратного буфера для ПЦР (с 15 мкмоль / л MgCl 2 ), 2 мкл dNTP (по 2 каждого.5 ммоль / л), 2 мкл прямого и обратного праймеров (каждый 5 мкмоль / л), 0,5 мкл TaqDNA-полимеразы (1 ед. / Мкл) и 9 мкл ddH 2 O. Первоначально реакцию денатурировали при 94 °. C в течение 5 мин, затем 30 циклов, каждый из которых состоит из 30 с при 94 ° C (денатурация), 1 мин при 52 ° C (отжиг) и 1 мин при 72 ° C (удлинение). После окончательного продления в течение 10 минут при 72 ° C ампликоны подвергали электрофорезу в 1,5% агарозном геле и очищали с использованием метода диоксицида кремния, как описано выше. Полученный ген rdxA секвенировали с помощью процедуры терминации дидезокси-цепи в Beijing Li-Jia-Tai-Cheng Technology Company.Гены rdxA H pylori , обработанные аспирином и без него, были проанализированы в режиме онлайн (http://align.genome.jp).

Исследования поглощения с использованием [7-

3 H] тетрациклина

Штамм 26 695 выращивали до средне-логарифмической фазы (приблизительно от 3 × 10 9 до 5 × 10 9 КОЕ / мл) в бульоне Brucella и затем добавляли 1 ммоль / л аспирина или ДМСО (<1%, контроль носителя) в течение 6 часов при 37 ° C на шейкере при 60 об / мин в микроаэробных условиях.Суспензию клеток центрифугировали при 8000 об / мин в течение 10 мин при комнатной температуре, осадок промывали и суспендировали в буфере HEPES (pH 7,2, содержащий 100 мкмоль / л MgCl 2 ). При комнатной температуре к 10 мл клеточной суспензии добавляли 5 мкКи [7- 3 H] -тетрациклин (0,6 Ки / ммоль; 22,2 ГБк / ммоль; Dupont / NEN Research Products, Бостон, США). Через 20 мин каждую клеточную суспензию делили на две половины и к половине добавляли 100 мкмоль / л CCCP. Аликвоты по 1 миллилитру отбирали с 10-минутными интервалами и трижды промывали PBS.Затем полученные гранулы разбавляли сцинтилляционной жидкостью и анализировали на радиоактивность в сцинтилляционном счетчике (TRI-CARB 2100TR).

Очистка OMPs

H. pylori 26 695 инкубировали в бульоне Brucella в течение 48 часов. Суспензию центрифугировали при 8000 об / мин в течение 10 минут, промывали и суспендировали в ледяном буфере Трис-Mg (10 ммоль / л Трис-HCl, содержащий 5 ммоль / л MgCl 2 , pH 7,3) и обрабатывали ультразвуком (один раз. 30 с с интервалом 3-5 с в течение 5 мин) до тех пор, пока большая часть клеток не будет разрушена, как это видно под микроскопом.Неразрушенные клетки удаляли центрифугированием при 8000 об / мин в течение 20 мин при 4 ° C. Внутреннюю и внешнюю мембраны концентрировали центрифугированием при 50 000 об / мин в течение 60 мин при 4 ° C. Осадок суспендировали в 2% Triton Tris-Mg (pH 7,5) и инкубировали в течение 30 минут при комнатной температуре, а затем центрифугировали и снова инкубировали в тех же условиях. Полученные гранулы, OMP, дважды промывали 10 ммоль / л трис-HCl и растворяли в ddH 2 О. Конечную концентрацию OMP определяли методом кумасси бриллиантового синего R250.

Гель-электрофорез в SDS-PAGE

Десять микрограмм OMP использовали для гель-электрофореза в SDS-PAGE при постоянном напряжении (5% -ный гель-стекинг при 60 В, 10% -ный разделяющий гель при 100 В). После 30 мин инкубации в фиксирующей жидкости гель окрашивали кумасси бриллиантовым синим G250 в течение 30 мин.

Выделение тотальной РНК и обратная транскрипция

Общую РНК получали методом TRIzol, как описано производителем (Invitrogen, Burlington, Ontario, Canada), и загрязняющую ДНК удаляли обработкой ДНКазой I в соответствии с инструкциями производителя (Sigma) .Для синтеза кДНК 4 мкг РНК, разбавленной DEPC H 2 O, нагревали до 70 ° C в течение 5 минут и быстро охлаждали на льду в течение 15 минут. Затем образцы добавляли к 20 мкл реакционной смеси, содержащей 2 мкл случайных гексамерных праймеров (1 мкг / мкл), 0,4 мкл RNasin, 1 мкл M-MLV, 4 мкл dNTP (каждый 2,5 ммоль / л) и 4 мкл 5 × RT буфера. Реакцию синтеза кДНК проводили в течение 60 мин при 37 ° C. Затем фермент инактивировали при 95 ° C в течение 5 мин. Аликвоты кДНК хранили при -70 ° C.

Количественная ПЦР в реальном времени

Уровни мРНК hopA, hopB, hopC, hopD, hopE и hefA, hefB, hefC определяли с помощью ПЦР в реальном времени с использованием системы обнаружения последовательностей ABI Prism 7700 (Perkin-Elmer Applied Biosystems, Фостер-Сити, Калифорния.). Специфические праймеры и зонды TaqMan были сконструированы с помощью программы Primer Express 3.0 (Perkin-Elmer Applied Biosystems) (таблица). Стандартная кривая была построена с использованием 10-кратных серийных разведений каждой кДНК. Реакционные смеси для ПЦР (50 мкл) готовили путем смешивания 5 мкл раствора синтезированной кДНК с 5 мкл 10-кратного буфера для ПЦР (содержащего 15 мкмоль / л MgCl 2 ), 3 мкл прямого и обратного праймеров (каждый по 5 мкмоль / л). , 4 мкл dNTP (каждый 2,5 ммоль / л), 2 мкл зонда TagMan, 1 мкл ROX, 0,5 мкл полимеразы TaqDNA (1 ед. / Мкл).ПЦР проводили при 95 ° C в течение 10 минут, затем 40 циклов при 95 ° C в течение 15 секунд и 60 ° C в течение 60 секунд в соответствии с инструкциями производителей. Уровни мРНК белка выражали как отношение мРНК белка к мРНК 16S рРНК [соотношение мРНК белка (ед. / Мл) / мРНК 16S рРНК (ед. / Мл) × 100 000]. ПЦР проводили пятикратно с использованием образцов, приготовленных одновременно.

Таблица 1

Праймеры и зонды, используемые в количественной ПЦР в реальном времени

TAACGCTAGCCAACAACGCTAACATCAGCA CGCTCTTTATAACGCGCAAGTAA GCTGTTCCCGGCTCTGAATC 905 AGACAAACAGGCTCAAAGCGATTCC
Тип зонда или праймера Последовательность (5′-3 ‘)
hopA F ATCATGCTAGTGATGGCGTTAAAG
HOPA R CAGGCATAGACGGAGGCAAT
HOPA зонд CCAAAAATATTGCATGCGTTCCCGC
hopB F CTTGGTGCAAAACATCGTCAAT
hopB R CCCGCCATAGCTCACTTGAT
hopB зонд
hopC F
hopC R
hopC зонд TGGATAAAATCAACGCGCTCAACAATCAG 900 52
hopD F CTGCTTGAGCGCGGTTTAA
hopD R CAACCTAGACACTGGGAAAGCAT
hopD Зонд CTTGCGCTCTAGCGTTAGCGAACATGC
надежду на F GGATTGCACAGGGAGTGTTGT
надежду на то, R GCCCCATTAGCGTATTTAGCAT
надежду на зонд TTGCCCCCCAGGTCTTACCGCT
Hefa F AGGGCGTTTTGGGAATTTCT
Hefa R GCATGATGGATTGTTTTTGCA
Hefa зонд CCCCGGTCAGCAAAATACGGCTG
hefB F AGGGCGATGTTTTGTTGCTT
hefB ICCCAATTTTGCTGTATCGT
hefB A Зонд
hefC F GTTTGCGTTCTTGCGTAACG
hefC R TGTTTAATGAAAAGCCCATCCA
hefC Зонд CACGATCACCCTCGTTTCAGCGATC
16S рРНК F CCGCCTACGCGCTCTTTAC
16S рРНК R CTAACGAATAAGCACCGGCTAAC
16S рРНК Зонд CCCAGTGATTCCGAGTAACGCTTGCA

Статистический анализ SAS

Статистический анализ был проведен с использованием статистического анализа SSSS.0. Репрезентативные данные внутриклеточной радиоактивности и количественной ПЦР были представлены как среднее ± стандартное отклонение. Для сравнения данных использовался тест Стьюдента t . P <0,05 считали статистически значимым.

РЕЗУЛЬТАТЫ

Влияние аспирина на МИК метронидазола

Для штамма R1 МИК метронидазола снизилась с 256 мкг / мл до 0,25 мкг / мл в присутствии аспирина (1 ммоль / л), а для штамма R2 — МИК метронидазола уменьшилось с 64 мкг / мл до значения ниже читаемого (0.016 мкг / мл), что указывает на то, что аспирин увеличивает чувствительность H pylori к метронидазолу и превращает эти два устойчивых штамма в чувствительные штаммы.

Влияние аспирина на мутации гена rdxA

Фрагменты ДНК длиной 886 п.н., содержащие полный ген rdxA , амплифицировали с помощью ПЦР для эталонного штамма H pylori 26 695 и двух штаммов, устойчивых к метронидазло (R1, R2), обработанных или без аспирина. Анализ последовательности выявил точечные мутации, вставки и делеции в гене rdxA штамма R2 по сравнению с эталонным штаммом 26 695, а нуклеотидная гомология между двумя штаммами (26 695 и R2) составила 94.4%. Однако нуклеотидная гомология гена rdxA между штаммом R2 и его соответствующим изолятом R2 (A) (штамм R2, обработанный аспирином) составляла более 99,5% (рисунок и рисунок).

Сравнение последовательностей на линии (http://align.genome.jp) гена rdxA между устойчивым к метронидазолу штаммом (R2) и эталонным штаммом H pylori 26 695 (S).

Сравнение последовательностей на линии (http://align.genome.jp) гена rdxA между устойчивым к метронидазолу штаммом (R2) и его соответствующим чувствительным штаммом в присутствии аспирина [R2 (A)].

Влияние аспирина на проницаемость внешней мембраны H. pylori

Независимо от присутствия CCCP, радиоактивность H pylori , обработанного аспирином, была выше по сравнению с контрольным носителем (DMSO), что указывает на усиление аспирина. проницаемость наружной мембраны H pylori для антимикробного препарата (рисунок). Независимо от присутствия аспирина, радиоактивность клеток H pylori снижалась при добавлении ингибитора эффлюксной помпы CCCP, что указывает на то, что аспирин не влияет на коллапсирующий эффект CCCP на градиент протонов через цитоплазматическую мембрану H pylori . (Фигура ).

Радиоактивность клеток H pylori , обработанных аспирином (1 ммоль / л) или контрольным носителем (ДМСО). A: CCCP; B: Нет CCCP.

Радиоактивность клеток H pylori , обработанных CCCP (100 мкмоль / л) или без CCCP. A: Аспирин; B: Управление транспортным средством.

Влияние аспирина на профили OMP

Профили OMP H pylori , обработанного аспирином, были аналогичны таковым в контроле. Однако экспрессия двух OMP (Band 1 и 2) между 55 и 72 кДа изменялась в присутствии аспирина (рисунок).

Профили OMP H pylori 26 695. M: Маркер размера; C: Контроль; D: ДМСО; A: Аспирин. Группа 1: OMP увеличивается в присутствии аспирина; Группа 2: OMP снизился в присутствии аспирина.

Влияние аспирина на экспрессию мРНК поринов и системы оттока

Количественная ПЦР в реальном времени показала отсутствие значительных различий в уровнях кДНК hopA, hopB, hopC, hopD, hopE и hefA, hefB, hefC для штаммов, получавших аспирин, по сравнению с контролем.Это указывало на то, что независимо от присутствия аспирина экспрессия уровней мРНК hopA, hopB, hopC, hopD, hopE и hefA, hefB, hefC не изменялась (таблица).

Таблица 2

кДНК Уровни поринов и система оттока H. pylori , протестированные с помощью количественной ПЦР в реальном времени

905 285,8 ± 5,07
Уровни кДНК
Ген Группа аспирина ДМСО-контроль Пустой контроль
hopA 963.60 ± 23,33 1087,75 ± 26,42 856,27 ± 25,43
hopB 84,00 ± 15,97 91,45 ± 14,83 100,15 ± 16,28
9008 ± 16,28
9008 ± 16,28 ± 12,01 52,79 ± 10,27
hopD 83,86 ± 14,09 92,46 ± 17,78 89,92 ± 13,72
hopE 54.07 ± 10,58 52,77 ± 11,93 52,12 ± 9,92
hefA 12,31 ± 2,12 12,51 ± 1,99 12,97 ± 2,76
hefB ,47 25,60 ± 4,99
hefC 55,62 ± 8,89 52,08 ± 9,78 53,37 ± 10,04

ОБСУЖДЕНИЕ

H pylori — отрицательная спиралевидная бактерия. и важный патоген для человека, который колонизирует в желудке 50% населения мира [10,11].Инфекция приводит к хроническому воспалению слизистой оболочки желудка и язвенной болезни, и было доказано, что инфекция H pylori тесно связана с аденокарциномой и лимфомой лимфоидной ткани, связанной со слизистой оболочкой (MALT). Международное агентство по изучению рака при Всемирной организации здравоохранения (ВОЗ) определило H pylori как один из канцерогенов первого класса для человека [12]. Недавние исследования показали, что инфекция H pylori играет важную роль в инвазии сосудистых заболеваний сердца и головного мозга, аутоиммунных заболеваний, нарушений питания и обмена веществ, гематопатии и дерматологических заболеваний.Искоренение инфекции H pylori очень важно для предотвращения и лечения этих заболеваний. Наиболее успешные схемы лечения используют комбинации двух или более антибиотиков, таких как амоксициллин, кларитромицин, метронидазол или тетрациклин, вместе с ингибитором протонной помпы или висмутом. Однако с широким использованием противомикробных препаратов в клинической практике устойчивость к антибиотикам становится все более очевидной и считается одной из основных причин неэффективности лечения [13].

Ранние исследования показали, что салицилат подавлял рост некоторых бактерий, таких как Escherichia coli , Klebsiella pneumoniae , Pseudomonas aeruginosa и Staphylococcus epidermidis , а также влиял на активность фимбрий, жгутиков и производство биофильм. , слизь, и, таким образом, может изменить патогенность бактерий [14–21].Сообщалось, что in vitro , салицилат может изменять чувствительность бактерий к некоторым противомикробным препаратам. Салицилат индуцировал внутренний фенотип множественной антимикробной устойчивости у многих бактерий, таких как Escherichia coli , Salmonella typhimurium и Staphylococcus aureus , и повышал чувствительность некоторых бактерий к аминогликозидам [22–29]. Наши предыдущие исследования также показали, что in vitro аспирин не только подавлял рост H pylori [6–9], но также снижал МИК метронидазола, кларитромицина и амоксициллина до H pylori и даже преобразовывал некоторые устойчивые штаммы. к восприимчивым [6–8].Таким образом, в настоящем исследовании изучались механизмы увеличения восприимчивости H pylori к метронидазолу аспирином.

По крайней мере, четыре отличительных механизма устойчивости к антибиотикам описаны у бактерий: ферментативная инактивация, снижение проницаемости бактериальных мембран, активный отток антимикробных агентов и изменение участков-мишеней противомикробных препаратов для бактерий [30]. Метронидазол, кларитромицин и амоксициллин — это разные виды противомикробных препаратов, и каждый по-разному действует на разные участки-мишени в H pylori .Точно так же устойчивость H pylori к этим антимикробным агентам возникает по разным механизмам. Разумное объяснение того, что аспирин увеличивает чувствительность H pylori к противомикробным препаратам с различными антибактериальными механизмами, заключается в том, что аспирин не изменяет целевые участки бактерий, но увеличивает внутриклеточные концентрации противомикробных препаратов.

Метронидазол — пролекарство, активируемое нитроредуктазами в клетках бактерий. Устойчивость к метронидазолу вызывается либо отсутствием, либо инактивацией нитроредуктаз [31].Сообщалось, что устойчивость H pylori к метронидазолу была вызвана в основном нулевыми мутациями в гене rdxA , который кодирует нечувствительную к кислороду НАДФН-нитроредуктазу [32]. Однако исследования также сообщили об участии других редуктаз в развитии резистентного фенотипа. Помимо нечувствительных к кислороду НАДФН-нитроредуктаз, было обнаружено, что несколько других нитроредуктаз в H pylori , такие как НАДФН-флавин-оксидоредуктаза, ферредоксин-подобный белок, флаводоксин, α-кетоглутарат-оксидоредуктаза и пируват: флаводоксин-оксидоредуктаза и пируват: флаводоксин-оксидоредуктаза восстанавливают и генерируют метаводоксин-оксидоредуктазу. активные соединения [33,34].В нашем исследовании мутации в гене rdxA могут быть связаны с устойчивостью изолированного штамма (R2). Однако в присутствии аспирина штамм превращался из устойчивого к метронидазолу в чувствительный, а мутации в гене rdxA не изменялись. Используя метод изотопной сцинтилляции с [7- 3 H] -тетрациклином, наше исследование показало, что аспирин увеличивает внутриклеточную концентрацию антимикробных препаратов в клетках H pylori , указывая на то, что аспирин увеличивает проницаемость внешней мембраны H pylori для противомикробных препаратов. .При более высокой внутриклеточной концентрации в присутствии аспирина метронидазол может снижаться и активироваться другими нитроредуктазами в H pylori . Таким образом, MIC H pylori по отношению к метронидазолу снизился, а в некоторых случаях устойчивые штаммы даже превратились в чувствительные.

В механизмах увеличения концентрации противомикробных препаратов в клетках бактерий могут быть задействованы два пути. Один из них — увеличение количества антимикробных препаратов, пассивно проникающих в клетки бактерий; другой — нарушение активной откачки противомикробных препаратов из бактерий.Предыдущие исследования Escherichia coli показали, что салицилат повышает устойчивость к нескольким антибиотикам, включая хинолоны, цефалоспорины, ампициллин, налидиксовую кислоту, тетрациклин и хлорамфеникол [22]. Аспирин может индуцировать ген множественной устойчивости к антибиотикам ( mar ), изменять экспрессию OMP и снижать проницаемость внешней мембраны для противомикробных препаратов или увеличивать отток антимикробных препаратов [35–38]. Существуют три основные системы захвата через внешнюю мембрану [39], а именно: поглощение гидрофильных веществ через заполненные водой каналы поринов, поглощение поликатионов через саморекламу на сайтах связывания двухвалентных катионов на липополисахариде и поглощение гидрофобные вещества через бислой внешней мембраны.Бактерии могли продуцировать множество поринов и регулировать относительное количество различных поринов в ответ на осмолярность окружающей среды. По крайней мере, пять поринов, названных HopA, HopB, HopC, HopD и HopE (часть 32-членного семейства белков внешней мембраны) присутствовали в одной клетке H pylori [40,41]. Считалось, что эти порины связаны с устойчивостью к антибиотикам [40]. С другой стороны, некоторые бактерии экспрессировали мембранную транспортную систему, которая приводила к множественной лекарственной устойчивости за счет оттока лекарств.Три предполагаемых системы оттока RND, HefABC, HefDEF и HefGHI, идентифицированные в H pylori , могут быть коррелированы с устойчивостью к антибиотикам [42]. Из трех систем оттока только HefABC участвует в формировании множественной лекарственной устойчивости in vitro [42]. Таким образом, мы протестировали пять генов порина ( hopA , hopB , hopC , hopD и hopE ) и гены белка оттока ( hefA , hefB , hefC ) с использованием реальных время количественной ПЦР, и обнаружили, что аспирин не мешает экспрессии вышеуказанных белков на уровнях транскрипции гена.

Изменение проницаемости внешней мембраны H pylori должно сопровождаться модификацией некоторых родственных OMP. В настоящем исследовании экспрессия двух OMP H pylori между 55 и 72 кДа изменялась в присутствии аспирина. Однако функции и идентификация этих OMP должны быть определены с помощью двумерного электрофореза и анализа масс-спектра белка. Если эти OMP были связаны с увеличением проницаемости внешней мембраны H pylori , необходимо провести дальнейшие исследования, чтобы определить, происходят ли функциональные и фенотипические изменения этих OMP в присутствии аспирина на уровнях трансляции или модификации белка. , или некоторые другие порины или системы оттока.

Park et al [43] провели пилотное исследование, направленное на сравнение эффективности стандартного режима омепразол-амоксициллин-кларитромицин (OAC) с комбинированным режимом OAC и аспирином (OACA). Последующие эндоскопические исследования показали, что предыдущие язвы полностью зажили у всех пациентов. Хотя уровень эрадикации в группе OACA (86,7%) был выше, чем в группе OAC (80,3%), статистически значимой разницы между двумя группами не было. Общие нежелательные явления были одинаковыми в двух группах.Режим OACA хорошо переносился в группе пациентов с язвенной болезнью. Потенциал аспирина и других НПВП для клинического использования в повышении эффективности эрадикации H pylori может потребовать дальнейших исследований.

В связи с повышенным вниманием, уделяемым повреждению H pylori и устойчивости противомикробных препаратов к этому микроорганизму, необходимо срочно исследовать новые эффективные терапевтические схемы. Изучение молекулярных механизмов аспирина, повышающих чувствительность H pylori к противомикробным препаратам, поможет найти более эффективный режим эрадикации в клинической практике.

КОММЕНТАРИИ

Предпосылки

Сообщалось, что аспирин подавлял рост Helicobacter pylori ( H pylori ), а минимальная ингибирующая концентрация (МПК) кларитромицина, метронидазола и амоксициллина до H pylori снижалась при лечении аспирин. Это указывает на то, что аспирин увеличивает чувствительность H pylori к этим противомикробным препаратам и даже превращает некоторые устойчивые штаммы в чувствительные.

Границы исследований

Инфекция H. pylori приводит к хроническому воспалению слизистой оболочки желудка, язвенной болезни и тесно связана с аденокарциномой и лимфомой лимфоидной ткани, ассоциированной со слизистой оболочкой (MALT). Недавние исследования показали, что инфекция H pylori играет важную роль в инвазии сосудистых заболеваний сердца и головного мозга, аутоиммунных заболеваний, нарушений питания и обмена веществ, гематопатии и дерматологических заболеваний. Таким образом, искоренение инфекции H pylori очень важно для предотвращения и лечения этих заболеваний.Однако с широким использованием противомикробных препаратов в клинической практике устойчивость к антибиотикам стала очевидной и считается одной из основных причин неэффективности лечения.

Инновации и прорывы

In vitro аспирин снизил МИК метронидазола, кларитромицина и амоксициллина до H pylori и даже преобразовал некоторые устойчивые штаммы в чувствительные. В этом исследовании изучались механизмы действия аспирина, повышающего чувствительность H pylori к метронидазолу.

Приложения

Изучение молекулярных механизмов аспирина, повышающих чувствительность H pylori к антимикробным препаратам, поможет более интенсивно понять механизмы устойчивости H pylori к антибиотикам и выявить более эффективный режим эрадикации в клинической практике.

Терминология

Карбонилцианид м-хлорфенилгидразон (CCCP), своего рода ингибитор оттока, который эффективен при микромолярной концентрации, может изменять градиент pH через цитоплазматическую мембрану, таким образом, лишает запас энергии транспортного белка.

Экспертный обзор

Авторы интенсивно сообщают, что нестероидные противовоспалительные препараты (НПВП), включая салицилат натрия, аспирин, индометацин и целекоксиб, ингибируют рост H pylori дозозависимым образом и изменяют восприимчивость. H pylori к антибиотикам. В этом исследовании авторы продемонстрировали, что, хотя аспирин увеличивал чувствительность H pylori к метронидазолу, он не влиял на мутации гена rdxA H pylori и что аспирин увеличивал внутриклеточные концентрации противомикробных препаратов, вероятно, за счет изменения белки внешней мембраны (OMP) экспрессируют H pylori .Эта интересная тема позволит врачам по-новому взглянуть на эрадикацию H pylori .

Аспирин увеличивает чувствительность Helicobacter pylori к метронидазолу за счет увеличения внутриклеточных концентраций противомикробных препаратов.

Резюме.

МЕТОДЫ. В это исследование были включены эталонный штамм H. pylori 26 695 и два метронидазолустойчивых изолята H. pylori .Штаммы инкубировали в бульоне Brucella с аспирином или без него (1 ммоль / л). Ген rdxA H pylori амплифицировали с помощью ПЦР и секвенировали. Проницаемость H pylori для противомикробных препаратов определяли путем анализа внутриклеточной радиоактивности клеток после инкубации с [7- 3 H] -тетрациклином. Белки внешней мембраны (OMP) H pylori 26 695 были очищены и проанализированы с помощью SDS-PAGE. Экспрессию 5 поринов (hopA, hopB, hopC, hopD и hopE) и предполагаемую систему оттока RND (hefABC) H pylori анализировали с помощью количественной ПЦР в реальном времени.

РЕЗУЛЬТАТЫ: Мутации в гене rdxA не изменились в изолятах, устойчивых к метронидазолу, обработанных аспирином. Радиоактивность H pylori увеличивалась при лечении аспирином, что указывает на то, что аспирин улучшает проницаемость внешней мембраны H pylori . Однако экспрессия двух полос OMP между 55 и 72 кДа изменялась в присутствии аспирина. Экспрессия мРНК hopA, hopB, hopC, hopD, hopE и hefA, hefB, hefC H. pylori не изменялась при лечении аспирином.

ЗАКЛЮЧЕНИЕ: Хотя аспирин увеличивает чувствительность H pylori к метронидазолу, он не влияет на мутации гена rdxA H pylori . Аспирин увеличивает внутриклеточные концентрации противомикробных препаратов, вероятно, за счет изменения экспрессии OMP.

Ключевые слова: Helicobacter pylori, аспирин, метронидазол, резистентность, минимальные ингибирующие концентрации

ВВЕДЕНИЕ

Аспирин, называемый нестероидными противовоспалительными препаратами (НПВП), является одним из наиболее широко используемых препаратов во всем мире.Он ингибирует циклооксигеназы (ЦОГ), тем самым необратимо блокируя превращение арахидоновой кислоты в простаноиды. Вдобавок считается, что аспирин обеспечивает некоторую защиту от ишемической болезни сердца [1], частично благодаря ингибированию тромбоксана А2, мощного агрегатора тромбоцитов. Сообщалось, что аспирин демонстрирует химиопрофилактическую активность против рака пищевода, желудка и толстой кишки, вызывая апоптоз в эпителиальных клетках и регулируя ангиогенез [2–4]. Аспирин также оказывает множество эффектов на различные виды бактерий.Предыдущие исследования показали, что аспирин может подавлять рост некоторых бактерий, влиять на выработку факторов вирулентности некоторыми бактериями и изменять восприимчивость бактерий к некоторым антибиотикам, влияя на экспрессию генов и вызывая ряд морфологических и физиологических изменений у бактерий [5 ].

Мы ранее сообщали, что НПВП, включая салицилат натрия, аспирин, индометацин и целекоксиб, подавляли рост H pylori дозозависимым образом при инкубации в бульоне бруцелл in vitro [6–9].Эти препараты также существенно влияли на активность факторов вирулентности H pylori , например уреазы и вакуулирующего цитотоксина [8,9]. Кроме того, минимальные ингибирующие концентрации (МПК) кларитромицина, метронидазола и амоксициллина до H pylori снижались при лечении низкой концентрацией аспирина [6–8], что указывает на то, что аспирин увеличивает чувствительность H pylori к этим антимикробным препаратам. .

Целью настоящего исследования было изучить механизмы действия аспирина, повышающего чувствительность H pylori к метронидазолу.Ген rdxA H pylori , обработанный аспирином и без него, анализировали с помощью ПЦР-амплификации и секвенирования. Влияние аспирина на проницаемость внешней мембраны H pylori определяли с использованием [7- 3 H] -тетрациклина. Также было определено влияние аспирина на экспрессию белков внешней мембраны (OMP) H pylori .

МАТЕРИАЛЫ И МЕТОДЫ

Chemicals

Аспирин (Sigma Chemical Co, Сент-Луис, Миссури, США) и карбонилцианид с протонным проводником м-хлорфенилгидразон (CCCP, Sigma Chemical Co.) заранее растворяли в ДМСО (Sigma Chemical Co.). [7- 3 H] -тетрациклин (0,6 Ки / ммоль; 22,2 ГБк / ммоль; Dupont / NEN Research Products, Бостон, Массачусетс) недавно растворяли в разбавленной соляной кислоте.

Штаммы и условия культивирования

H pylori эталонный штамм 26 695 (чувствительный к метронидазолу) и два клинических изолята H pylori (устойчивый к метронидазолу, R1 и R2) были включены в это исследование. Штаммы культивировали на чашках с колумбийским агаром, содержащим 8% овечьей крови, в микроаэробной атмосфере (10% CO 2 и 5% O 2 ) при 37 ° C в течение 2-3 дней. H pylori из 10 8 КОЕ / мл затем инокулировали в 20 мл бульона Brucella (Difco Laboratories, Детройт, штат Мичиган, США) с добавлением 10% фетальной бычьей сыворотки (FBS; Gibco-BRL, Гранд-Айленд, штат Нью-Йорк, США). ) в наборе 10 см чашек Петри с 1 ммоль / л аспирина или с контролем носителя (ДМСО 0,1%). Чашки помещали в анаэробный сосуд (Oxoid) и инкубировали при 37 ° C на шейкере со скоростью 60 об / мин в микроаэробных условиях в течение 48 часов.

Определение МИК

Бактерии готовили в бульоне для инфузии сердца мозга с получением количества жизнеспособных клеток 3 × 10 8 КОЕ / мл (что эквивалентно 1 стандартной единице мутности МакФарланда) и использовали в качестве инокулята для тестирования чувствительности.Бактериальную суспензию (100 мкл) наносили в двух экземплярах на чашки с колумбийским агаром с аспирином (1 ммоль / л) или без него. На каждую пластину наносили одну тест-полоску метронидазола (OXOID Ltd, Англия). МИК метронидазола и возможное влияние аспирина на МИК метронидазола определяли через 72 часа инкубации при 37 ° C в микроаэробных условиях.

Экстракция геномной ДНК

H pylori геномная ДНК была экстрагирована с использованием метода диоксицида кремния.Клетки собирали и дважды промывали фосфатно-солевым буфером (PBS) (0,01 моль / л, pH 7,2). Осаждение клеток суспендировали в 100 мкл ТЕ. Затем 5 мкл SiO 2 Liq. и 400 мкл связывающего буфера (содержащего 4 моль / л изотиоцианата гуанидиния, 50 ммоль / л трис-HCl, 20 ммоль / л EDTA) добавляли и инкубировали при 55 ° C в течение 5 минут при встряхивании один раз в минуту. Суспензию центрифугировали при 8000 об / мин в течение 30 с при комнатной температуре и осадок трижды промывали очищающим буфером (содержащим 20 ммоль / л Трис-HCl, 1 ммоль / л EDTA, 100 ммоль / л NaCl и дегидратированный спирт).Полученную суспензию сушили при 55 ° C и хранили при -20 ° C.

Амплификация гена rdxA H. pylori и секвенирование

Фрагменты (886 п.н.), содержащие полный ген rdxA , амплифицировали с помощью ПЦР. Прямой праймер: 5′-AGGGATTTTATTGTATGCTACAA-3 ‘; Обратный праймер: 5’-AGGAGCATCAGATAGTTCTGA-3 ‘. ПЦР-амплификацию проводили в 25 мкл реакционного раствора, содержащего 2 мкл геномной ДНК H pylori , 4,5 мкл 10-кратного буфера для ПЦР (с 15 мкмоль / л MgCl 2 ), 2 мкл dNTP (по 2 каждого.5 ммоль / л), 2 мкл прямого и обратного праймеров (каждый 5 мкмоль / л), 0,5 мкл TaqDNA-полимеразы (1 ед. / Мкл) и 9 мкл ddH 2 O. Первоначально реакцию денатурировали при 94 °. C в течение 5 мин, затем 30 циклов, каждый из которых состоит из 30 с при 94 ° C (денатурация), 1 мин при 52 ° C (отжиг) и 1 мин при 72 ° C (удлинение). После окончательного продления в течение 10 минут при 72 ° C ампликоны подвергали электрофорезу в 1,5% агарозном геле и очищали с использованием метода диоксицида кремния, как описано выше. Полученный ген rdxA секвенировали с помощью процедуры терминации дидезокси-цепи в Beijing Li-Jia-Tai-Cheng Technology Company.Гены rdxA H pylori , обработанные аспирином и без него, были проанализированы в режиме онлайн (http://align.genome.jp).

Исследования поглощения с использованием [7-

3 H] тетрациклина

Штамм 26 695 выращивали до средне-логарифмической фазы (приблизительно от 3 × 10 9 до 5 × 10 9 КОЕ / мл) в бульоне Brucella и затем добавляли 1 ммоль / л аспирина или ДМСО (<1%, контроль носителя) в течение 6 часов при 37 ° C на шейкере при 60 об / мин в микроаэробных условиях.Суспензию клеток центрифугировали при 8000 об / мин в течение 10 мин при комнатной температуре, осадок промывали и суспендировали в буфере HEPES (pH 7,2, содержащий 100 мкмоль / л MgCl 2 ). При комнатной температуре к 10 мл клеточной суспензии добавляли 5 мкКи [7- 3 H] -тетрациклин (0,6 Ки / ммоль; 22,2 ГБк / ммоль; Dupont / NEN Research Products, Бостон, США). Через 20 мин каждую клеточную суспензию делили на две половины и к половине добавляли 100 мкмоль / л CCCP. Аликвоты по 1 миллилитру отбирали с 10-минутными интервалами и трижды промывали PBS.Затем полученные гранулы разбавляли сцинтилляционной жидкостью и анализировали на радиоактивность в сцинтилляционном счетчике (TRI-CARB 2100TR).

Очистка OMPs

H. pylori 26 695 инкубировали в бульоне Brucella в течение 48 часов. Суспензию центрифугировали при 8000 об / мин в течение 10 минут, промывали и суспендировали в ледяном буфере Трис-Mg (10 ммоль / л Трис-HCl, содержащий 5 ммоль / л MgCl 2 , pH 7,3) и обрабатывали ультразвуком (один раз. 30 с с интервалом 3-5 с в течение 5 мин) до тех пор, пока большая часть клеток не будет разрушена, как это видно под микроскопом.Неразрушенные клетки удаляли центрифугированием при 8000 об / мин в течение 20 мин при 4 ° C. Внутреннюю и внешнюю мембраны концентрировали центрифугированием при 50 000 об / мин в течение 60 мин при 4 ° C. Осадок суспендировали в 2% Triton Tris-Mg (pH 7,5) и инкубировали в течение 30 минут при комнатной температуре, а затем центрифугировали и снова инкубировали в тех же условиях. Полученные гранулы, OMP, дважды промывали 10 ммоль / л трис-HCl и растворяли в ddH 2 О. Конечную концентрацию OMP определяли методом кумасси бриллиантового синего R250.

Гель-электрофорез в SDS-PAGE

Десять микрограмм OMP использовали для гель-электрофореза в SDS-PAGE при постоянном напряжении (5% -ный гель-стекинг при 60 В, 10% -ный разделяющий гель при 100 В). После 30 мин инкубации в фиксирующей жидкости гель окрашивали кумасси бриллиантовым синим G250 в течение 30 мин.

Выделение тотальной РНК и обратная транскрипция

Общую РНК получали методом TRIzol, как описано производителем (Invitrogen, Burlington, Ontario, Canada), и загрязняющую ДНК удаляли обработкой ДНКазой I в соответствии с инструкциями производителя (Sigma) .Для синтеза кДНК 4 мкг РНК, разбавленной DEPC H 2 O, нагревали до 70 ° C в течение 5 минут и быстро охлаждали на льду в течение 15 минут. Затем образцы добавляли к 20 мкл реакционной смеси, содержащей 2 мкл случайных гексамерных праймеров (1 мкг / мкл), 0,4 мкл RNasin, 1 мкл M-MLV, 4 мкл dNTP (каждый 2,5 ммоль / л) и 4 мкл 5 × RT буфера. Реакцию синтеза кДНК проводили в течение 60 мин при 37 ° C. Затем фермент инактивировали при 95 ° C в течение 5 мин. Аликвоты кДНК хранили при -70 ° C.

Количественная ПЦР в реальном времени

Уровни мРНК hopA, hopB, hopC, hopD, hopE и hefA, hefB, hefC определяли с помощью ПЦР в реальном времени с использованием системы обнаружения последовательностей ABI Prism 7700 (Perkin-Elmer Applied Biosystems, Фостер-Сити, Калифорния.). Специфические праймеры и зонды TaqMan были сконструированы с помощью программы Primer Express 3.0 (Perkin-Elmer Applied Biosystems) (таблица). Стандартная кривая была построена с использованием 10-кратных серийных разведений каждой кДНК. Реакционные смеси для ПЦР (50 мкл) готовили путем смешивания 5 мкл раствора синтезированной кДНК с 5 мкл 10-кратного буфера для ПЦР (содержащего 15 мкмоль / л MgCl 2 ), 3 мкл прямого и обратного праймеров (каждый по 5 мкмоль / л). , 4 мкл dNTP (каждый 2,5 ммоль / л), 2 мкл зонда TagMan, 1 мкл ROX, 0,5 мкл полимеразы TaqDNA (1 ед. / Мкл).ПЦР проводили при 95 ° C в течение 10 минут, затем 40 циклов при 95 ° C в течение 15 секунд и 60 ° C в течение 60 секунд в соответствии с инструкциями производителей. Уровни мРНК белка выражали как отношение мРНК белка к мРНК 16S рРНК [соотношение мРНК белка (ед. / Мл) / мРНК 16S рРНК (ед. / Мл) × 100 000]. ПЦР проводили пятикратно с использованием образцов, приготовленных одновременно.

Таблица 1

Праймеры и зонды, используемые в количественной ПЦР в реальном времени

TAACGCTAGCCAACAACGCTAACATCAGCA CGCTCTTTATAACGCGCAAGTAA GCTGTTCCCGGCTCTGAATC 905 AGACAAACAGGCTCAAAGCGATTCC
Тип зонда или праймера Последовательность (5′-3 ‘)
hopA F ATCATGCTAGTGATGGCGTTAAAG
HOPA R CAGGCATAGACGGAGGCAAT
HOPA зонд CCAAAAATATTGCATGCGTTCCCGC
hopB F CTTGGTGCAAAACATCGTCAAT
hopB R CCCGCCATAGCTCACTTGAT
hopB зонд
hopC F
hopC R
hopC зонд TGGATAAAATCAACGCGCTCAACAATCAG 900 52
hopD F CTGCTTGAGCGCGGTTTAA
hopD R CAACCTAGACACTGGGAAAGCAT
hopD Зонд CTTGCGCTCTAGCGTTAGCGAACATGC
надежду на F GGATTGCACAGGGAGTGTTGT
надежду на то, R GCCCCATTAGCGTATTTAGCAT
надежду на зонд TTGCCCCCCAGGTCTTACCGCT
Hefa F AGGGCGTTTTGGGAATTTCT
Hefa R GCATGATGGATTGTTTTTGCA
Hefa зонд CCCCGGTCAGCAAAATACGGCTG
hefB F AGGGCGATGTTTTGTTGCTT
hefB ICCCAATTTTGCTGTATCGT
hefB A Зонд
hefC F GTTTGCGTTCTTGCGTAACG
hefC R TGTTTAATGAAAAGCCCATCCA
hefC Зонд CACGATCACCCTCGTTTCAGCGATC
16S рРНК F CCGCCTACGCGCTCTTTAC
16S рРНК R CTAACGAATAAGCACCGGCTAAC
16S рРНК Зонд CCCAGTGATTCCGAGTAACGCTTGCA

Статистический анализ SAS

Статистический анализ был проведен с использованием статистического анализа SSSS.0. Репрезентативные данные внутриклеточной радиоактивности и количественной ПЦР были представлены как среднее ± стандартное отклонение. Для сравнения данных использовался тест Стьюдента t . P <0,05 считали статистически значимым.

РЕЗУЛЬТАТЫ

Влияние аспирина на МИК метронидазола

Для штамма R1 МИК метронидазола снизилась с 256 мкг / мл до 0,25 мкг / мл в присутствии аспирина (1 ммоль / л), а для штамма R2 — МИК метронидазола уменьшилось с 64 мкг / мл до значения ниже читаемого (0.016 мкг / мл), что указывает на то, что аспирин увеличивает чувствительность H pylori к метронидазолу и превращает эти два устойчивых штамма в чувствительные штаммы.

Влияние аспирина на мутации гена rdxA

Фрагменты ДНК длиной 886 п.н., содержащие полный ген rdxA , амплифицировали с помощью ПЦР для эталонного штамма H pylori 26 695 и двух штаммов, устойчивых к метронидазло (R1, R2), обработанных или без аспирина. Анализ последовательности выявил точечные мутации, вставки и делеции в гене rdxA штамма R2 по сравнению с эталонным штаммом 26 695, а нуклеотидная гомология между двумя штаммами (26 695 и R2) составила 94.4%. Однако нуклеотидная гомология гена rdxA между штаммом R2 и его соответствующим изолятом R2 (A) (штамм R2, обработанный аспирином) составляла более 99,5% (рисунок и рисунок).

Сравнение последовательностей на линии (http://align.genome.jp) гена rdxA между устойчивым к метронидазолу штаммом (R2) и эталонным штаммом H pylori 26 695 (S).

Сравнение последовательностей на линии (http://align.genome.jp) гена rdxA между устойчивым к метронидазолу штаммом (R2) и его соответствующим чувствительным штаммом в присутствии аспирина [R2 (A)].

Влияние аспирина на проницаемость внешней мембраны H. pylori

Независимо от присутствия CCCP, радиоактивность H pylori , обработанного аспирином, была выше по сравнению с контрольным носителем (DMSO), что указывает на усиление аспирина. проницаемость наружной мембраны H pylori для антимикробного препарата (рисунок). Независимо от присутствия аспирина, радиоактивность клеток H pylori снижалась при добавлении ингибитора эффлюксной помпы CCCP, что указывает на то, что аспирин не влияет на коллапсирующий эффект CCCP на градиент протонов через цитоплазматическую мембрану H pylori . (Фигура ).

Радиоактивность клеток H pylori , обработанных аспирином (1 ммоль / л) или контрольным носителем (ДМСО). A: CCCP; B: Нет CCCP.

Радиоактивность клеток H pylori , обработанных CCCP (100 мкмоль / л) или без CCCP. A: Аспирин; B: Управление транспортным средством.

Влияние аспирина на профили OMP

Профили OMP H pylori , обработанного аспирином, были аналогичны таковым в контроле. Однако экспрессия двух OMP (Band 1 и 2) между 55 и 72 кДа изменялась в присутствии аспирина (рисунок).

Профили OMP H pylori 26 695. M: Маркер размера; C: Контроль; D: ДМСО; A: Аспирин. Группа 1: OMP увеличивается в присутствии аспирина; Группа 2: OMP снизился в присутствии аспирина.

Влияние аспирина на экспрессию мРНК поринов и системы оттока

Количественная ПЦР в реальном времени показала отсутствие значительных различий в уровнях кДНК hopA, hopB, hopC, hopD, hopE и hefA, hefB, hefC для штаммов, получавших аспирин, по сравнению с контролем.Это указывало на то, что независимо от присутствия аспирина экспрессия уровней мРНК hopA, hopB, hopC, hopD, hopE и hefA, hefB, hefC не изменялась (таблица).

Таблица 2

кДНК Уровни поринов и система оттока H. pylori , протестированные с помощью количественной ПЦР в реальном времени

905 285,8 ± 5,07
Уровни кДНК
Ген Группа аспирина ДМСО-контроль Пустой контроль
hopA 963.60 ± 23,33 1087,75 ± 26,42 856,27 ± 25,43
hopB 84,00 ± 15,97 91,45 ± 14,83 100,15 ± 16,28
9008 ± 16,28
9008 ± 16,28 ± 12,01 52,79 ± 10,27
hopD 83,86 ± 14,09 92,46 ± 17,78 89,92 ± 13,72
hopE 54.07 ± 10,58 52,77 ± 11,93 52,12 ± 9,92
hefA 12,31 ± 2,12 12,51 ± 1,99 12,97 ± 2,76
hefB ,47 25,60 ± 4,99
hefC 55,62 ± 8,89 52,08 ± 9,78 53,37 ± 10,04

ОБСУЖДЕНИЕ

H pylori — отрицательная спиралевидная бактерия. и важный патоген для человека, который колонизирует в желудке 50% населения мира [10,11].Инфекция приводит к хроническому воспалению слизистой оболочки желудка и язвенной болезни, и было доказано, что инфекция H pylori тесно связана с аденокарциномой и лимфомой лимфоидной ткани, связанной со слизистой оболочкой (MALT). Международное агентство по изучению рака при Всемирной организации здравоохранения (ВОЗ) определило H pylori как один из канцерогенов первого класса для человека [12]. Недавние исследования показали, что инфекция H pylori играет важную роль в инвазии сосудистых заболеваний сердца и головного мозга, аутоиммунных заболеваний, нарушений питания и обмена веществ, гематопатии и дерматологических заболеваний.Искоренение инфекции H pylori очень важно для предотвращения и лечения этих заболеваний. Наиболее успешные схемы лечения используют комбинации двух или более антибиотиков, таких как амоксициллин, кларитромицин, метронидазол или тетрациклин, вместе с ингибитором протонной помпы или висмутом. Однако с широким использованием противомикробных препаратов в клинической практике устойчивость к антибиотикам становится все более очевидной и считается одной из основных причин неэффективности лечения [13].

Ранние исследования показали, что салицилат подавлял рост некоторых бактерий, таких как Escherichia coli , Klebsiella pneumoniae , Pseudomonas aeruginosa и Staphylococcus epidermidis , а также влиял на активность фимбрий, жгутиков и производство биофильм. , слизь, и, таким образом, может изменить патогенность бактерий [14–21].Сообщалось, что in vitro , салицилат может изменять чувствительность бактерий к некоторым противомикробным препаратам. Салицилат индуцировал внутренний фенотип множественной антимикробной устойчивости у многих бактерий, таких как Escherichia coli , Salmonella typhimurium и Staphylococcus aureus , и повышал чувствительность некоторых бактерий к аминогликозидам [22–29]. Наши предыдущие исследования также показали, что in vitro аспирин не только подавлял рост H pylori [6–9], но также снижал МИК метронидазола, кларитромицина и амоксициллина до H pylori и даже преобразовывал некоторые устойчивые штаммы. к восприимчивым [6–8].Таким образом, в настоящем исследовании изучались механизмы увеличения восприимчивости H pylori к метронидазолу аспирином.

По крайней мере, четыре отличительных механизма устойчивости к антибиотикам описаны у бактерий: ферментативная инактивация, снижение проницаемости бактериальных мембран, активный отток антимикробных агентов и изменение участков-мишеней противомикробных препаратов для бактерий [30]. Метронидазол, кларитромицин и амоксициллин — это разные виды противомикробных препаратов, и каждый по-разному действует на разные участки-мишени в H pylori .Точно так же устойчивость H pylori к этим антимикробным агентам возникает по разным механизмам. Разумное объяснение того, что аспирин увеличивает чувствительность H pylori к противомикробным препаратам с различными антибактериальными механизмами, заключается в том, что аспирин не изменяет целевые участки бактерий, но увеличивает внутриклеточные концентрации противомикробных препаратов.

Метронидазол — пролекарство, активируемое нитроредуктазами в клетках бактерий. Устойчивость к метронидазолу вызывается либо отсутствием, либо инактивацией нитроредуктаз [31].Сообщалось, что устойчивость H pylori к метронидазолу была вызвана в основном нулевыми мутациями в гене rdxA , который кодирует нечувствительную к кислороду НАДФН-нитроредуктазу [32]. Однако исследования также сообщили об участии других редуктаз в развитии резистентного фенотипа. Помимо нечувствительных к кислороду НАДФН-нитроредуктаз, было обнаружено, что несколько других нитроредуктаз в H pylori , такие как НАДФН-флавин-оксидоредуктаза, ферредоксин-подобный белок, флаводоксин, α-кетоглутарат-оксидоредуктаза и пируват: флаводоксин-оксидоредуктаза и пируват: флаводоксин-оксидоредуктаза восстанавливают и генерируют метаводоксин-оксидоредуктазу. активные соединения [33,34].В нашем исследовании мутации в гене rdxA могут быть связаны с устойчивостью изолированного штамма (R2). Однако в присутствии аспирина штамм превращался из устойчивого к метронидазолу в чувствительный, а мутации в гене rdxA не изменялись. Используя метод изотопной сцинтилляции с [7- 3 H] -тетрациклином, наше исследование показало, что аспирин увеличивает внутриклеточную концентрацию антимикробных препаратов в клетках H pylori , указывая на то, что аспирин увеличивает проницаемость внешней мембраны H pylori для противомикробных препаратов. .При более высокой внутриклеточной концентрации в присутствии аспирина метронидазол может снижаться и активироваться другими нитроредуктазами в H pylori . Таким образом, MIC H pylori по отношению к метронидазолу снизился, а в некоторых случаях устойчивые штаммы даже превратились в чувствительные.

В механизмах увеличения концентрации противомикробных препаратов в клетках бактерий могут быть задействованы два пути. Один из них — увеличение количества антимикробных препаратов, пассивно проникающих в клетки бактерий; другой — нарушение активной откачки противомикробных препаратов из бактерий.Предыдущие исследования Escherichia coli показали, что салицилат повышает устойчивость к нескольким антибиотикам, включая хинолоны, цефалоспорины, ампициллин, налидиксовую кислоту, тетрациклин и хлорамфеникол [22]. Аспирин может индуцировать ген множественной устойчивости к антибиотикам ( mar ), изменять экспрессию OMP и снижать проницаемость внешней мембраны для противомикробных препаратов или увеличивать отток антимикробных препаратов [35–38]. Существуют три основные системы захвата через внешнюю мембрану [39], а именно: поглощение гидрофильных веществ через заполненные водой каналы поринов, поглощение поликатионов через саморекламу на сайтах связывания двухвалентных катионов на липополисахариде и поглощение гидрофобные вещества через бислой внешней мембраны.Бактерии могли продуцировать множество поринов и регулировать относительное количество различных поринов в ответ на осмолярность окружающей среды. По крайней мере, пять поринов, названных HopA, HopB, HopC, HopD и HopE (часть 32-членного семейства белков внешней мембраны) присутствовали в одной клетке H pylori [40,41]. Считалось, что эти порины связаны с устойчивостью к антибиотикам [40]. С другой стороны, некоторые бактерии экспрессировали мембранную транспортную систему, которая приводила к множественной лекарственной устойчивости за счет оттока лекарств.Три предполагаемых системы оттока RND, HefABC, HefDEF и HefGHI, идентифицированные в H pylori , могут быть коррелированы с устойчивостью к антибиотикам [42]. Из трех систем оттока только HefABC участвует в формировании множественной лекарственной устойчивости in vitro [42]. Таким образом, мы протестировали пять генов порина ( hopA , hopB , hopC , hopD и hopE ) и гены белка оттока ( hefA , hefB , hefC ) с использованием реальных время количественной ПЦР, и обнаружили, что аспирин не мешает экспрессии вышеуказанных белков на уровнях транскрипции гена.

Изменение проницаемости внешней мембраны H pylori должно сопровождаться модификацией некоторых родственных OMP. В настоящем исследовании экспрессия двух OMP H pylori между 55 и 72 кДа изменялась в присутствии аспирина. Однако функции и идентификация этих OMP должны быть определены с помощью двумерного электрофореза и анализа масс-спектра белка. Если эти OMP были связаны с увеличением проницаемости внешней мембраны H pylori , необходимо провести дальнейшие исследования, чтобы определить, происходят ли функциональные и фенотипические изменения этих OMP в присутствии аспирина на уровнях трансляции или модификации белка. , или некоторые другие порины или системы оттока.

Park et al [43] провели пилотное исследование, направленное на сравнение эффективности стандартного режима омепразол-амоксициллин-кларитромицин (OAC) с комбинированным режимом OAC и аспирином (OACA). Последующие эндоскопические исследования показали, что предыдущие язвы полностью зажили у всех пациентов. Хотя уровень эрадикации в группе OACA (86,7%) был выше, чем в группе OAC (80,3%), статистически значимой разницы между двумя группами не было. Общие нежелательные явления были одинаковыми в двух группах.Режим OACA хорошо переносился в группе пациентов с язвенной болезнью. Потенциал аспирина и других НПВП для клинического использования в повышении эффективности эрадикации H pylori может потребовать дальнейших исследований.

В связи с повышенным вниманием, уделяемым повреждению H pylori и устойчивости противомикробных препаратов к этому микроорганизму, необходимо срочно исследовать новые эффективные терапевтические схемы. Изучение молекулярных механизмов аспирина, повышающих чувствительность H pylori к противомикробным препаратам, поможет найти более эффективный режим эрадикации в клинической практике.

КОММЕНТАРИИ

Предпосылки

Сообщалось, что аспирин подавлял рост Helicobacter pylori ( H pylori ), а минимальная ингибирующая концентрация (МПК) кларитромицина, метронидазола и амоксициллина до H pylori снижалась при лечении аспирин. Это указывает на то, что аспирин увеличивает чувствительность H pylori к этим противомикробным препаратам и даже превращает некоторые устойчивые штаммы в чувствительные.

Границы исследований

Инфекция H. pylori приводит к хроническому воспалению слизистой оболочки желудка, язвенной болезни и тесно связана с аденокарциномой и лимфомой лимфоидной ткани, ассоциированной со слизистой оболочкой (MALT). Недавние исследования показали, что инфекция H pylori играет важную роль в инвазии сосудистых заболеваний сердца и головного мозга, аутоиммунных заболеваний, нарушений питания и обмена веществ, гематопатии и дерматологических заболеваний. Таким образом, искоренение инфекции H pylori очень важно для предотвращения и лечения этих заболеваний.Однако с широким использованием противомикробных препаратов в клинической практике устойчивость к антибиотикам стала очевидной и считается одной из основных причин неэффективности лечения.

Инновации и прорывы

In vitro аспирин снизил МИК метронидазола, кларитромицина и амоксициллина до H pylori и даже преобразовал некоторые устойчивые штаммы в чувствительные. В этом исследовании изучались механизмы действия аспирина, повышающего чувствительность H pylori к метронидазолу.

Приложения

Изучение молекулярных механизмов аспирина, повышающих чувствительность H pylori к антимикробным препаратам, поможет более интенсивно понять механизмы устойчивости H pylori к антибиотикам и выявить более эффективный режим эрадикации в клинической практике.

Терминология

Карбонилцианид м-хлорфенилгидразон (CCCP), своего рода ингибитор оттока, который эффективен при микромолярной концентрации, может изменять градиент pH через цитоплазматическую мембрану, таким образом, лишает запас энергии транспортного белка.

Экспертный обзор

Авторы интенсивно сообщают, что нестероидные противовоспалительные препараты (НПВП), включая салицилат натрия, аспирин, индометацин и целекоксиб, ингибируют рост H pylori дозозависимым образом и изменяют восприимчивость. H pylori к антибиотикам. В этом исследовании авторы продемонстрировали, что, хотя аспирин увеличивал чувствительность H pylori к метронидазолу, он не влиял на мутации гена rdxA H pylori и что аспирин увеличивал внутриклеточные концентрации противомикробных препаратов, вероятно, за счет изменения белки внешней мембраны (OMP) экспрессируют H pylori .Эта интересная тема позволит врачам по-новому взглянуть на эрадикацию H pylori .

Аспирин увеличивает чувствительность Helicobacter pylori к метронидазолу за счет увеличения внутриклеточных концентраций противомикробных препаратов.

Резюме.

МЕТОДЫ. В это исследование были включены эталонный штамм H. pylori 26 695 и два метронидазолустойчивых изолята H. pylori .Штаммы инкубировали в бульоне Brucella с аспирином или без него (1 ммоль / л). Ген rdxA H pylori амплифицировали с помощью ПЦР и секвенировали. Проницаемость H pylori для противомикробных препаратов определяли путем анализа внутриклеточной радиоактивности клеток после инкубации с [7- 3 H] -тетрациклином. Белки внешней мембраны (OMP) H pylori 26 695 были очищены и проанализированы с помощью SDS-PAGE. Экспрессию 5 поринов (hopA, hopB, hopC, hopD и hopE) и предполагаемую систему оттока RND (hefABC) H pylori анализировали с помощью количественной ПЦР в реальном времени.

РЕЗУЛЬТАТЫ: Мутации в гене rdxA не изменились в изолятах, устойчивых к метронидазолу, обработанных аспирином. Радиоактивность H pylori увеличивалась при лечении аспирином, что указывает на то, что аспирин улучшает проницаемость внешней мембраны H pylori . Однако экспрессия двух полос OMP между 55 и 72 кДа изменялась в присутствии аспирина. Экспрессия мРНК hopA, hopB, hopC, hopD, hopE и hefA, hefB, hefC H. pylori не изменялась при лечении аспирином.

ЗАКЛЮЧЕНИЕ: Хотя аспирин увеличивает чувствительность H pylori к метронидазолу, он не влияет на мутации гена rdxA H pylori . Аспирин увеличивает внутриклеточные концентрации противомикробных препаратов, вероятно, за счет изменения экспрессии OMP.

Ключевые слова: Helicobacter pylori, аспирин, метронидазол, резистентность, минимальные ингибирующие концентрации

ВВЕДЕНИЕ

Аспирин, называемый нестероидными противовоспалительными препаратами (НПВП), является одним из наиболее широко используемых препаратов во всем мире.Он ингибирует циклооксигеназы (ЦОГ), тем самым необратимо блокируя превращение арахидоновой кислоты в простаноиды. Вдобавок считается, что аспирин обеспечивает некоторую защиту от ишемической болезни сердца [1], частично благодаря ингибированию тромбоксана А2, мощного агрегатора тромбоцитов. Сообщалось, что аспирин демонстрирует химиопрофилактическую активность против рака пищевода, желудка и толстой кишки, вызывая апоптоз в эпителиальных клетках и регулируя ангиогенез [2–4]. Аспирин также оказывает множество эффектов на различные виды бактерий.Предыдущие исследования показали, что аспирин может подавлять рост некоторых бактерий, влиять на выработку факторов вирулентности некоторыми бактериями и изменять восприимчивость бактерий к некоторым антибиотикам, влияя на экспрессию генов и вызывая ряд морфологических и физиологических изменений у бактерий [5 ].

Мы ранее сообщали, что НПВП, включая салицилат натрия, аспирин, индометацин и целекоксиб, подавляли рост H pylori дозозависимым образом при инкубации в бульоне бруцелл in vitro [6–9].Эти препараты также существенно влияли на активность факторов вирулентности H pylori , например уреазы и вакуулирующего цитотоксина [8,9]. Кроме того, минимальные ингибирующие концентрации (МПК) кларитромицина, метронидазола и амоксициллина до H pylori снижались при лечении низкой концентрацией аспирина [6–8], что указывает на то, что аспирин увеличивает чувствительность H pylori к этим антимикробным препаратам. .

Целью настоящего исследования было изучить механизмы действия аспирина, повышающего чувствительность H pylori к метронидазолу.Ген rdxA H pylori , обработанный аспирином и без него, анализировали с помощью ПЦР-амплификации и секвенирования. Влияние аспирина на проницаемость внешней мембраны H pylori определяли с использованием [7- 3 H] -тетрациклина. Также было определено влияние аспирина на экспрессию белков внешней мембраны (OMP) H pylori .

МАТЕРИАЛЫ И МЕТОДЫ

Chemicals

Аспирин (Sigma Chemical Co, Сент-Луис, Миссури, США) и карбонилцианид с протонным проводником м-хлорфенилгидразон (CCCP, Sigma Chemical Co.) заранее растворяли в ДМСО (Sigma Chemical Co.). [7- 3 H] -тетрациклин (0,6 Ки / ммоль; 22,2 ГБк / ммоль; Dupont / NEN Research Products, Бостон, Массачусетс) недавно растворяли в разбавленной соляной кислоте.

Штаммы и условия культивирования

H pylori эталонный штамм 26 695 (чувствительный к метронидазолу) и два клинических изолята H pylori (устойчивый к метронидазолу, R1 и R2) были включены в это исследование. Штаммы культивировали на чашках с колумбийским агаром, содержащим 8% овечьей крови, в микроаэробной атмосфере (10% CO 2 и 5% O 2 ) при 37 ° C в течение 2-3 дней. H pylori из 10 8 КОЕ / мл затем инокулировали в 20 мл бульона Brucella (Difco Laboratories, Детройт, штат Мичиган, США) с добавлением 10% фетальной бычьей сыворотки (FBS; Gibco-BRL, Гранд-Айленд, штат Нью-Йорк, США). ) в наборе 10 см чашек Петри с 1 ммоль / л аспирина или с контролем носителя (ДМСО 0,1%). Чашки помещали в анаэробный сосуд (Oxoid) и инкубировали при 37 ° C на шейкере со скоростью 60 об / мин в микроаэробных условиях в течение 48 часов.

Определение МИК

Бактерии готовили в бульоне для инфузии сердца мозга с получением количества жизнеспособных клеток 3 × 10 8 КОЕ / мл (что эквивалентно 1 стандартной единице мутности МакФарланда) и использовали в качестве инокулята для тестирования чувствительности.Бактериальную суспензию (100 мкл) наносили в двух экземплярах на чашки с колумбийским агаром с аспирином (1 ммоль / л) или без него. На каждую пластину наносили одну тест-полоску метронидазола (OXOID Ltd, Англия). МИК метронидазола и возможное влияние аспирина на МИК метронидазола определяли через 72 часа инкубации при 37 ° C в микроаэробных условиях.

Экстракция геномной ДНК

H pylori геномная ДНК была экстрагирована с использованием метода диоксицида кремния.Клетки собирали и дважды промывали фосфатно-солевым буфером (PBS) (0,01 моль / л, pH 7,2). Осаждение клеток суспендировали в 100 мкл ТЕ. Затем 5 мкл SiO 2 Liq. и 400 мкл связывающего буфера (содержащего 4 моль / л изотиоцианата гуанидиния, 50 ммоль / л трис-HCl, 20 ммоль / л EDTA) добавляли и инкубировали при 55 ° C в течение 5 минут при встряхивании один раз в минуту. Суспензию центрифугировали при 8000 об / мин в течение 30 с при комнатной температуре и осадок трижды промывали очищающим буфером (содержащим 20 ммоль / л Трис-HCl, 1 ммоль / л EDTA, 100 ммоль / л NaCl и дегидратированный спирт).Полученную суспензию сушили при 55 ° C и хранили при -20 ° C.

Амплификация гена rdxA H. pylori и секвенирование

Фрагменты (886 п.н.), содержащие полный ген rdxA , амплифицировали с помощью ПЦР. Прямой праймер: 5′-AGGGATTTTATTGTATGCTACAA-3 ‘; Обратный праймер: 5’-AGGAGCATCAGATAGTTCTGA-3 ‘. ПЦР-амплификацию проводили в 25 мкл реакционного раствора, содержащего 2 мкл геномной ДНК H pylori , 4,5 мкл 10-кратного буфера для ПЦР (с 15 мкмоль / л MgCl 2 ), 2 мкл dNTP (по 2 каждого.5 ммоль / л), 2 мкл прямого и обратного праймеров (каждый 5 мкмоль / л), 0,5 мкл TaqDNA-полимеразы (1 ед. / Мкл) и 9 мкл ddH 2 O. Первоначально реакцию денатурировали при 94 °. C в течение 5 мин, затем 30 циклов, каждый из которых состоит из 30 с при 94 ° C (денатурация), 1 мин при 52 ° C (отжиг) и 1 мин при 72 ° C (удлинение). После окончательного продления в течение 10 минут при 72 ° C ампликоны подвергали электрофорезу в 1,5% агарозном геле и очищали с использованием метода диоксицида кремния, как описано выше. Полученный ген rdxA секвенировали с помощью процедуры терминации дидезокси-цепи в Beijing Li-Jia-Tai-Cheng Technology Company.Гены rdxA H pylori , обработанные аспирином и без него, были проанализированы в режиме онлайн (http://align.genome.jp).

Исследования поглощения с использованием [7-

3 H] тетрациклина

Штамм 26 695 выращивали до средне-логарифмической фазы (приблизительно от 3 × 10 9 до 5 × 10 9 КОЕ / мл) в бульоне Brucella и затем добавляли 1 ммоль / л аспирина или ДМСО (<1%, контроль носителя) в течение 6 часов при 37 ° C на шейкере при 60 об / мин в микроаэробных условиях.Суспензию клеток центрифугировали при 8000 об / мин в течение 10 мин при комнатной температуре, осадок промывали и суспендировали в буфере HEPES (pH 7,2, содержащий 100 мкмоль / л MgCl 2 ). При комнатной температуре к 10 мл клеточной суспензии добавляли 5 мкКи [7- 3 H] -тетрациклин (0,6 Ки / ммоль; 22,2 ГБк / ммоль; Dupont / NEN Research Products, Бостон, США). Через 20 мин каждую клеточную суспензию делили на две половины и к половине добавляли 100 мкмоль / л CCCP. Аликвоты по 1 миллилитру отбирали с 10-минутными интервалами и трижды промывали PBS.Затем полученные гранулы разбавляли сцинтилляционной жидкостью и анализировали на радиоактивность в сцинтилляционном счетчике (TRI-CARB 2100TR).

Очистка OMPs

H. pylori 26 695 инкубировали в бульоне Brucella в течение 48 часов. Суспензию центрифугировали при 8000 об / мин в течение 10 минут, промывали и суспендировали в ледяном буфере Трис-Mg (10 ммоль / л Трис-HCl, содержащий 5 ммоль / л MgCl 2 , pH 7,3) и обрабатывали ультразвуком (один раз. 30 с с интервалом 3-5 с в течение 5 мин) до тех пор, пока большая часть клеток не будет разрушена, как это видно под микроскопом.Неразрушенные клетки удаляли центрифугированием при 8000 об / мин в течение 20 мин при 4 ° C. Внутреннюю и внешнюю мембраны концентрировали центрифугированием при 50 000 об / мин в течение 60 мин при 4 ° C. Осадок суспендировали в 2% Triton Tris-Mg (pH 7,5) и инкубировали в течение 30 минут при комнатной температуре, а затем центрифугировали и снова инкубировали в тех же условиях. Полученные гранулы, OMP, дважды промывали 10 ммоль / л трис-HCl и растворяли в ddH 2 О. Конечную концентрацию OMP определяли методом кумасси бриллиантового синего R250.

Гель-электрофорез в SDS-PAGE

Десять микрограмм OMP использовали для гель-электрофореза в SDS-PAGE при постоянном напряжении (5% -ный гель-стекинг при 60 В, 10% -ный разделяющий гель при 100 В). После 30 мин инкубации в фиксирующей жидкости гель окрашивали кумасси бриллиантовым синим G250 в течение 30 мин.

Выделение тотальной РНК и обратная транскрипция

Общую РНК получали методом TRIzol, как описано производителем (Invitrogen, Burlington, Ontario, Canada), и загрязняющую ДНК удаляли обработкой ДНКазой I в соответствии с инструкциями производителя (Sigma) .Для синтеза кДНК 4 мкг РНК, разбавленной DEPC H 2 O, нагревали до 70 ° C в течение 5 минут и быстро охлаждали на льду в течение 15 минут. Затем образцы добавляли к 20 мкл реакционной смеси, содержащей 2 мкл случайных гексамерных праймеров (1 мкг / мкл), 0,4 мкл RNasin, 1 мкл M-MLV, 4 мкл dNTP (каждый 2,5 ммоль / л) и 4 мкл 5 × RT буфера. Реакцию синтеза кДНК проводили в течение 60 мин при 37 ° C. Затем фермент инактивировали при 95 ° C в течение 5 мин. Аликвоты кДНК хранили при -70 ° C.

Количественная ПЦР в реальном времени

Уровни мРНК hopA, hopB, hopC, hopD, hopE и hefA, hefB, hefC определяли с помощью ПЦР в реальном времени с использованием системы обнаружения последовательностей ABI Prism 7700 (Perkin-Elmer Applied Biosystems, Фостер-Сити, Калифорния.). Специфические праймеры и зонды TaqMan были сконструированы с помощью программы Primer Express 3.0 (Perkin-Elmer Applied Biosystems) (таблица). Стандартная кривая была построена с использованием 10-кратных серийных разведений каждой кДНК. Реакционные смеси для ПЦР (50 мкл) готовили путем смешивания 5 мкл раствора синтезированной кДНК с 5 мкл 10-кратного буфера для ПЦР (содержащего 15 мкмоль / л MgCl 2 ), 3 мкл прямого и обратного праймеров (каждый по 5 мкмоль / л). , 4 мкл dNTP (каждый 2,5 ммоль / л), 2 мкл зонда TagMan, 1 мкл ROX, 0,5 мкл полимеразы TaqDNA (1 ед. / Мкл).ПЦР проводили при 95 ° C в течение 10 минут, затем 40 циклов при 95 ° C в течение 15 секунд и 60 ° C в течение 60 секунд в соответствии с инструкциями производителей. Уровни мРНК белка выражали как отношение мРНК белка к мРНК 16S рРНК [соотношение мРНК белка (ед. / Мл) / мРНК 16S рРНК (ед. / Мл) × 100 000]. ПЦР проводили пятикратно с использованием образцов, приготовленных одновременно.

Таблица 1

Праймеры и зонды, используемые в количественной ПЦР в реальном времени

TAACGCTAGCCAACAACGCTAACATCAGCA CGCTCTTTATAACGCGCAAGTAA GCTGTTCCCGGCTCTGAATC 905 AGACAAACAGGCTCAAAGCGATTCC
Тип зонда или праймера Последовательность (5′-3 ‘)
hopA F ATCATGCTAGTGATGGCGTTAAAG
HOPA R CAGGCATAGACGGAGGCAAT
HOPA зонд CCAAAAATATTGCATGCGTTCCCGC
hopB F CTTGGTGCAAAACATCGTCAAT
hopB R CCCGCCATAGCTCACTTGAT
hopB зонд
hopC F
hopC R
hopC зонд TGGATAAAATCAACGCGCTCAACAATCAG 900 52
hopD F CTGCTTGAGCGCGGTTTAA
hopD R CAACCTAGACACTGGGAAAGCAT
hopD Зонд CTTGCGCTCTAGCGTTAGCGAACATGC
надежду на F GGATTGCACAGGGAGTGTTGT
надежду на то, R GCCCCATTAGCGTATTTAGCAT
надежду на зонд TTGCCCCCCAGGTCTTACCGCT
Hefa F AGGGCGTTTTGGGAATTTCT
Hefa R GCATGATGGATTGTTTTTGCA
Hefa зонд CCCCGGTCAGCAAAATACGGCTG
hefB F AGGGCGATGTTTTGTTGCTT
hefB ICCCAATTTTGCTGTATCGT
hefB A Зонд
hefC F GTTTGCGTTCTTGCGTAACG
hefC R TGTTTAATGAAAAGCCCATCCA
hefC Зонд CACGATCACCCTCGTTTCAGCGATC
16S рРНК F CCGCCTACGCGCTCTTTAC
16S рРНК R CTAACGAATAAGCACCGGCTAAC
16S рРНК Зонд CCCAGTGATTCCGAGTAACGCTTGCA

Статистический анализ SAS

Статистический анализ был проведен с использованием статистического анализа SSSS.0. Репрезентативные данные внутриклеточной радиоактивности и количественной ПЦР были представлены как среднее ± стандартное отклонение. Для сравнения данных использовался тест Стьюдента t . P <0,05 считали статистически значимым.

РЕЗУЛЬТАТЫ

Влияние аспирина на МИК метронидазола

Для штамма R1 МИК метронидазола снизилась с 256 мкг / мл до 0,25 мкг / мл в присутствии аспирина (1 ммоль / л), а для штамма R2 — МИК метронидазола уменьшилось с 64 мкг / мл до значения ниже читаемого (0.016 мкг / мл), что указывает на то, что аспирин увеличивает чувствительность H pylori к метронидазолу и превращает эти два устойчивых штамма в чувствительные штаммы.

Влияние аспирина на мутации гена rdxA

Фрагменты ДНК длиной 886 п.н., содержащие полный ген rdxA , амплифицировали с помощью ПЦР для эталонного штамма H pylori 26 695 и двух штаммов, устойчивых к метронидазло (R1, R2), обработанных или без аспирина. Анализ последовательности выявил точечные мутации, вставки и делеции в гене rdxA штамма R2 по сравнению с эталонным штаммом 26 695, а нуклеотидная гомология между двумя штаммами (26 695 и R2) составила 94.4%. Однако нуклеотидная гомология гена rdxA между штаммом R2 и его соответствующим изолятом R2 (A) (штамм R2, обработанный аспирином) составляла более 99,5% (рисунок и рисунок).

Сравнение последовательностей на линии (http://align.genome.jp) гена rdxA между устойчивым к метронидазолу штаммом (R2) и эталонным штаммом H pylori 26 695 (S).

Сравнение последовательностей на линии (http://align.genome.jp) гена rdxA между устойчивым к метронидазолу штаммом (R2) и его соответствующим чувствительным штаммом в присутствии аспирина [R2 (A)].

Влияние аспирина на проницаемость внешней мембраны H. pylori

Независимо от присутствия CCCP, радиоактивность H pylori , обработанного аспирином, была выше по сравнению с контрольным носителем (DMSO), что указывает на усиление аспирина. проницаемость наружной мембраны H pylori для антимикробного препарата (рисунок). Независимо от присутствия аспирина, радиоактивность клеток H pylori снижалась при добавлении ингибитора эффлюксной помпы CCCP, что указывает на то, что аспирин не влияет на коллапсирующий эффект CCCP на градиент протонов через цитоплазматическую мембрану H pylori . (Фигура ).

Радиоактивность клеток H pylori , обработанных аспирином (1 ммоль / л) или контрольным носителем (ДМСО). A: CCCP; B: Нет CCCP.

Радиоактивность клеток H pylori , обработанных CCCP (100 мкмоль / л) или без CCCP. A: Аспирин; B: Управление транспортным средством.

Влияние аспирина на профили OMP

Профили OMP H pylori , обработанного аспирином, были аналогичны таковым в контроле. Однако экспрессия двух OMP (Band 1 и 2) между 55 и 72 кДа изменялась в присутствии аспирина (рисунок).

Профили OMP H pylori 26 695. M: Маркер размера; C: Контроль; D: ДМСО; A: Аспирин. Группа 1: OMP увеличивается в присутствии аспирина; Группа 2: OMP снизился в присутствии аспирина.

Влияние аспирина на экспрессию мРНК поринов и системы оттока

Количественная ПЦР в реальном времени показала отсутствие значительных различий в уровнях кДНК hopA, hopB, hopC, hopD, hopE и hefA, hefB, hefC для штаммов, получавших аспирин, по сравнению с контролем.Это указывало на то, что независимо от присутствия аспирина экспрессия уровней мРНК hopA, hopB, hopC, hopD, hopE и hefA, hefB, hefC не изменялась (таблица).

Таблица 2

кДНК Уровни поринов и система оттока H. pylori , протестированные с помощью количественной ПЦР в реальном времени

905 285,8 ± 5,07
Уровни кДНК
Ген Группа аспирина ДМСО-контроль Пустой контроль
hopA 963.60 ± 23,33 1087,75 ± 26,42 856,27 ± 25,43
hopB 84,00 ± 15,97 91,45 ± 14,83 100,15 ± 16,28
9008 ± 16,28
9008 ± 16,28 ± 12,01 52,79 ± 10,27
hopD 83,86 ± 14,09 92,46 ± 17,78 89,92 ± 13,72
hopE 54.07 ± 10,58 52,77 ± 11,93 52,12 ± 9,92
hefA 12,31 ± 2,12 12,51 ± 1,99 12,97 ± 2,76
hefB ,47 25,60 ± 4,99
hefC 55,62 ± 8,89 52,08 ± 9,78 53,37 ± 10,04

ОБСУЖДЕНИЕ

H pylori — отрицательная спиралевидная бактерия. и важный патоген для человека, который колонизирует в желудке 50% населения мира [10,11].Инфекция приводит к хроническому воспалению слизистой оболочки желудка и язвенной болезни, и было доказано, что инфекция H pylori тесно связана с аденокарциномой и лимфомой лимфоидной ткани, связанной со слизистой оболочкой (MALT). Международное агентство по изучению рака при Всемирной организации здравоохранения (ВОЗ) определило H pylori как один из канцерогенов первого класса для человека [12]. Недавние исследования показали, что инфекция H pylori играет важную роль в инвазии сосудистых заболеваний сердца и головного мозга, аутоиммунных заболеваний, нарушений питания и обмена веществ, гематопатии и дерматологических заболеваний.Искоренение инфекции H pylori очень важно для предотвращения и лечения этих заболеваний. Наиболее успешные схемы лечения используют комбинации двух или более антибиотиков, таких как амоксициллин, кларитромицин, метронидазол или тетрациклин, вместе с ингибитором протонной помпы или висмутом. Однако с широким использованием противомикробных препаратов в клинической практике устойчивость к антибиотикам становится все более очевидной и считается одной из основных причин неэффективности лечения [13].

Ранние исследования показали, что салицилат подавлял рост некоторых бактерий, таких как Escherichia coli , Klebsiella pneumoniae , Pseudomonas aeruginosa и Staphylococcus epidermidis , а также влиял на активность фимбрий, жгутиков и производство биофильм. , слизь, и, таким образом, может изменить патогенность бактерий [14–21].Сообщалось, что in vitro , салицилат может изменять чувствительность бактерий к некоторым противомикробным препаратам. Салицилат индуцировал внутренний фенотип множественной антимикробной устойчивости у многих бактерий, таких как Escherichia coli , Salmonella typhimurium и Staphylococcus aureus , и повышал чувствительность некоторых бактерий к аминогликозидам [22–29]. Наши предыдущие исследования также показали, что in vitro аспирин не только подавлял рост H pylori [6–9], но также снижал МИК метронидазола, кларитромицина и амоксициллина до H pylori и даже преобразовывал некоторые устойчивые штаммы. к восприимчивым [6–8].Таким образом, в настоящем исследовании изучались механизмы увеличения восприимчивости H pylori к метронидазолу аспирином.

По крайней мере, четыре отличительных механизма устойчивости к антибиотикам описаны у бактерий: ферментативная инактивация, снижение проницаемости бактериальных мембран, активный отток антимикробных агентов и изменение участков-мишеней противомикробных препаратов для бактерий [30]. Метронидазол, кларитромицин и амоксициллин — это разные виды противомикробных препаратов, и каждый по-разному действует на разные участки-мишени в H pylori .Точно так же устойчивость H pylori к этим антимикробным агентам возникает по разным механизмам. Разумное объяснение того, что аспирин увеличивает чувствительность H pylori к противомикробным препаратам с различными антибактериальными механизмами, заключается в том, что аспирин не изменяет целевые участки бактерий, но увеличивает внутриклеточные концентрации противомикробных препаратов.

Метронидазол — пролекарство, активируемое нитроредуктазами в клетках бактерий. Устойчивость к метронидазолу вызывается либо отсутствием, либо инактивацией нитроредуктаз [31].Сообщалось, что устойчивость H pylori к метронидазолу была вызвана в основном нулевыми мутациями в гене rdxA , который кодирует нечувствительную к кислороду НАДФН-нитроредуктазу [32]. Однако исследования также сообщили об участии других редуктаз в развитии резистентного фенотипа. Помимо нечувствительных к кислороду НАДФН-нитроредуктаз, было обнаружено, что несколько других нитроредуктаз в H pylori , такие как НАДФН-флавин-оксидоредуктаза, ферредоксин-подобный белок, флаводоксин, α-кетоглутарат-оксидоредуктаза и пируват: флаводоксин-оксидоредуктаза и пируват: флаводоксин-оксидоредуктаза восстанавливают и генерируют метаводоксин-оксидоредуктазу. активные соединения [33,34].В нашем исследовании мутации в гене rdxA могут быть связаны с устойчивостью изолированного штамма (R2). Однако в присутствии аспирина штамм превращался из устойчивого к метронидазолу в чувствительный, а мутации в гене rdxA не изменялись. Используя метод изотопной сцинтилляции с [7- 3 H] -тетрациклином, наше исследование показало, что аспирин увеличивает внутриклеточную концентрацию антимикробных препаратов в клетках H pylori , указывая на то, что аспирин увеличивает проницаемость внешней мембраны H pylori для противомикробных препаратов. .При более высокой внутриклеточной концентрации в присутствии аспирина метронидазол может снижаться и активироваться другими нитроредуктазами в H pylori . Таким образом, MIC H pylori по отношению к метронидазолу снизился, а в некоторых случаях устойчивые штаммы даже превратились в чувствительные.

В механизмах увеличения концентрации противомикробных препаратов в клетках бактерий могут быть задействованы два пути. Один из них — увеличение количества антимикробных препаратов, пассивно проникающих в клетки бактерий; другой — нарушение активной откачки противомикробных препаратов из бактерий.Предыдущие исследования Escherichia coli показали, что салицилат повышает устойчивость к нескольким антибиотикам, включая хинолоны, цефалоспорины, ампициллин, налидиксовую кислоту, тетрациклин и хлорамфеникол [22]. Аспирин может индуцировать ген множественной устойчивости к антибиотикам ( mar ), изменять экспрессию OMP и снижать проницаемость внешней мембраны для противомикробных препаратов или увеличивать отток антимикробных препаратов [35–38]. Существуют три основные системы захвата через внешнюю мембрану [39], а именно: поглощение гидрофильных веществ через заполненные водой каналы поринов, поглощение поликатионов через саморекламу на сайтах связывания двухвалентных катионов на липополисахариде и поглощение гидрофобные вещества через бислой внешней мембраны.Бактерии могли продуцировать множество поринов и регулировать относительное количество различных поринов в ответ на осмолярность окружающей среды. По крайней мере, пять поринов, названных HopA, HopB, HopC, HopD и HopE (часть 32-членного семейства белков внешней мембраны) присутствовали в одной клетке H pylori [40,41]. Считалось, что эти порины связаны с устойчивостью к антибиотикам [40]. С другой стороны, некоторые бактерии экспрессировали мембранную транспортную систему, которая приводила к множественной лекарственной устойчивости за счет оттока лекарств.Три предполагаемых системы оттока RND, HefABC, HefDEF и HefGHI, идентифицированные в H pylori , могут быть коррелированы с устойчивостью к антибиотикам [42]. Из трех систем оттока только HefABC участвует в формировании множественной лекарственной устойчивости in vitro [42]. Таким образом, мы протестировали пять генов порина ( hopA , hopB , hopC , hopD и hopE ) и гены белка оттока ( hefA , hefB , hefC ) с использованием реальных время количественной ПЦР, и обнаружили, что аспирин не мешает экспрессии вышеуказанных белков на уровнях транскрипции гена.

Изменение проницаемости внешней мембраны H pylori должно сопровождаться модификацией некоторых родственных OMP. В настоящем исследовании экспрессия двух OMP H pylori между 55 и 72 кДа изменялась в присутствии аспирина. Однако функции и идентификация этих OMP должны быть определены с помощью двумерного электрофореза и анализа масс-спектра белка. Если эти OMP были связаны с увеличением проницаемости внешней мембраны H pylori , необходимо провести дальнейшие исследования, чтобы определить, происходят ли функциональные и фенотипические изменения этих OMP в присутствии аспирина на уровнях трансляции или модификации белка. , или некоторые другие порины или системы оттока.

Park et al [43] провели пилотное исследование, направленное на сравнение эффективности стандартного режима омепразол-амоксициллин-кларитромицин (OAC) с комбинированным режимом OAC и аспирином (OACA). Последующие эндоскопические исследования показали, что предыдущие язвы полностью зажили у всех пациентов. Хотя уровень эрадикации в группе OACA (86,7%) был выше, чем в группе OAC (80,3%), статистически значимой разницы между двумя группами не было. Общие нежелательные явления были одинаковыми в двух группах.Режим OACA хорошо переносился в группе пациентов с язвенной болезнью. Потенциал аспирина и других НПВП для клинического использования в повышении эффективности эрадикации H pylori может потребовать дальнейших исследований.

В связи с повышенным вниманием, уделяемым повреждению H pylori и устойчивости противомикробных препаратов к этому микроорганизму, необходимо срочно исследовать новые эффективные терапевтические схемы. Изучение молекулярных механизмов аспирина, повышающих чувствительность H pylori к противомикробным препаратам, поможет найти более эффективный режим эрадикации в клинической практике.

КОММЕНТАРИИ

Предпосылки

Сообщалось, что аспирин подавлял рост Helicobacter pylori ( H pylori ), а минимальная ингибирующая концентрация (МПК) кларитромицина, метронидазола и амоксициллина до H pylori снижалась при лечении аспирин. Это указывает на то, что аспирин увеличивает чувствительность H pylori к этим противомикробным препаратам и даже превращает некоторые устойчивые штаммы в чувствительные.

Границы исследований

Инфекция H. pylori приводит к хроническому воспалению слизистой оболочки желудка, язвенной болезни и тесно связана с аденокарциномой и лимфомой лимфоидной ткани, ассоциированной со слизистой оболочкой (MALT). Недавние исследования показали, что инфекция H pylori играет важную роль в инвазии сосудистых заболеваний сердца и головного мозга, аутоиммунных заболеваний, нарушений питания и обмена веществ, гематопатии и дерматологических заболеваний. Таким образом, искоренение инфекции H pylori очень важно для предотвращения и лечения этих заболеваний.Однако с широким использованием противомикробных препаратов в клинической практике устойчивость к антибиотикам стала очевидной и считается одной из основных причин неэффективности лечения.

Инновации и прорывы

In vitro аспирин снизил МИК метронидазола, кларитромицина и амоксициллина до H pylori и даже преобразовал некоторые устойчивые штаммы в чувствительные. В этом исследовании изучались механизмы действия аспирина, повышающего чувствительность H pylori к метронидазолу.

Приложения

Изучение молекулярных механизмов аспирина, повышающих чувствительность H pylori к антимикробным препаратам, поможет более интенсивно понять механизмы устойчивости H pylori к антибиотикам и выявить более эффективный режим эрадикации в клинической практике.

Терминология

Карбонилцианид м-хлорфенилгидразон (CCCP), своего рода ингибитор оттока, который эффективен при микромолярной концентрации, может изменять градиент pH через цитоплазматическую мембрану, таким образом, лишает запас энергии транспортного белка.

Экспертный обзор

Авторы интенсивно сообщают, что нестероидные противовоспалительные препараты (НПВП), включая салицилат натрия, аспирин, индометацин и целекоксиб, ингибируют рост H pylori дозозависимым образом и изменяют восприимчивость. H pylori к антибиотикам. В этом исследовании авторы продемонстрировали, что, хотя аспирин увеличивал чувствительность H pylori к метронидазолу, он не влиял на мутации гена rdxA H pylori и что аспирин увеличивал внутриклеточные концентрации противомикробных препаратов, вероятно, за счет изменения белки внешней мембраны (OMP) экспрессируют H pylori .Эта интересная тема позволит врачам по-новому взглянуть на эрадикацию H pylori .

Аспирин увеличивает чувствительность Helicobacter pylori к метронидазолу за счет увеличения внутриклеточных концентраций противомикробных препаратов.

Резюме.

МЕТОДЫ. В это исследование были включены эталонный штамм H. pylori 26 695 и два метронидазолустойчивых изолята H. pylori .Штаммы инкубировали в бульоне Brucella с аспирином или без него (1 ммоль / л). Ген rdxA H pylori амплифицировали с помощью ПЦР и секвенировали. Проницаемость H pylori для противомикробных препаратов определяли путем анализа внутриклеточной радиоактивности клеток после инкубации с [7- 3 H] -тетрациклином. Белки внешней мембраны (OMP) H pylori 26 695 были очищены и проанализированы с помощью SDS-PAGE. Экспрессию 5 поринов (hopA, hopB, hopC, hopD и hopE) и предполагаемую систему оттока RND (hefABC) H pylori анализировали с помощью количественной ПЦР в реальном времени.

РЕЗУЛЬТАТЫ: Мутации в гене rdxA не изменились в изолятах, устойчивых к метронидазолу, обработанных аспирином. Радиоактивность H pylori увеличивалась при лечении аспирином, что указывает на то, что аспирин улучшает проницаемость внешней мембраны H pylori . Однако экспрессия двух полос OMP между 55 и 72 кДа изменялась в присутствии аспирина. Экспрессия мРНК hopA, hopB, hopC, hopD, hopE и hefA, hefB, hefC H. pylori не изменялась при лечении аспирином.

ЗАКЛЮЧЕНИЕ: Хотя аспирин увеличивает чувствительность H pylori к метронидазолу, он не влияет на мутации гена rdxA H pylori . Аспирин увеличивает внутриклеточные концентрации противомикробных препаратов, вероятно, за счет изменения экспрессии OMP.

Ключевые слова: Helicobacter pylori, аспирин, метронидазол, резистентность, минимальные ингибирующие концентрации

ВВЕДЕНИЕ

Аспирин, называемый нестероидными противовоспалительными препаратами (НПВП), является одним из наиболее широко используемых препаратов во всем мире.Он ингибирует циклооксигеназы (ЦОГ), тем самым необратимо блокируя превращение арахидоновой кислоты в простаноиды. Вдобавок считается, что аспирин обеспечивает некоторую защиту от ишемической болезни сердца [1], частично благодаря ингибированию тромбоксана А2, мощного агрегатора тромбоцитов. Сообщалось, что аспирин демонстрирует химиопрофилактическую активность против рака пищевода, желудка и толстой кишки, вызывая апоптоз в эпителиальных клетках и регулируя ангиогенез [2–4]. Аспирин также оказывает множество эффектов на различные виды бактерий.Предыдущие исследования показали, что аспирин может подавлять рост некоторых бактерий, влиять на выработку факторов вирулентности некоторыми бактериями и изменять восприимчивость бактерий к некоторым антибиотикам, влияя на экспрессию генов и вызывая ряд морфологических и физиологических изменений у бактерий [5 ].

Мы ранее сообщали, что НПВП, включая салицилат натрия, аспирин, индометацин и целекоксиб, подавляли рост H pylori дозозависимым образом при инкубации в бульоне бруцелл in vitro [6–9].Эти препараты также существенно влияли на активность факторов вирулентности H pylori , например уреазы и вакуулирующего цитотоксина [8,9]. Кроме того, минимальные ингибирующие концентрации (МПК) кларитромицина, метронидазола и амоксициллина до H pylori снижались при лечении низкой концентрацией аспирина [6–8], что указывает на то, что аспирин увеличивает чувствительность H pylori к этим антимикробным препаратам. .

Целью настоящего исследования было изучить механизмы действия аспирина, повышающего чувствительность H pylori к метронидазолу.Ген rdxA H pylori , обработанный аспирином и без него, анализировали с помощью ПЦР-амплификации и секвенирования. Влияние аспирина на проницаемость внешней мембраны H pylori определяли с использованием [7- 3 H] -тетрациклина. Также было определено влияние аспирина на экспрессию белков внешней мембраны (OMP) H pylori .

МАТЕРИАЛЫ И МЕТОДЫ

Chemicals

Аспирин (Sigma Chemical Co, Сент-Луис, Миссури, США) и карбонилцианид с протонным проводником м-хлорфенилгидразон (CCCP, Sigma Chemical Co.) заранее растворяли в ДМСО (Sigma Chemical Co.). [7- 3 H] -тетрациклин (0,6 Ки / ммоль; 22,2 ГБк / ммоль; Dupont / NEN Research Products, Бостон, Массачусетс) недавно растворяли в разбавленной соляной кислоте.

Штаммы и условия культивирования

H pylori эталонный штамм 26 695 (чувствительный к метронидазолу) и два клинических изолята H pylori (устойчивый к метронидазолу, R1 и R2) были включены в это исследование. Штаммы культивировали на чашках с колумбийским агаром, содержащим 8% овечьей крови, в микроаэробной атмосфере (10% CO 2 и 5% O 2 ) при 37 ° C в течение 2-3 дней. H pylori из 10 8 КОЕ / мл затем инокулировали в 20 мл бульона Brucella (Difco Laboratories, Детройт, штат Мичиган, США) с добавлением 10% фетальной бычьей сыворотки (FBS; Gibco-BRL, Гранд-Айленд, штат Нью-Йорк, США). ) в наборе 10 см чашек Петри с 1 ммоль / л аспирина или с контролем носителя (ДМСО 0,1%). Чашки помещали в анаэробный сосуд (Oxoid) и инкубировали при 37 ° C на шейкере со скоростью 60 об / мин в микроаэробных условиях в течение 48 часов.

Определение МИК

Бактерии готовили в бульоне для инфузии сердца мозга с получением количества жизнеспособных клеток 3 × 10 8 КОЕ / мл (что эквивалентно 1 стандартной единице мутности МакФарланда) и использовали в качестве инокулята для тестирования чувствительности.Бактериальную суспензию (100 мкл) наносили в двух экземплярах на чашки с колумбийским агаром с аспирином (1 ммоль / л) или без него. На каждую пластину наносили одну тест-полоску метронидазола (OXOID Ltd, Англия). МИК метронидазола и возможное влияние аспирина на МИК метронидазола определяли через 72 часа инкубации при 37 ° C в микроаэробных условиях.

Экстракция геномной ДНК

H pylori геномная ДНК была экстрагирована с использованием метода диоксицида кремния.Клетки собирали и дважды промывали фосфатно-солевым буфером (PBS) (0,01 моль / л, pH 7,2). Осаждение клеток суспендировали в 100 мкл ТЕ. Затем 5 мкл SiO 2 Liq. и 400 мкл связывающего буфера (содержащего 4 моль / л изотиоцианата гуанидиния, 50 ммоль / л трис-HCl, 20 ммоль / л EDTA) добавляли и инкубировали при 55 ° C в течение 5 минут при встряхивании один раз в минуту. Суспензию центрифугировали при 8000 об / мин в течение 30 с при комнатной температуре и осадок трижды промывали очищающим буфером (содержащим 20 ммоль / л Трис-HCl, 1 ммоль / л EDTA, 100 ммоль / л NaCl и дегидратированный спирт).Полученную суспензию сушили при 55 ° C и хранили при -20 ° C.

Амплификация гена rdxA H. pylori и секвенирование

Фрагменты (886 п.н.), содержащие полный ген rdxA , амплифицировали с помощью ПЦР. Прямой праймер: 5′-AGGGATTTTATTGTATGCTACAA-3 ‘; Обратный праймер: 5’-AGGAGCATCAGATAGTTCTGA-3 ‘. ПЦР-амплификацию проводили в 25 мкл реакционного раствора, содержащего 2 мкл геномной ДНК H pylori , 4,5 мкл 10-кратного буфера для ПЦР (с 15 мкмоль / л MgCl 2 ), 2 мкл dNTP (по 2 каждого.5 ммоль / л), 2 мкл прямого и обратного праймеров (каждый 5 мкмоль / л), 0,5 мкл TaqDNA-полимеразы (1 ед. / Мкл) и 9 мкл ddH 2 O. Первоначально реакцию денатурировали при 94 °. C в течение 5 мин, затем 30 циклов, каждый из которых состоит из 30 с при 94 ° C (денатурация), 1 мин при 52 ° C (отжиг) и 1 мин при 72 ° C (удлинение). После окончательного продления в течение 10 минут при 72 ° C ампликоны подвергали электрофорезу в 1,5% агарозном геле и очищали с использованием метода диоксицида кремния, как описано выше. Полученный ген rdxA секвенировали с помощью процедуры терминации дидезокси-цепи в Beijing Li-Jia-Tai-Cheng Technology Company.Гены rdxA H pylori , обработанные аспирином и без него, были проанализированы в режиме онлайн (http://align.genome.jp).

Исследования поглощения с использованием [7-

3 H] тетрациклина

Штамм 26 695 выращивали до средне-логарифмической фазы (приблизительно от 3 × 10 9 до 5 × 10 9 КОЕ / мл) в бульоне Brucella и затем добавляли 1 ммоль / л аспирина или ДМСО (<1%, контроль носителя) в течение 6 часов при 37 ° C на шейкере при 60 об / мин в микроаэробных условиях.Суспензию клеток центрифугировали при 8000 об / мин в течение 10 мин при комнатной температуре, осадок промывали и суспендировали в буфере HEPES (pH 7,2, содержащий 100 мкмоль / л MgCl 2 ). При комнатной температуре к 10 мл клеточной суспензии добавляли 5 мкКи [7- 3 H] -тетрациклин (0,6 Ки / ммоль; 22,2 ГБк / ммоль; Dupont / NEN Research Products, Бостон, США). Через 20 мин каждую клеточную суспензию делили на две половины и к половине добавляли 100 мкмоль / л CCCP. Аликвоты по 1 миллилитру отбирали с 10-минутными интервалами и трижды промывали PBS.Затем полученные гранулы разбавляли сцинтилляционной жидкостью и анализировали на радиоактивность в сцинтилляционном счетчике (TRI-CARB 2100TR).

Очистка OMPs

H. pylori 26 695 инкубировали в бульоне Brucella в течение 48 часов. Суспензию центрифугировали при 8000 об / мин в течение 10 минут, промывали и суспендировали в ледяном буфере Трис-Mg (10 ммоль / л Трис-HCl, содержащий 5 ммоль / л MgCl 2 , pH 7,3) и обрабатывали ультразвуком (один раз. 30 с с интервалом 3-5 с в течение 5 мин) до тех пор, пока большая часть клеток не будет разрушена, как это видно под микроскопом.Неразрушенные клетки удаляли центрифугированием при 8000 об / мин в течение 20 мин при 4 ° C. Внутреннюю и внешнюю мембраны концентрировали центрифугированием при 50 000 об / мин в течение 60 мин при 4 ° C. Осадок суспендировали в 2% Triton Tris-Mg (pH 7,5) и инкубировали в течение 30 минут при комнатной температуре, а затем центрифугировали и снова инкубировали в тех же условиях. Полученные гранулы, OMP, дважды промывали 10 ммоль / л трис-HCl и растворяли в ddH 2 О. Конечную концентрацию OMP определяли методом кумасси бриллиантового синего R250.

Гель-электрофорез в SDS-PAGE

Десять микрограмм OMP использовали для гель-электрофореза в SDS-PAGE при постоянном напряжении (5% -ный гель-стекинг при 60 В, 10% -ный разделяющий гель при 100 В). После 30 мин инкубации в фиксирующей жидкости гель окрашивали кумасси бриллиантовым синим G250 в течение 30 мин.

Выделение тотальной РНК и обратная транскрипция

Общую РНК получали методом TRIzol, как описано производителем (Invitrogen, Burlington, Ontario, Canada), и загрязняющую ДНК удаляли обработкой ДНКазой I в соответствии с инструкциями производителя (Sigma) .Для синтеза кДНК 4 мкг РНК, разбавленной DEPC H 2 O, нагревали до 70 ° C в течение 5 минут и быстро охлаждали на льду в течение 15 минут. Затем образцы добавляли к 20 мкл реакционной смеси, содержащей 2 мкл случайных гексамерных праймеров (1 мкг / мкл), 0,4 мкл RNasin, 1 мкл M-MLV, 4 мкл dNTP (каждый 2,5 ммоль / л) и 4 мкл 5 × RT буфера. Реакцию синтеза кДНК проводили в течение 60 мин при 37 ° C. Затем фермент инактивировали при 95 ° C в течение 5 мин. Аликвоты кДНК хранили при -70 ° C.

Количественная ПЦР в реальном времени

Уровни мРНК hopA, hopB, hopC, hopD, hopE и hefA, hefB, hefC определяли с помощью ПЦР в реальном времени с использованием системы обнаружения последовательностей ABI Prism 7700 (Perkin-Elmer Applied Biosystems, Фостер-Сити, Калифорния.). Специфические праймеры и зонды TaqMan были сконструированы с помощью программы Primer Express 3.0 (Perkin-Elmer Applied Biosystems) (таблица). Стандартная кривая была построена с использованием 10-кратных серийных разведений каждой кДНК. Реакционные смеси для ПЦР (50 мкл) готовили путем смешивания 5 мкл раствора синтезированной кДНК с 5 мкл 10-кратного буфера для ПЦР (содержащего 15 мкмоль / л MgCl 2 ), 3 мкл прямого и обратного праймеров (каждый по 5 мкмоль / л). , 4 мкл dNTP (каждый 2,5 ммоль / л), 2 мкл зонда TagMan, 1 мкл ROX, 0,5 мкл полимеразы TaqDNA (1 ед. / Мкл).ПЦР проводили при 95 ° C в течение 10 минут, затем 40 циклов при 95 ° C в течение 15 секунд и 60 ° C в течение 60 секунд в соответствии с инструкциями производителей. Уровни мРНК белка выражали как отношение мРНК белка к мРНК 16S рРНК [соотношение мРНК белка (ед. / Мл) / мРНК 16S рРНК (ед. / Мл) × 100 000]. ПЦР проводили пятикратно с использованием образцов, приготовленных одновременно.

Таблица 1

Праймеры и зонды, используемые в количественной ПЦР в реальном времени

TAACGCTAGCCAACAACGCTAACATCAGCA CGCTCTTTATAACGCGCAAGTAA GCTGTTCCCGGCTCTGAATC 905 AGACAAACAGGCTCAAAGCGATTCC
Тип зонда или праймера Последовательность (5′-3 ‘)
hopA F ATCATGCTAGTGATGGCGTTAAAG
HOPA R CAGGCATAGACGGAGGCAAT
HOPA зонд CCAAAAATATTGCATGCGTTCCCGC
hopB F CTTGGTGCAAAACATCGTCAAT
hopB R CCCGCCATAGCTCACTTGAT
hopB зонд
hopC F
hopC R
hopC зонд TGGATAAAATCAACGCGCTCAACAATCAG 900 52
hopD F CTGCTTGAGCGCGGTTTAA
hopD R CAACCTAGACACTGGGAAAGCAT
hopD Зонд CTTGCGCTCTAGCGTTAGCGAACATGC
надежду на F GGATTGCACAGGGAGTGTTGT
надежду на то, R GCCCCATTAGCGTATTTAGCAT
надежду на зонд TTGCCCCCCAGGTCTTACCGCT
Hefa F AGGGCGTTTTGGGAATTTCT
Hefa R GCATGATGGATTGTTTTTGCA
Hefa зонд CCCCGGTCAGCAAAATACGGCTG
hefB F AGGGCGATGTTTTGTTGCTT
hefB ICCCAATTTTGCTGTATCGT
hefB A Зонд
hefC F GTTTGCGTTCTTGCGTAACG
hefC R TGTTTAATGAAAAGCCCATCCA
hefC Зонд CACGATCACCCTCGTTTCAGCGATC
16S рРНК F CCGCCTACGCGCTCTTTAC
16S рРНК R CTAACGAATAAGCACCGGCTAAC
16S рРНК Зонд CCCAGTGATTCCGAGTAACGCTTGCA

Статистический анализ SAS

Статистический анализ был проведен с использованием статистического анализа SSSS.0. Репрезентативные данные внутриклеточной радиоактивности и количественной ПЦР были представлены как среднее ± стандартное отклонение. Для сравнения данных использовался тест Стьюдента t . P <0,05 считали статистически значимым.

РЕЗУЛЬТАТЫ

Влияние аспирина на МИК метронидазола

Для штамма R1 МИК метронидазола снизилась с 256 мкг / мл до 0,25 мкг / мл в присутствии аспирина (1 ммоль / л), а для штамма R2 — МИК метронидазола уменьшилось с 64 мкг / мл до значения ниже читаемого (0.016 мкг / мл), что указывает на то, что аспирин увеличивает чувствительность H pylori к метронидазолу и превращает эти два устойчивых штамма в чувствительные штаммы.

Влияние аспирина на мутации гена rdxA

Фрагменты ДНК длиной 886 п.н., содержащие полный ген rdxA , амплифицировали с помощью ПЦР для эталонного штамма H pylori 26 695 и двух штаммов, устойчивых к метронидазло (R1, R2), обработанных или без аспирина. Анализ последовательности выявил точечные мутации, вставки и делеции в гене rdxA штамма R2 по сравнению с эталонным штаммом 26 695, а нуклеотидная гомология между двумя штаммами (26 695 и R2) составила 94.4%. Однако нуклеотидная гомология гена rdxA между штаммом R2 и его соответствующим изолятом R2 (A) (штамм R2, обработанный аспирином) составляла более 99,5% (рисунок и рисунок).

Сравнение последовательностей на линии (http://align.genome.jp) гена rdxA между устойчивым к метронидазолу штаммом (R2) и эталонным штаммом H pylori 26 695 (S).

Сравнение последовательностей на линии (http://align.genome.jp) гена rdxA между устойчивым к метронидазолу штаммом (R2) и его соответствующим чувствительным штаммом в присутствии аспирина [R2 (A)].

Влияние аспирина на проницаемость внешней мембраны H. pylori

Независимо от присутствия CCCP, радиоактивность H pylori , обработанного аспирином, была выше по сравнению с контрольным носителем (DMSO), что указывает на усиление аспирина. проницаемость наружной мембраны H pylori для антимикробного препарата (рисунок). Независимо от присутствия аспирина, радиоактивность клеток H pylori снижалась при добавлении ингибитора эффлюксной помпы CCCP, что указывает на то, что аспирин не влияет на коллапсирующий эффект CCCP на градиент протонов через цитоплазматическую мембрану H pylori . (Фигура ).

Радиоактивность клеток H pylori , обработанных аспирином (1 ммоль / л) или контрольным носителем (ДМСО). A: CCCP; B: Нет CCCP.

Радиоактивность клеток H pylori , обработанных CCCP (100 мкмоль / л) или без CCCP. A: Аспирин; B: Управление транспортным средством.

Влияние аспирина на профили OMP

Профили OMP H pylori , обработанного аспирином, были аналогичны таковым в контроле. Однако экспрессия двух OMP (Band 1 и 2) между 55 и 72 кДа изменялась в присутствии аспирина (рисунок).

Профили OMP H pylori 26 695. M: Маркер размера; C: Контроль; D: ДМСО; A: Аспирин. Группа 1: OMP увеличивается в присутствии аспирина; Группа 2: OMP снизился в присутствии аспирина.

Влияние аспирина на экспрессию мРНК поринов и системы оттока

Количественная ПЦР в реальном времени показала отсутствие значительных различий в уровнях кДНК hopA, hopB, hopC, hopD, hopE и hefA, hefB, hefC для штаммов, получавших аспирин, по сравнению с контролем.Это указывало на то, что независимо от присутствия аспирина экспрессия уровней мРНК hopA, hopB, hopC, hopD, hopE и hefA, hefB, hefC не изменялась (таблица).

Таблица 2

кДНК Уровни поринов и система оттока H. pylori , протестированные с помощью количественной ПЦР в реальном времени

905 285,8 ± 5,07
Уровни кДНК
Ген Группа аспирина ДМСО-контроль Пустой контроль
hopA 963.60 ± 23,33 1087,75 ± 26,42 856,27 ± 25,43
hopB 84,00 ± 15,97 91,45 ± 14,83 100,15 ± 16,28
9008 ± 16,28
9008 ± 16,28 ± 12,01 52,79 ± 10,27
hopD 83,86 ± 14,09 92,46 ± 17,78 89,92 ± 13,72
hopE 54.07 ± 10,58 52,77 ± 11,93 52,12 ± 9,92
hefA 12,31 ± 2,12 12,51 ± 1,99 12,97 ± 2,76
hefB ,47 25,60 ± 4,99
hefC 55,62 ± 8,89 52,08 ± 9,78 53,37 ± 10,04

ОБСУЖДЕНИЕ

H pylori — отрицательная спиралевидная бактерия. и важный патоген для человека, который колонизирует в желудке 50% населения мира [10,11].Инфекция приводит к хроническому воспалению слизистой оболочки желудка и язвенной болезни, и было доказано, что инфекция H pylori тесно связана с аденокарциномой и лимфомой лимфоидной ткани, связанной со слизистой оболочкой (MALT). Международное агентство по изучению рака при Всемирной организации здравоохранения (ВОЗ) определило H pylori как один из канцерогенов первого класса для человека [12]. Недавние исследования показали, что инфекция H pylori играет важную роль в инвазии сосудистых заболеваний сердца и головного мозга, аутоиммунных заболеваний, нарушений питания и обмена веществ, гематопатии и дерматологических заболеваний.Искоренение инфекции H pylori очень важно для предотвращения и лечения этих заболеваний. Наиболее успешные схемы лечения используют комбинации двух или более антибиотиков, таких как амоксициллин, кларитромицин, метронидазол или тетрациклин, вместе с ингибитором протонной помпы или висмутом. Однако с широким использованием противомикробных препаратов в клинической практике устойчивость к антибиотикам становится все более очевидной и считается одной из основных причин неэффективности лечения [13].

Ранние исследования показали, что салицилат подавлял рост некоторых бактерий, таких как Escherichia coli , Klebsiella pneumoniae , Pseudomonas aeruginosa и Staphylococcus epidermidis , а также влиял на активность фимбрий, жгутиков и производство биофильм. , слизь, и, таким образом, может изменить патогенность бактерий [14–21].Сообщалось, что in vitro , салицилат может изменять чувствительность бактерий к некоторым противомикробным препаратам. Салицилат индуцировал внутренний фенотип множественной антимикробной устойчивости у многих бактерий, таких как Escherichia coli , Salmonella typhimurium и Staphylococcus aureus , и повышал чувствительность некоторых бактерий к аминогликозидам [22–29]. Наши предыдущие исследования также показали, что in vitro аспирин не только подавлял рост H pylori [6–9], но также снижал МИК метронидазола, кларитромицина и амоксициллина до H pylori и даже преобразовывал некоторые устойчивые штаммы. к восприимчивым [6–8].Таким образом, в настоящем исследовании изучались механизмы увеличения восприимчивости H pylori к метронидазолу аспирином.

По крайней мере, четыре отличительных механизма устойчивости к антибиотикам описаны у бактерий: ферментативная инактивация, снижение проницаемости бактериальных мембран, активный отток антимикробных агентов и изменение участков-мишеней противомикробных препаратов для бактерий [30]. Метронидазол, кларитромицин и амоксициллин — это разные виды противомикробных препаратов, и каждый по-разному действует на разные участки-мишени в H pylori .Точно так же устойчивость H pylori к этим антимикробным агентам возникает по разным механизмам. Разумное объяснение того, что аспирин увеличивает чувствительность H pylori к противомикробным препаратам с различными антибактериальными механизмами, заключается в том, что аспирин не изменяет целевые участки бактерий, но увеличивает внутриклеточные концентрации противомикробных препаратов.

Метронидазол — пролекарство, активируемое нитроредуктазами в клетках бактерий. Устойчивость к метронидазолу вызывается либо отсутствием, либо инактивацией нитроредуктаз [31].Сообщалось, что устойчивость H pylori к метронидазолу была вызвана в основном нулевыми мутациями в гене rdxA , который кодирует нечувствительную к кислороду НАДФН-нитроредуктазу [32]. Однако исследования также сообщили об участии других редуктаз в развитии резистентного фенотипа. Помимо нечувствительных к кислороду НАДФН-нитроредуктаз, было обнаружено, что несколько других нитроредуктаз в H pylori , такие как НАДФН-флавин-оксидоредуктаза, ферредоксин-подобный белок, флаводоксин, α-кетоглутарат-оксидоредуктаза и пируват: флаводоксин-оксидоредуктаза и пируват: флаводоксин-оксидоредуктаза восстанавливают и генерируют метаводоксин-оксидоредуктазу. активные соединения [33,34].В нашем исследовании мутации в гене rdxA могут быть связаны с устойчивостью изолированного штамма (R2). Однако в присутствии аспирина штамм превращался из устойчивого к метронидазолу в чувствительный, а мутации в гене rdxA не изменялись. Используя метод изотопной сцинтилляции с [7- 3 H] -тетрациклином, наше исследование показало, что аспирин увеличивает внутриклеточную концентрацию антимикробных препаратов в клетках H pylori , указывая на то, что аспирин увеличивает проницаемость внешней мембраны H pylori для противомикробных препаратов. .При более высокой внутриклеточной концентрации в присутствии аспирина метронидазол может снижаться и активироваться другими нитроредуктазами в H pylori . Таким образом, MIC H pylori по отношению к метронидазолу снизился, а в некоторых случаях устойчивые штаммы даже превратились в чувствительные.

В механизмах увеличения концентрации противомикробных препаратов в клетках бактерий могут быть задействованы два пути. Один из них — увеличение количества антимикробных препаратов, пассивно проникающих в клетки бактерий; другой — нарушение активной откачки противомикробных препаратов из бактерий.Предыдущие исследования Escherichia coli показали, что салицилат повышает устойчивость к нескольким антибиотикам, включая хинолоны, цефалоспорины, ампициллин, налидиксовую кислоту, тетрациклин и хлорамфеникол [22]. Аспирин может индуцировать ген множественной устойчивости к антибиотикам ( mar ), изменять экспрессию OMP и снижать проницаемость внешней мембраны для противомикробных препаратов или увеличивать отток антимикробных препаратов [35–38]. Существуют три основные системы захвата через внешнюю мембрану [39], а именно: поглощение гидрофильных веществ через заполненные водой каналы поринов, поглощение поликатионов через саморекламу на сайтах связывания двухвалентных катионов на липополисахариде и поглощение гидрофобные вещества через бислой внешней мембраны.Бактерии могли продуцировать множество поринов и регулировать относительное количество различных поринов в ответ на осмолярность окружающей среды. По крайней мере, пять поринов, названных HopA, HopB, HopC, HopD и HopE (часть 32-членного семейства белков внешней мембраны) присутствовали в одной клетке H pylori [40,41]. Считалось, что эти порины связаны с устойчивостью к антибиотикам [40]. С другой стороны, некоторые бактерии экспрессировали мембранную транспортную систему, которая приводила к множественной лекарственной устойчивости за счет оттока лекарств.Три предполагаемых системы оттока RND, HefABC, HefDEF и HefGHI, идентифицированные в H pylori , могут быть коррелированы с устойчивостью к антибиотикам [42]. Из трех систем оттока только HefABC участвует в формировании множественной лекарственной устойчивости in vitro [42]. Таким образом, мы протестировали пять генов порина ( hopA , hopB , hopC , hopD и hopE ) и гены белка оттока ( hefA , hefB , hefC ) с использованием реальных время количественной ПЦР, и обнаружили, что аспирин не мешает экспрессии вышеуказанных белков на уровнях транскрипции гена.

Изменение проницаемости внешней мембраны H pylori должно сопровождаться модификацией некоторых родственных OMP. В настоящем исследовании экспрессия двух OMP H pylori между 55 и 72 кДа изменялась в присутствии аспирина. Однако функции и идентификация этих OMP должны быть определены с помощью двумерного электрофореза и анализа масс-спектра белка. Если эти OMP были связаны с увеличением проницаемости внешней мембраны H pylori , необходимо провести дальнейшие исследования, чтобы определить, происходят ли функциональные и фенотипические изменения этих OMP в присутствии аспирина на уровнях трансляции или модификации белка. , или некоторые другие порины или системы оттока.

Park et al [43] провели пилотное исследование, направленное на сравнение эффективности стандартного режима омепразол-амоксициллин-кларитромицин (OAC) с комбинированным режимом OAC и аспирином (OACA). Последующие эндоскопические исследования показали, что предыдущие язвы полностью зажили у всех пациентов. Хотя уровень эрадикации в группе OACA (86,7%) был выше, чем в группе OAC (80,3%), статистически значимой разницы между двумя группами не было. Общие нежелательные явления были одинаковыми в двух группах.Режим OACA хорошо переносился в группе пациентов с язвенной болезнью. Потенциал аспирина и других НПВП для клинического использования в повышении эффективности эрадикации H pylori может потребовать дальнейших исследований.

В связи с повышенным вниманием, уделяемым повреждению H pylori и устойчивости противомикробных препаратов к этому микроорганизму, необходимо срочно исследовать новые эффективные терапевтические схемы. Изучение молекулярных механизмов аспирина, повышающих чувствительность H pylori к противомикробным препаратам, поможет найти более эффективный режим эрадикации в клинической практике.

КОММЕНТАРИИ

Предпосылки

Сообщалось, что аспирин подавлял рост Helicobacter pylori ( H pylori ), а минимальная ингибирующая концентрация (МПК) кларитромицина, метронидазола и амоксициллина до H pylori снижалась при лечении аспирин. Это указывает на то, что аспирин увеличивает чувствительность H pylori к этим противомикробным препаратам и даже превращает некоторые устойчивые штаммы в чувствительные.

Границы исследований

Инфекция H. pylori приводит к хроническому воспалению слизистой оболочки желудка, язвенной болезни и тесно связана с аденокарциномой и лимфомой лимфоидной ткани, ассоциированной со слизистой оболочкой (MALT). Недавние исследования показали, что инфекция H pylori играет важную роль в инвазии сосудистых заболеваний сердца и головного мозга, аутоиммунных заболеваний, нарушений питания и обмена веществ, гематопатии и дерматологических заболеваний. Таким образом, искоренение инфекции H pylori очень важно для предотвращения и лечения этих заболеваний.Однако с широким использованием противомикробных препаратов в клинической практике устойчивость к антибиотикам стала очевидной и считается одной из основных причин неэффективности лечения.

Инновации и прорывы

In vitro аспирин снизил МИК метронидазола, кларитромицина и амоксициллина до H pylori и даже преобразовал некоторые устойчивые штаммы в чувствительные. В этом исследовании изучались механизмы действия аспирина, повышающего чувствительность H pylori к метронидазолу.

Приложения

Изучение молекулярных механизмов аспирина, повышающих чувствительность H pylori к антимикробным препаратам, поможет более интенсивно понять механизмы устойчивости H pylori к антибиотикам и выявить более эффективный режим эрадикации в клинической практике.

Терминология

Карбонилцианид м-хлорфенилгидразон (CCCP), своего рода ингибитор оттока, который эффективен при микромолярной концентрации, может изменять градиент pH через цитоплазматическую мембрану, таким образом, лишает запас энергии транспортного белка.

Экспертный обзор

Авторы интенсивно сообщают, что нестероидные противовоспалительные препараты (НПВП), включая салицилат натрия, аспирин, индометацин и целекоксиб, ингибируют рост H pylori дозозависимым образом и изменяют восприимчивость. H pylori к антибиотикам. В этом исследовании авторы продемонстрировали, что, хотя аспирин увеличивал чувствительность H pylori к метронидазолу, он не влиял на мутации гена rdxA H pylori и что аспирин увеличивал внутриклеточные концентрации противомикробных препаратов, вероятно, за счет изменения белки внешней мембраны (OMP) экспрессируют H pylori .Эта интересная тема позволит врачам по-новому взглянуть на эрадикацию H pylori .

Аспирин увеличивает чувствительность Helicobacter pylori к метронидазолу за счет увеличения внутриклеточных концентраций противомикробных препаратов.

Резюме.

МЕТОДЫ. В это исследование были включены эталонный штамм H. pylori 26 695 и два метронидазолустойчивых изолята H. pylori .Штаммы инкубировали в бульоне Brucella с аспирином или без него (1 ммоль / л). Ген rdxA H pylori амплифицировали с помощью ПЦР и секвенировали. Проницаемость H pylori для противомикробных препаратов определяли путем анализа внутриклеточной радиоактивности клеток после инкубации с [7- 3 H] -тетрациклином. Белки внешней мембраны (OMP) H pylori 26 695 были очищены и проанализированы с помощью SDS-PAGE. Экспрессию 5 поринов (hopA, hopB, hopC, hopD и hopE) и предполагаемую систему оттока RND (hefABC) H pylori анализировали с помощью количественной ПЦР в реальном времени.

РЕЗУЛЬТАТЫ: Мутации в гене rdxA не изменились в изолятах, устойчивых к метронидазолу, обработанных аспирином. Радиоактивность H pylori увеличивалась при лечении аспирином, что указывает на то, что аспирин улучшает проницаемость внешней мембраны H pylori . Однако экспрессия двух полос OMP между 55 и 72 кДа изменялась в присутствии аспирина. Экспрессия мРНК hopA, hopB, hopC, hopD, hopE и hefA, hefB, hefC H. pylori не изменялась при лечении аспирином.

ЗАКЛЮЧЕНИЕ: Хотя аспирин увеличивает чувствительность H pylori к метронидазолу, он не влияет на мутации гена rdxA H pylori . Аспирин увеличивает внутриклеточные концентрации противомикробных препаратов, вероятно, за счет изменения экспрессии OMP.

Ключевые слова: Helicobacter pylori, аспирин, метронидазол, резистентность, минимальные ингибирующие концентрации

ВВЕДЕНИЕ

Аспирин, называемый нестероидными противовоспалительными препаратами (НПВП), является одним из наиболее широко используемых препаратов во всем мире.Он ингибирует циклооксигеназы (ЦОГ), тем самым необратимо блокируя превращение арахидоновой кислоты в простаноиды. Вдобавок считается, что аспирин обеспечивает некоторую защиту от ишемической болезни сердца [1], частично благодаря ингибированию тромбоксана А2, мощного агрегатора тромбоцитов. Сообщалось, что аспирин демонстрирует химиопрофилактическую активность против рака пищевода, желудка и толстой кишки, вызывая апоптоз в эпителиальных клетках и регулируя ангиогенез [2–4]. Аспирин также оказывает множество эффектов на различные виды бактерий.Предыдущие исследования показали, что аспирин может подавлять рост некоторых бактерий, влиять на выработку факторов вирулентности некоторыми бактериями и изменять восприимчивость бактерий к некоторым антибиотикам, влияя на экспрессию генов и вызывая ряд морфологических и физиологических изменений у бактерий [5 ].

Мы ранее сообщали, что НПВП, включая салицилат натрия, аспирин, индометацин и целекоксиб, подавляли рост H pylori дозозависимым образом при инкубации в бульоне бруцелл in vitro [6–9].Эти препараты также существенно влияли на активность факторов вирулентности H pylori , например уреазы и вакуулирующего цитотоксина [8,9]. Кроме того, минимальные ингибирующие концентрации (МПК) кларитромицина, метронидазола и амоксициллина до H pylori снижались при лечении низкой концентрацией аспирина [6–8], что указывает на то, что аспирин увеличивает чувствительность H pylori к этим антимикробным препаратам. .

Целью настоящего исследования было изучить механизмы действия аспирина, повышающего чувствительность H pylori к метронидазолу.Ген rdxA H pylori , обработанный аспирином и без него, анализировали с помощью ПЦР-амплификации и секвенирования. Влияние аспирина на проницаемость внешней мембраны H pylori определяли с использованием [7- 3 H] -тетрациклина. Также было определено влияние аспирина на экспрессию белков внешней мембраны (OMP) H pylori .

МАТЕРИАЛЫ И МЕТОДЫ

Chemicals

Аспирин (Sigma Chemical Co, Сент-Луис, Миссури, США) и карбонилцианид с протонным проводником м-хлорфенилгидразон (CCCP, Sigma Chemical Co.) заранее растворяли в ДМСО (Sigma Chemical Co.). [7- 3 H] -тетрациклин (0,6 Ки / ммоль; 22,2 ГБк / ммоль; Dupont / NEN Research Products, Бостон, Массачусетс) недавно растворяли в разбавленной соляной кислоте.

Штаммы и условия культивирования

H pylori эталонный штамм 26 695 (чувствительный к метронидазолу) и два клинических изолята H pylori (устойчивый к метронидазолу, R1 и R2) были включены в это исследование. Штаммы культивировали на чашках с колумбийским агаром, содержащим 8% овечьей крови, в микроаэробной атмосфере (10% CO 2 и 5% O 2 ) при 37 ° C в течение 2-3 дней. H pylori из 10 8 КОЕ / мл затем инокулировали в 20 мл бульона Brucella (Difco Laboratories, Детройт, штат Мичиган, США) с добавлением 10% фетальной бычьей сыворотки (FBS; Gibco-BRL, Гранд-Айленд, штат Нью-Йорк, США). ) в наборе 10 см чашек Петри с 1 ммоль / л аспирина или с контролем носителя (ДМСО 0,1%). Чашки помещали в анаэробный сосуд (Oxoid) и инкубировали при 37 ° C на шейкере со скоростью 60 об / мин в микроаэробных условиях в течение 48 часов.

Определение МИК

Бактерии готовили в бульоне для инфузии сердца мозга с получением количества жизнеспособных клеток 3 × 10 8 КОЕ / мл (что эквивалентно 1 стандартной единице мутности МакФарланда) и использовали в качестве инокулята для тестирования чувствительности.Бактериальную суспензию (100 мкл) наносили в двух экземплярах на чашки с колумбийским агаром с аспирином (1 ммоль / л) или без него. На каждую пластину наносили одну тест-полоску метронидазола (OXOID Ltd, Англия). МИК метронидазола и возможное влияние аспирина на МИК метронидазола определяли через 72 часа инкубации при 37 ° C в микроаэробных условиях.

Экстракция геномной ДНК

H pylori геномная ДНК была экстрагирована с использованием метода диоксицида кремния.Клетки собирали и дважды промывали фосфатно-солевым буфером (PBS) (0,01 моль / л, pH 7,2). Осаждение клеток суспендировали в 100 мкл ТЕ. Затем 5 мкл SiO 2 Liq. и 400 мкл связывающего буфера (содержащего 4 моль / л изотиоцианата гуанидиния, 50 ммоль / л трис-HCl, 20 ммоль / л EDTA) добавляли и инкубировали при 55 ° C в течение 5 минут при встряхивании один раз в минуту. Суспензию центрифугировали при 8000 об / мин в течение 30 с при комнатной температуре и осадок трижды промывали очищающим буфером (содержащим 20 ммоль / л Трис-HCl, 1 ммоль / л EDTA, 100 ммоль / л NaCl и дегидратированный спирт).Полученную суспензию сушили при 55 ° C и хранили при -20 ° C.

Амплификация гена rdxA H. pylori и секвенирование

Фрагменты (886 п.н.), содержащие полный ген rdxA , амплифицировали с помощью ПЦР. Прямой праймер: 5′-AGGGATTTTATTGTATGCTACAA-3 ‘; Обратный праймер: 5’-AGGAGCATCAGATAGTTCTGA-3 ‘. ПЦР-амплификацию проводили в 25 мкл реакционного раствора, содержащего 2 мкл геномной ДНК H pylori , 4,5 мкл 10-кратного буфера для ПЦР (с 15 мкмоль / л MgCl 2 ), 2 мкл dNTP (по 2 каждого.5 ммоль / л), 2 мкл прямого и обратного праймеров (каждый 5 мкмоль / л), 0,5 мкл TaqDNA-полимеразы (1 ед. / Мкл) и 9 мкл ddH 2 O. Первоначально реакцию денатурировали при 94 °. C в течение 5 мин, затем 30 циклов, каждый из которых состоит из 30 с при 94 ° C (денатурация), 1 мин при 52 ° C (отжиг) и 1 мин при 72 ° C (удлинение). После окончательного продления в течение 10 минут при 72 ° C ампликоны подвергали электрофорезу в 1,5% агарозном геле и очищали с использованием метода диоксицида кремния, как описано выше. Полученный ген rdxA секвенировали с помощью процедуры терминации дидезокси-цепи в Beijing Li-Jia-Tai-Cheng Technology Company.Гены rdxA H pylori , обработанные аспирином и без него, были проанализированы в режиме онлайн (http://align.genome.jp).

Исследования поглощения с использованием [7-

3 H] тетрациклина

Штамм 26 695 выращивали до средне-логарифмической фазы (приблизительно от 3 × 10 9 до 5 × 10 9 КОЕ / мл) в бульоне Brucella и затем добавляли 1 ммоль / л аспирина или ДМСО (<1%, контроль носителя) в течение 6 часов при 37 ° C на шейкере при 60 об / мин в микроаэробных условиях.Суспензию клеток центрифугировали при 8000 об / мин в течение 10 мин при комнатной температуре, осадок промывали и суспендировали в буфере HEPES (pH 7,2, содержащий 100 мкмоль / л MgCl 2 ). При комнатной температуре к 10 мл клеточной суспензии добавляли 5 мкКи [7- 3 H] -тетрациклин (0,6 Ки / ммоль; 22,2 ГБк / ммоль; Dupont / NEN Research Products, Бостон, США). Через 20 мин каждую клеточную суспензию делили на две половины и к половине добавляли 100 мкмоль / л CCCP. Аликвоты по 1 миллилитру отбирали с 10-минутными интервалами и трижды промывали PBS.Затем полученные гранулы разбавляли сцинтилляционной жидкостью и анализировали на радиоактивность в сцинтилляционном счетчике (TRI-CARB 2100TR).

Очистка OMPs

H. pylori 26 695 инкубировали в бульоне Brucella в течение 48 часов. Суспензию центрифугировали при 8000 об / мин в течение 10 минут, промывали и суспендировали в ледяном буфере Трис-Mg (10 ммоль / л Трис-HCl, содержащий 5 ммоль / л MgCl 2 , pH 7,3) и обрабатывали ультразвуком (один раз. 30 с с интервалом 3-5 с в течение 5 мин) до тех пор, пока большая часть клеток не будет разрушена, как это видно под микроскопом.Неразрушенные клетки удаляли центрифугированием при 8000 об / мин в течение 20 мин при 4 ° C. Внутреннюю и внешнюю мембраны концентрировали центрифугированием при 50 000 об / мин в течение 60 мин при 4 ° C. Осадок суспендировали в 2% Triton Tris-Mg (pH 7,5) и инкубировали в течение 30 минут при комнатной температуре, а затем центрифугировали и снова инкубировали в тех же условиях. Полученные гранулы, OMP, дважды промывали 10 ммоль / л трис-HCl и растворяли в ddH 2 О. Конечную концентрацию OMP определяли методом кумасси бриллиантового синего R250.

Гель-электрофорез в SDS-PAGE

Десять микрограмм OMP использовали для гель-электрофореза в SDS-PAGE при постоянном напряжении (5% -ный гель-стекинг при 60 В, 10% -ный разделяющий гель при 100 В). После 30 мин инкубации в фиксирующей жидкости гель окрашивали кумасси бриллиантовым синим G250 в течение 30 мин.

Выделение тотальной РНК и обратная транскрипция

Общую РНК получали методом TRIzol, как описано производителем (Invitrogen, Burlington, Ontario, Canada), и загрязняющую ДНК удаляли обработкой ДНКазой I в соответствии с инструкциями производителя (Sigma) .Для синтеза кДНК 4 мкг РНК, разбавленной DEPC H 2 O, нагревали до 70 ° C в течение 5 минут и быстро охлаждали на льду в течение 15 минут. Затем образцы добавляли к 20 мкл реакционной смеси, содержащей 2 мкл случайных гексамерных праймеров (1 мкг / мкл), 0,4 мкл RNasin, 1 мкл M-MLV, 4 мкл dNTP (каждый 2,5 ммоль / л) и 4 мкл 5 × RT буфера. Реакцию синтеза кДНК проводили в течение 60 мин при 37 ° C. Затем фермент инактивировали при 95 ° C в течение 5 мин. Аликвоты кДНК хранили при -70 ° C.

Количественная ПЦР в реальном времени

Уровни мРНК hopA, hopB, hopC, hopD, hopE и hefA, hefB, hefC определяли с помощью ПЦР в реальном времени с использованием системы обнаружения последовательностей ABI Prism 7700 (Perkin-Elmer Applied Biosystems, Фостер-Сити, Калифорния.). Специфические праймеры и зонды TaqMan были сконструированы с помощью программы Primer Express 3.0 (Perkin-Elmer Applied Biosystems) (таблица). Стандартная кривая была построена с использованием 10-кратных серийных разведений каждой кДНК. Реакционные смеси для ПЦР (50 мкл) готовили путем смешивания 5 мкл раствора синтезированной кДНК с 5 мкл 10-кратного буфера для ПЦР (содержащего 15 мкмоль / л MgCl 2 ), 3 мкл прямого и обратного праймеров (каждый по 5 мкмоль / л). , 4 мкл dNTP (каждый 2,5 ммоль / л), 2 мкл зонда TagMan, 1 мкл ROX, 0,5 мкл полимеразы TaqDNA (1 ед. / Мкл).ПЦР проводили при 95 ° C в течение 10 минут, затем 40 циклов при 95 ° C в течение 15 секунд и 60 ° C в течение 60 секунд в соответствии с инструкциями производителей. Уровни мРНК белка выражали как отношение мРНК белка к мРНК 16S рРНК [соотношение мРНК белка (ед. / Мл) / мРНК 16S рРНК (ед. / Мл) × 100 000]. ПЦР проводили пятикратно с использованием образцов, приготовленных одновременно.

Таблица 1

Праймеры и зонды, используемые в количественной ПЦР в реальном времени

TAACGCTAGCCAACAACGCTAACATCAGCA CGCTCTTTATAACGCGCAAGTAA GCTGTTCCCGGCTCTGAATC 905 AGACAAACAGGCTCAAAGCGATTCC
Тип зонда или праймера Последовательность (5′-3 ‘)
hopA F ATCATGCTAGTGATGGCGTTAAAG
HOPA R CAGGCATAGACGGAGGCAAT
HOPA зонд CCAAAAATATTGCATGCGTTCCCGC
hopB F CTTGGTGCAAAACATCGTCAAT
hopB R CCCGCCATAGCTCACTTGAT
hopB зонд
hopC F
hopC R
hopC зонд TGGATAAAATCAACGCGCTCAACAATCAG 900 52
hopD F CTGCTTGAGCGCGGTTTAA
hopD R CAACCTAGACACTGGGAAAGCAT
hopD Зонд CTTGCGCTCTAGCGTTAGCGAACATGC
надежду на F GGATTGCACAGGGAGTGTTGT
надежду на то, R GCCCCATTAGCGTATTTAGCAT
надежду на зонд TTGCCCCCCAGGTCTTACCGCT
Hefa F AGGGCGTTTTGGGAATTTCT
Hefa R GCATGATGGATTGTTTTTGCA
Hefa зонд CCCCGGTCAGCAAAATACGGCTG
hefB F AGGGCGATGTTTTGTTGCTT
hefB ICCCAATTTTGCTGTATCGT
hefB A Зонд
hefC F GTTTGCGTTCTTGCGTAACG
hefC R TGTTTAATGAAAAGCCCATCCA
hefC Зонд CACGATCACCCTCGTTTCAGCGATC
16S рРНК F CCGCCTACGCGCTCTTTAC
16S рРНК R CTAACGAATAAGCACCGGCTAAC
16S рРНК Зонд CCCAGTGATTCCGAGTAACGCTTGCA

Статистический анализ SAS

Статистический анализ был проведен с использованием статистического анализа SSSS.0. Репрезентативные данные внутриклеточной радиоактивности и количественной ПЦР были представлены как среднее ± стандартное отклонение. Для сравнения данных использовался тест Стьюдента t . P <0,05 считали статистически значимым.

РЕЗУЛЬТАТЫ

Влияние аспирина на МИК метронидазола

Для штамма R1 МИК метронидазола снизилась с 256 мкг / мл до 0,25 мкг / мл в присутствии аспирина (1 ммоль / л), а для штамма R2 — МИК метронидазола уменьшилось с 64 мкг / мл до значения ниже читаемого (0.016 мкг / мл), что указывает на то, что аспирин увеличивает чувствительность H pylori к метронидазолу и превращает эти два устойчивых штамма в чувствительные штаммы.

Влияние аспирина на мутации гена rdxA

Фрагменты ДНК длиной 886 п.н., содержащие полный ген rdxA , амплифицировали с помощью ПЦР для эталонного штамма H pylori 26 695 и двух штаммов, устойчивых к метронидазло (R1, R2), обработанных или без аспирина. Анализ последовательности выявил точечные мутации, вставки и делеции в гене rdxA штамма R2 по сравнению с эталонным штаммом 26 695, а нуклеотидная гомология между двумя штаммами (26 695 и R2) составила 94.4%. Однако нуклеотидная гомология гена rdxA между штаммом R2 и его соответствующим изолятом R2 (A) (штамм R2, обработанный аспирином) составляла более 99,5% (рисунок и рисунок).

Сравнение последовательностей на линии (http://align.genome.jp) гена rdxA между устойчивым к метронидазолу штаммом (R2) и эталонным штаммом H pylori 26 695 (S).

Сравнение последовательностей на линии (http://align.genome.jp) гена rdxA между устойчивым к метронидазолу штаммом (R2) и его соответствующим чувствительным штаммом в присутствии аспирина [R2 (A)].

Влияние аспирина на проницаемость внешней мембраны H. pylori

Независимо от присутствия CCCP, радиоактивность H pylori , обработанного аспирином, была выше по сравнению с контрольным носителем (DMSO), что указывает на усиление аспирина. проницаемость наружной мембраны H pylori для антимикробного препарата (рисунок). Независимо от присутствия аспирина, радиоактивность клеток H pylori снижалась при добавлении ингибитора эффлюксной помпы CCCP, что указывает на то, что аспирин не влияет на коллапсирующий эффект CCCP на градиент протонов через цитоплазматическую мембрану H pylori . (Фигура ).

Радиоактивность клеток H pylori , обработанных аспирином (1 ммоль / л) или контрольным носителем (ДМСО). A: CCCP; B: Нет CCCP.

Радиоактивность клеток H pylori , обработанных CCCP (100 мкмоль / л) или без CCCP. A: Аспирин; B: Управление транспортным средством.

Влияние аспирина на профили OMP

Профили OMP H pylori , обработанного аспирином, были аналогичны таковым в контроле. Однако экспрессия двух OMP (Band 1 и 2) между 55 и 72 кДа изменялась в присутствии аспирина (рисунок).

Профили OMP H pylori 26 695. M: Маркер размера; C: Контроль; D: ДМСО; A: Аспирин. Группа 1: OMP увеличивается в присутствии аспирина; Группа 2: OMP снизился в присутствии аспирина.

Влияние аспирина на экспрессию мРНК поринов и системы оттока

Количественная ПЦР в реальном времени показала отсутствие значительных различий в уровнях кДНК hopA, hopB, hopC, hopD, hopE и hefA, hefB, hefC для штаммов, получавших аспирин, по сравнению с контролем.Это указывало на то, что независимо от присутствия аспирина экспрессия уровней мРНК hopA, hopB, hopC, hopD, hopE и hefA, hefB, hefC не изменялась (таблица).

Таблица 2

кДНК Уровни поринов и система оттока H. pylori , протестированные с помощью количественной ПЦР в реальном времени

905 285,8 ± 5,07
Уровни кДНК
Ген Группа аспирина ДМСО-контроль Пустой контроль
hopA 963.60 ± 23,33 1087,75 ± 26,42 856,27 ± 25,43
hopB 84,00 ± 15,97 91,45 ± 14,83 100,15 ± 16,28
9008 ± 16,28
9008 ± 16,28 ± 12,01 52,79 ± 10,27
hopD 83,86 ± 14,09 92,46 ± 17,78 89,92 ± 13,72
hopE 54.07 ± 10,58 52,77 ± 11,93 52,12 ± 9,92
hefA 12,31 ± 2,12 12,51 ± 1,99 12,97 ± 2,76
hefB ,47 25,60 ± 4,99
hefC 55,62 ± 8,89 52,08 ± 9,78 53,37 ± 10,04

ОБСУЖДЕНИЕ

H pylori — отрицательная спиралевидная бактерия. и важный патоген для человека, который колонизирует в желудке 50% населения мира [10,11].Инфекция приводит к хроническому воспалению слизистой оболочки желудка и язвенной болезни, и было доказано, что инфекция H pylori тесно связана с аденокарциномой и лимфомой лимфоидной ткани, связанной со слизистой оболочкой (MALT). Международное агентство по изучению рака при Всемирной организации здравоохранения (ВОЗ) определило H pylori как один из канцерогенов первого класса для человека [12]. Недавние исследования показали, что инфекция H pylori играет важную роль в инвазии сосудистых заболеваний сердца и головного мозга, аутоиммунных заболеваний, нарушений питания и обмена веществ, гематопатии и дерматологических заболеваний.Искоренение инфекции H pylori очень важно для предотвращения и лечения этих заболеваний. Наиболее успешные схемы лечения используют комбинации двух или более антибиотиков, таких как амоксициллин, кларитромицин, метронидазол или тетрациклин, вместе с ингибитором протонной помпы или висмутом. Однако с широким использованием противомикробных препаратов в клинической практике устойчивость к антибиотикам становится все более очевидной и считается одной из основных причин неэффективности лечения [13].

Ранние исследования показали, что салицилат подавлял рост некоторых бактерий, таких как Escherichia coli , Klebsiella pneumoniae , Pseudomonas aeruginosa и Staphylococcus epidermidis , а также влиял на активность фимбрий, жгутиков и производство биофильм. , слизь, и, таким образом, может изменить патогенность бактерий [14–21].Сообщалось, что in vitro , салицилат может изменять чувствительность бактерий к некоторым противомикробным препаратам. Салицилат индуцировал внутренний фенотип множественной антимикробной устойчивости у многих бактерий, таких как Escherichia coli , Salmonella typhimurium и Staphylococcus aureus , и повышал чувствительность некоторых бактерий к аминогликозидам [22–29]. Наши предыдущие исследования также показали, что in vitro аспирин не только подавлял рост H pylori [6–9], но также снижал МИК метронидазола, кларитромицина и амоксициллина до H pylori и даже преобразовывал некоторые устойчивые штаммы. к восприимчивым [6–8].Таким образом, в настоящем исследовании изучались механизмы увеличения восприимчивости H pylori к метронидазолу аспирином.

По крайней мере, четыре отличительных механизма устойчивости к антибиотикам описаны у бактерий: ферментативная инактивация, снижение проницаемости бактериальных мембран, активный отток антимикробных агентов и изменение участков-мишеней противомикробных препаратов для бактерий [30]. Метронидазол, кларитромицин и амоксициллин — это разные виды противомикробных препаратов, и каждый по-разному действует на разные участки-мишени в H pylori .Точно так же устойчивость H pylori к этим антимикробным агентам возникает по разным механизмам. Разумное объяснение того, что аспирин увеличивает чувствительность H pylori к противомикробным препаратам с различными антибактериальными механизмами, заключается в том, что аспирин не изменяет целевые участки бактерий, но увеличивает внутриклеточные концентрации противомикробных препаратов.

Метронидазол — пролекарство, активируемое нитроредуктазами в клетках бактерий. Устойчивость к метронидазолу вызывается либо отсутствием, либо инактивацией нитроредуктаз [31].Сообщалось, что устойчивость H pylori к метронидазолу была вызвана в основном нулевыми мутациями в гене rdxA , который кодирует нечувствительную к кислороду НАДФН-нитроредуктазу [32]. Однако исследования также сообщили об участии других редуктаз в развитии резистентного фенотипа. Помимо нечувствительных к кислороду НАДФН-нитроредуктаз, было обнаружено, что несколько других нитроредуктаз в H pylori , такие как НАДФН-флавин-оксидоредуктаза, ферредоксин-подобный белок, флаводоксин, α-кетоглутарат-оксидоредуктаза и пируват: флаводоксин-оксидоредуктаза и пируват: флаводоксин-оксидоредуктаза восстанавливают и генерируют метаводоксин-оксидоредуктазу. активные соединения [33,34].В нашем исследовании мутации в гене rdxA могут быть связаны с устойчивостью изолированного штамма (R2). Однако в присутствии аспирина штамм превращался из устойчивого к метронидазолу в чувствительный, а мутации в гене rdxA не изменялись. Используя метод изотопной сцинтилляции с [7- 3 H] -тетрациклином, наше исследование показало, что аспирин увеличивает внутриклеточную концентрацию антимикробных препаратов в клетках H pylori , указывая на то, что аспирин увеличивает проницаемость внешней мембраны H pylori для противомикробных препаратов. .При более высокой внутриклеточной концентрации в присутствии аспирина метронидазол может снижаться и активироваться другими нитроредуктазами в H pylori . Таким образом, MIC H pylori по отношению к метронидазолу снизился, а в некоторых случаях устойчивые штаммы даже превратились в чувствительные.

В механизмах увеличения концентрации противомикробных препаратов в клетках бактерий могут быть задействованы два пути. Один из них — увеличение количества антимикробных препаратов, пассивно проникающих в клетки бактерий; другой — нарушение активной откачки противомикробных препаратов из бактерий.Предыдущие исследования Escherichia coli показали, что салицилат повышает устойчивость к нескольким антибиотикам, включая хинолоны, цефалоспорины, ампициллин, налидиксовую кислоту, тетрациклин и хлорамфеникол [22]. Аспирин может индуцировать ген множественной устойчивости к антибиотикам ( mar ), изменять экспрессию OMP и снижать проницаемость внешней мембраны для противомикробных препаратов или увеличивать отток антимикробных препаратов [35–38]. Существуют три основные системы захвата через внешнюю мембрану [39], а именно: поглощение гидрофильных веществ через заполненные водой каналы поринов, поглощение поликатионов через саморекламу на сайтах связывания двухвалентных катионов на липополисахариде и поглощение гидрофобные вещества через бислой внешней мембраны.Бактерии могли продуцировать множество поринов и регулировать относительное количество различных поринов в ответ на осмолярность окружающей среды. По крайней мере, пять поринов, названных HopA, HopB, HopC, HopD и HopE (часть 32-членного семейства белков внешней мембраны) присутствовали в одной клетке H pylori [40,41]. Считалось, что эти порины связаны с устойчивостью к антибиотикам [40]. С другой стороны, некоторые бактерии экспрессировали мембранную транспортную систему, которая приводила к множественной лекарственной устойчивости за счет оттока лекарств.Три предполагаемых системы оттока RND, HefABC, HefDEF и HefGHI, идентифицированные в H pylori , могут быть коррелированы с устойчивостью к антибиотикам [42]. Из трех систем оттока только HefABC участвует в формировании множественной лекарственной устойчивости in vitro [42]. Таким образом, мы протестировали пять генов порина ( hopA , hopB , hopC , hopD и hopE ) и гены белка оттока ( hefA , hefB , hefC ) с использованием реальных время количественной ПЦР, и обнаружили, что аспирин не мешает экспрессии вышеуказанных белков на уровнях транскрипции гена.

Изменение проницаемости внешней мембраны H pylori должно сопровождаться модификацией некоторых родственных OMP. В настоящем исследовании экспрессия двух OMP H pylori между 55 и 72 кДа изменялась в присутствии аспирина. Однако функции и идентификация этих OMP должны быть определены с помощью двумерного электрофореза и анализа масс-спектра белка. Если эти OMP были связаны с увеличением проницаемости внешней мембраны H pylori , необходимо провести дальнейшие исследования, чтобы определить, происходят ли функциональные и фенотипические изменения этих OMP в присутствии аспирина на уровнях трансляции или модификации белка. , или некоторые другие порины или системы оттока.

Park et al [43] провели пилотное исследование, направленное на сравнение эффективности стандартного режима омепразол-амоксициллин-кларитромицин (OAC) с комбинированным режимом OAC и аспирином (OACA). Последующие эндоскопические исследования показали, что предыдущие язвы полностью зажили у всех пациентов. Хотя уровень эрадикации в группе OACA (86,7%) был выше, чем в группе OAC (80,3%), статистически значимой разницы между двумя группами не было. Общие нежелательные явления были одинаковыми в двух группах.Режим OACA хорошо переносился в группе пациентов с язвенной болезнью. Потенциал аспирина и других НПВП для клинического использования в повышении эффективности эрадикации H pylori может потребовать дальнейших исследований.

В связи с повышенным вниманием, уделяемым повреждению H pylori и устойчивости противомикробных препаратов к этому микроорганизму, необходимо срочно исследовать новые эффективные терапевтические схемы. Изучение молекулярных механизмов аспирина, повышающих чувствительность H pylori к противомикробным препаратам, поможет найти более эффективный режим эрадикации в клинической практике.

КОММЕНТАРИИ

Предпосылки

Сообщалось, что аспирин подавлял рост Helicobacter pylori ( H pylori ), а минимальная ингибирующая концентрация (МПК) кларитромицина, метронидазола и амоксициллина до H pylori снижалась при лечении аспирин. Это указывает на то, что аспирин увеличивает чувствительность H pylori к этим противомикробным препаратам и даже превращает некоторые устойчивые штаммы в чувствительные.

Границы исследований

Инфекция H. pylori приводит к хроническому воспалению слизистой оболочки желудка, язвенной болезни и тесно связана с аденокарциномой и лимфомой лимфоидной ткани, ассоциированной со слизистой оболочкой (MALT). Недавние исследования показали, что инфекция H pylori играет важную роль в инвазии сосудистых заболеваний сердца и головного мозга, аутоиммунных заболеваний, нарушений питания и обмена веществ, гематопатии и дерматологических заболеваний. Таким образом, искоренение инфекции H pylori очень важно для предотвращения и лечения этих заболеваний.Однако с широким использованием противомикробных препаратов в клинической практике устойчивость к антибиотикам стала очевидной и считается одной из основных причин неэффективности лечения.

Инновации и прорывы

In vitro аспирин снизил МИК метронидазола, кларитромицина и амоксициллина до H pylori и даже преобразовал некоторые устойчивые штаммы в чувствительные. В этом исследовании изучались механизмы действия аспирина, повышающего чувствительность H pylori к метронидазолу.

Приложения

Изучение молекулярных механизмов аспирина, повышающих чувствительность H pylori к антимикробным препаратам, поможет более интенсивно понять механизмы устойчивости H pylori к антибиотикам и выявить более эффективный режим эрадикации в клинической практике.

Терминология

Карбонилцианид м-хлорфенилгидразон (CCCP), своего рода ингибитор оттока, который эффективен при микромолярной концентрации, может изменять градиент pH через цитоплазматическую мембрану, таким образом, лишает запас энергии транспортного белка.

Экспертный обзор

Авторы интенсивно сообщают, что нестероидные противовоспалительные препараты (НПВП), включая салицилат натрия, аспирин, индометацин и целекоксиб, ингибируют рост H pylori дозозависимым образом и изменяют восприимчивость. H pylori к антибиотикам.

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *